The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP009775	Klebsiella pneumoniae subsp. pneumoniae strain KPNIH32 chromosome, complete genome	5515525	593006	598831	5515525		Enterobacteria_phage(100.0%)	8	NA	NA
WP_004152202.1|593006_593573_-	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	63.8	9.7e-59
WP_004152203.1|593590_593836_-	ogr/Delta-like zinc finger family protein	NA	Q7M294	Enterobacteria_phage	56.8	5.5e-19
WP_004152204.1|593832_594570_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	59.4	1.1e-70
WP_000556592.1|595130_595397_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	71.6	2.0e-30
WP_004153681.1|595393_595942_+	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	69.4	1.1e-30
WP_004152205.1|595938_596166_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152206.1|596162_596483_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_004152207.1|596497_598831_+	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	83.9	0.0e+00
>prophage 2
NZ_CP009775	Klebsiella pneumoniae subsp. pneumoniae strain KPNIH32 chromosome, complete genome	5515525	1067077	1078731	5515525	integrase	Enterobacteria_phage(70.0%)	13	1055211:1055225	1078268:1078282
1055211:1055225	attL	AGCGCGGAGAGATTG	NA	NA	NA	NA
WP_002889890.1|1067077_1069411_-	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	82.2	0.0e+00
WP_002889897.1|1069422_1069743_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_002889911.1|1069739_1069967_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024940872.1|1069963_1070521_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	70.4	1.8e-33
WP_002889915.1|1070517_1070784_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	71.6	2.6e-30
WP_002889917.1|1071325_1072063_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	60.7	9.0e-73
WP_002889919.1|1072059_1072305_+	ogr/Delta-like zinc finger family protein	NA	Q7M294	Enterobacteria_phage	58.0	1.9e-19
WP_002889930.1|1072322_1072889_+	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	64.3	1.5e-59
WP_004152979.1|1073457_1073883_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152029.1|1073882_1074833_-	AAA family ATPase	NA	A0A1X9IGI7	Lactococcus_phage	27.1	1.2e-13
WP_002889938.1|1074820_1076011_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	62.7	6.4e-145
WP_002889940.1|1076363_1077617_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	44.9	8.9e-89
WP_004144574.1|1077627_1078731_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.5	4.8e-62
1078268:1078282	attR	AGCGCGGAGAGATTG	NA	NA	NA	NA
>prophage 3
NZ_CP009775	Klebsiella pneumoniae subsp. pneumoniae strain KPNIH32 chromosome, complete genome	5515525	1288286	1333561	5515525	holin,lysis,head,tRNA	Escherichia_phage(25.0%)	65	NA	NA
WP_004143010.1|1288286_1289672_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.4	3.5e-46
WP_004143016.1|1289717_1289930_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_004143017.1|1289931_1290798_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	34.8	1.3e-30
WP_004151317.1|1292268_1292604_-	excisionase family DNA-binding protein	NA	NA	NA	NA	NA
WP_004151316.1|1292605_1292821_-	TraR/DksA family transcriptional regulator	NA	A0A0K2FI84	Escherichia_phage	52.9	4.0e-13
WP_004151314.1|1292822_1293041_-	hypothetical protein	NA	A0A1I9LJM7	Stx_converting_phage	47.2	1.2e-09
WP_004151312.1|1293037_1293805_-	hypothetical protein	NA	D5LH17	Escherichia_phage	53.4	1.7e-66
WP_004151310.1|1293801_1294458_-	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	87.5	2.7e-113
WP_004151308.1|1294454_1294613_-	DUF1317 family protein	NA	A0A0N7CHV0	Escherichia_phage	60.8	3.0e-10
WP_004151306.1|1294609_1295290_-	YqaJ viral recombinase family protein	NA	A0A0M3ULE0	Salmonella_phage	93.4	7.9e-124
WP_004151305.1|1295286_1296132_-	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	59.2	6.9e-69
WP_004151304.1|1296147_1296432_-	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	62.8	8.0e-30
WP_004151303.1|1296520_1296715_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151302.1|1296707_1296818_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151301.1|1296814_1297030_-	hypothetical protein	NA	B5WZV1	Pseudomonas_phage	48.6	1.6e-09
WP_004151300.1|1297380_1298070_-	helix-turn-helix transcriptional regulator	NA	G8C7U1	Escherichia_phage	52.2	4.3e-61
WP_004151299.1|1298197_1298431_+	helix-turn-helix domain-containing protein	NA	G8C7U2	Escherichia_phage	50.7	4.3e-13
WP_001548453.1|1298471_1298693_+	hypothetical protein	NA	G8EYH8	Enterobacteria_phage	41.7	6.9e-05
WP_004151298.1|1298778_1298925_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004230546.1|1298965_1299817_+	hypothetical protein	NA	F1C5C3	Cronobacter_phage	56.3	5.3e-85
WP_004230547.1|1299821_1301237_+	AAA family ATPase	NA	Q9MCT4	Escherichia_phage	67.1	1.8e-183
WP_004151295.1|1301236_1301530_+	protein ren	NA	O48423	Enterobacteria_phage	65.6	3.3e-26
WP_004151294.1|1301526_1302033_+	hypothetical protein	NA	A0A0A6Z565	Enterobacter_phage	59.6	3.0e-27
WP_004151293.1|1302139_1302982_+	ead/Ea22-like family protein	NA	A0A2H4FRZ0	Salmonella_phage	60.8	1.8e-29
WP_004151292.1|1302981_1303158_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151291.1|1303154_1303802_+	DUF551 domain-containing protein	NA	A5LH60	Enterobacteria_phage	32.6	4.5e-12
WP_004151288.1|1304302_1304758_+	hypothetical protein	NA	K7P7B8	Enterobacteria_phage	69.5	8.0e-56
WP_004151287.1|1304757_1304928_+	NinE family protein	NA	G8C7V4	Escherichia_phage	73.2	1.3e-14
WP_004151286.1|1304920_1305556_+	recombination protein NinG	NA	M9NYX8	Enterobacteria_phage	77.9	2.7e-81
WP_004151285.1|1305552_1305690_+	YlcG family protein	NA	NA	NA	NA	NA
WP_004151284.1|1305682_1306213_+	HNH endonuclease	NA	A0A193GYW9	Enterobacter_phage	43.1	5.2e-30
WP_004151283.1|1306209_1306899_+	antitermination protein	NA	I6PDF8	Cronobacter_phage	54.5	1.4e-56
WP_004151282.1|1307808_1308057_+|holin	class II holin family protein	holin	NA	NA	NA	NA
WP_004151281.1|1308059_1308590_+	lysozyme	NA	G9L6J6	Escherichia_phage	78.5	6.0e-79
WP_004151280.1|1308586_1309051_+|lysis	lysis protein	lysis	Q76H63	Enterobacteria_phage	73.2	2.4e-55
WP_004151279.1|1309156_1309486_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151277.1|1309856_1310459_+	hypothetical protein	NA	G8C7P2	Escherichia_phage	80.9	5.4e-76
WP_004151276.1|1310458_1311931_+	hypothetical protein	NA	A0A1W6JNY3	Morganella_phage	82.5	1.3e-248
WP_004151275.1|1311943_1313365_+	DUF1073 domain-containing protein	NA	F1C5D7	Cronobacter_phage	57.1	9.6e-148
WP_004151274.1|1313339_1314344_+|head	phage head morphogenesis protein	head	F1C5D8	Cronobacter_phage	69.7	9.0e-116
WP_004151273.1|1314385_1314862_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151272.1|1314934_1316320_+	DUF2213 domain-containing protein	NA	F1C5D9	Cronobacter_phage	60.0	2.3e-154
WP_004151271.1|1316323_1316752_+	hypothetical protein	NA	F1C5E0	Cronobacter_phage	60.8	1.6e-42
WP_004151270.1|1316763_1317858_+	hypothetical protein	NA	F1C5E1	Cronobacter_phage	62.8	1.7e-123
WP_004151269.1|1317868_1318108_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151268.1|1318110_1318491_+	hypothetical protein	NA	F1C5E2	Cronobacter_phage	55.3	5.3e-29
WP_004151267.1|1318490_1318664_+	hypothetical protein	NA	I6R0P9	Salmonella_phage	56.1	1.4e-13
WP_004151266.1|1318663_1319026_+	hypothetical protein	NA	A0A173GCE0	Salmonella_phage	45.0	1.8e-18
WP_004151265.1|1319028_1319454_+	hypothetical protein	NA	R9TPP7	Aeromonas_phage	47.9	5.1e-28
WP_004151264.1|1319450_1319843_+	hypothetical protein	NA	G0ZNE4	Cronobacter_phage	52.7	5.1e-35
WP_004151263.1|1319911_1320664_+	Ig domain-containing protein	NA	G0ZNE6	Cronobacter_phage	42.1	5.8e-43
WP_004151262.1|1320716_1321394_+	hypothetical protein	NA	F1C5E8	Cronobacter_phage	57.9	4.8e-73
WP_004151261.1|1321569_1322325_+	KilA-N domain-containing protein	NA	K7PGT4	Enterobacteria_phage	51.0	2.4e-60
WP_004151260.1|1322327_1322582_+	hypothetical protein	NA	K7PM89	Enterobacteria_phage	73.0	6.7e-20
WP_004151259.1|1322875_1323346_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151258.1|1323362_1323722_-	Arc family DNA-binding protein	NA	A0A0P0ZBD1	Stx2-converting_phage	47.5	3.8e-16
WP_004151257.1|1323821_1323992_+	Arc family DNA-binding protein	NA	I6R9A8	Salmonella_phage	87.0	6.1e-17
WP_004151256.1|1323981_1324695_+	hypothetical protein	NA	H6WRU8	Salmonella_phage	50.2	3.9e-49
WP_004151255.1|1324760_1325546_+	phage repressor protein	NA	A0A2L1IV39	Escherichia_phage	59.7	1.9e-84
WP_004151254.1|1325673_1326177_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151253.1|1326269_1329716_+	tape measure protein	NA	Q5G8W8	Enterobacteria_phage	48.6	1.4e-163
WP_004151252.1|1329758_1330235_+	hypothetical protein	NA	A0A2P1MXB5	Escherichia_phage	49.7	3.0e-37
WP_004199076.1|1330234_1330705_+	hypothetical protein	NA	R9TPR6	Aeromonas_phage	41.0	2.5e-28
WP_004151250.1|1330701_1331097_+	C40 family peptidase	NA	F1C5F2	Cronobacter_phage	54.0	8.0e-36
WP_004151249.1|1331083_1333561_+	MoaD/ThiS family protein	NA	F1C5A7	Cronobacter_phage	45.6	2.7e-198
>prophage 4
NZ_CP009775	Klebsiella pneumoniae subsp. pneumoniae strain KPNIH32 chromosome, complete genome	5515525	1779966	1817302	5515525	head,portal,terminase,tail,lysis,plate,integrase,capsid	Salmonella_phage(87.18%)	47	1779874:1779892	1817374:1817392
1779874:1779892	attL	CAGGCAACAAAAAACCCAT	NA	NA	NA	NA
WP_014342959.1|1779966_1780947_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.2	1.4e-97
WP_004178082.1|1781434_1782922_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_004150866.1|1783020_1783965_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152885.1|1783976_1784855_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	39.9	1.7e-30
WP_000188448.1|1785000_1785222_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000460893.1|1785254_1785764_+	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
WP_000956179.1|1785771_1785972_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	97.0	1.6e-32
WP_000963473.1|1785935_1786277_+	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	99.1	4.6e-56
WP_004150864.1|1786344_1786578_+	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	96.1	4.1e-32
WP_000752622.1|1786577_1786805_+	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	98.7	6.0e-36
WP_004150863.1|1786801_1787659_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	95.4	2.0e-156
WP_004150862.1|1787655_1790070_+	replication endonuclease	NA	E5G6L9	Salmonella_phage	97.5	0.0e+00
WP_001154434.1|1790223_1790412_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
WP_001217575.1|1790422_1790656_+	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_000700647.1|1790770_1791448_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004199124.1|1791723_1793466_+	AIPR family protein	NA	NA	NA	NA	NA
WP_002895959.1|1793527_1794553_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	86.7	7.6e-171
WP_004150858.1|1794552_1796319_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.0	0.0e+00
WP_002895967.1|1796461_1797295_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	88.8	6.3e-123
WP_002895972.1|1797311_1798370_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.1	1.1e-180
WP_000059191.1|1798373_1799024_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
WP_002896151.1|1799119_1799584_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	8.4e-77
WP_002896155.1|1799583_1799787_+|tail	tail protein X	tail	A0A1S6KZY4	Salmonella_phage	88.1	1.3e-29
WP_002896158.1|1799790_1800006_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	90.1	3.6e-30
WP_002896161.1|1799986_1800496_+	lysozyme	NA	E5G6N1	Salmonella_phage	83.4	2.1e-81
WP_002896163.1|1800500_1800884_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	42.0	2.1e-17
WP_002896168.1|1800880_1801309_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	77.9	9.6e-51
WP_002896170.1|1801295_1801442_+	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	76.1	6.0e-13
WP_002896172.1|1801404_1801836_+|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	82.5	9.9e-64
WP_002896175.1|1801828_1802275_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	71.2	2.2e-50
WP_004150857.1|1802271_1802964_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002896177.1|1803058_1803631_+|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	72.3	4.7e-77
WP_002896179.1|1803627_1803990_+	GPW/gp25 family protein	NA	A0A1S6KZZ4	Salmonella_phage	84.7	5.8e-49
WP_002896182.1|1803976_1804885_+|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	66.9	7.6e-106
WP_004150856.1|1804877_1805477_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	60.5	1.3e-58
WP_019724930.1|1807695_1808430_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002896186.1|1808433_1809165_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002896188.1|1809161_1809365_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002896191.1|1809394_1810471_+|tail	phage tail protein	tail	Q37842	Escherichia_phage	44.8	1.2e-25
WP_002896193.1|1810609_1811782_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	93.3	1.9e-210
WP_002896201.1|1811791_1812307_+|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	85.4	1.3e-81
WP_002896204.1|1812359_1812659_+|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	79.0	3.7e-33
WP_002896220.1|1812673_1812793_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
WP_002896222.1|1812785_1815413_+|tail	phage tail tape measure protein	tail	E5FFG5	Burkholderia_phage	42.0	5.6e-117
WP_002896224.1|1815409_1815895_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	75.6	7.2e-63
WP_002896225.1|1815891_1816992_+	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	87.4	4.9e-176
WP_000972391.1|1817083_1817302_+	ogr/Delta-like zinc finger family protein	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
1817374:1817392	attR	CAGGCAACAAAAAACCCAT	NA	NA	NA	NA
>prophage 5
NZ_CP009775	Klebsiella pneumoniae subsp. pneumoniae strain KPNIH32 chromosome, complete genome	5515525	1851718	1861182	5515525	protease,tRNA	Dickeya_phage(16.67%)	8	NA	NA
WP_002896440.1|1851718_1852834_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
WP_004150848.1|1852830_1854771_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
WP_002896516.1|1854847_1855069_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_002896520.1|1855394_1855712_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896522.1|1855742_1858022_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
WP_001040187.1|1858142_1858361_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_002898014.1|1858714_1859416_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_004150847.1|1859460_1861182_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
>prophage 6
NZ_CP009775	Klebsiella pneumoniae subsp. pneumoniae strain KPNIH32 chromosome, complete genome	5515525	2284619	2356373	5515525	terminase,holin,transposase,plate,integrase	uncultured_Caudovirales_phage(35.29%)	83	2282700:2282714	2291640:2291654
2282700:2282714	attL	AGTTGATCCTCTGGC	NA	NA	NA	NA
WP_004152144.1|2284619_2285381_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.5	2.4e-20
WP_004152145.1|2285597_2287130_+	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	30.0	1.1e-21
WP_016197745.1|2287328_2287877_-	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
WP_004152147.1|2288073_2289255_+|integrase	site-specific integrase	integrase	A0A0M4QX09	Salmonella_phage	84.2	5.6e-202
WP_004152148.1|2289235_2289478_-	hypothetical protein	NA	A0A0M4RTZ2	Salmonella_phage	73.8	2.2e-20
WP_004198245.1|2289437_2289584_-	hypothetical protein	NA	A0A1B5FPC2	Escherichia_phage	70.8	2.9e-15
WP_014343018.1|2289656_2289890_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152150.1|2290132_2290345_-	hypothetical protein	NA	A0A286S2B6	Klebsiella_phage	98.6	3.4e-33
WP_004152151.1|2290341_2290566_-	hypothetical protein	NA	A0A286S2B3	Klebsiella_phage	89.2	3.1e-29
WP_004154298.1|2290555_2291266_-	Rha family transcriptional regulator	NA	A0A286S260	Klebsiella_phage	88.3	2.1e-111
WP_004152153.1|2291271_2291790_-	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	98.8	1.7e-94
2291640:2291654	attR	GCCAGAGGATCAACT	NA	NA	NA	NA
WP_004152154.1|2291894_2292722_-	hypothetical protein	NA	Q8W654	Enterobacteria_phage	84.0	5.5e-111
WP_004152155.1|2292718_2292913_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152156.1|2292909_2293335_-	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	77.9	3.5e-53
WP_004177208.1|2293331_2293550_-	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	98.6	6.6e-32
WP_004152157.1|2293521_2293776_-	hypothetical protein	NA	A0A286SGR4	Klebsiella_phage	97.6	3.1e-41
WP_004152158.1|2293768_2294134_-	hypothetical protein	NA	A0A286S1Q6	Klebsiella_phage	99.2	6.9e-58
WP_004152159.1|2294303_2294492_-	hypothetical protein	NA	A0A286S1P8	Klebsiella_phage	100.0	4.6e-26
WP_004152160.1|2294484_2294799_-	hypothetical protein	NA	A0A286S1T9	Klebsiella_phage	100.0	1.0e-49
WP_004152161.1|2294969_2295638_-	LexA family transcriptional regulator	NA	A0A286S2B2	Klebsiella_phage	99.5	2.4e-125
WP_004152162.1|2295735_2295957_+	helix-turn-helix transcriptional regulator	NA	A0A286S2C1	Klebsiella_phage	100.0	3.0e-32
WP_004198228.1|2296533_2298192_+	DEAD/DEAH box helicase	NA	A0A286N2P9	Klebsiella_phage	96.0	0.0e+00
WP_004198233.1|2298193_2299156_+	toprim domain-containing protein	NA	A0A286N2Q0	Klebsiella_phage	99.4	4.8e-183
WP_004198239.1|2299152_2299629_+	hypothetical protein	NA	A0A286N2Q1	Klebsiella_phage	100.0	1.8e-90
WP_004152167.1|2299625_2300408_+	antitermination protein	NA	F1C595	Cronobacter_phage	76.8	7.2e-113
WP_004146526.1|2300813_2301062_+|holin	class II holin family protein	holin	NA	NA	NA	NA
WP_004152169.1|2301064_2301595_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	77.1	2.7e-79
WP_004153952.1|2301591_2301981_+	lipase chaperone	NA	A0A192Y6H8	Salmonella_phage	49.2	9.4e-21
WP_004152170.1|2302215_2302536_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004218030.1|2302901_2303390_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152172.1|2303340_2304741_+|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	69.0	9.4e-188
WP_004152173.1|2304978_2306430_+	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	68.8	3.8e-192
WP_004152174.1|2306485_2307034_+	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	56.3	3.0e-49
WP_004199270.1|2307085_2308288_+	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	54.1	2.6e-106
WP_000528476.1|2308291_2308786_+	hypothetical protein	NA	A0A2H4JHM9	uncultured_Caudovirales_phage	62.7	4.2e-50
WP_001132269.1|2308797_2309739_+	DUF2184 domain-containing protein	NA	A0A2H4J191	uncultured_Caudovirales_phage	77.1	1.7e-137
WP_000725700.1|2309778_2310060_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000113538.1|2310028_2310448_+	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	60.7	3.3e-40
WP_000834982.1|2310444_2310951_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001116156.1|2310950_2311337_+	hypothetical protein	NA	A0A2H4J1A4	uncultured_Caudovirales_phage	78.2	1.1e-48
WP_004152176.1|2311431_2311872_+	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	51.7	1.6e-40
WP_004152177.1|2311875_2313021_+	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	76.9	6.3e-166
WP_004152178.1|2313031_2313322_+	DUF3277 family protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	85.5	2.6e-23
WP_085955245.1|2313262_2314455_-|transposase	IS3-like element ISKpn18 family transposase	transposase	U5P429	Shigella_phage	43.5	3.5e-50
WP_004152564.1|2314781_2315207_+	hypothetical protein	NA	A0A2H4J2V6	uncultured_Caudovirales_phage	63.4	2.6e-40
WP_004152565.1|2315242_2315395_+	hypothetical protein	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	88.0	7.6e-19
WP_004152566.1|2315384_2317388_+	lytic transglycosylase domain-containing protein	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	63.6	1.2e-247
WP_004152567.1|2317387_2317987_+	hypothetical protein	NA	A0A2H4J1B3	uncultured_Caudovirales_phage	57.6	9.9e-54
WP_004217362.1|2318062_2318290_+	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	56.0	4.6e-20
WP_004152569.1|2318292_2319315_+	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	54.2	9.2e-100
WP_004152570.1|2319314_2319656_+	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	46.6	1.8e-23
WP_004199301.1|2319705_2319888_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152571.1|2319930_2320497_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152572.1|2320550_2321204_+	hypothetical protein	NA	A0A2H4J8H6	uncultured_Caudovirales_phage	63.5	1.0e-59
WP_004152573.1|2321205_2321559_+	hypothetical protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	80.3	2.3e-50
WP_004152574.1|2321558_2322755_+|plate	baseplate J/gp47 family protein	plate	A0A0M4RD32	Salmonella_phage	72.9	3.9e-158
WP_004152575.1|2322751_2323525_+	DUF2612 domain-containing protein	NA	A0A2H4J1A9	uncultured_Caudovirales_phage	54.4	2.8e-77
WP_004152576.1|2323524_2324391_+	hypothetical protein	NA	A0A2H4IYR0	uncultured_Caudovirales_phage	64.5	1.9e-34
WP_004152577.1|2324390_2324588_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004218487.1|2326938_2327667_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002902128.1|2327677_2328409_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002902131.1|2328405_2328615_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002902133.1|2328719_2329004_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002902136.1|2329226_2329475_-	DinI-like family protein	NA	S5MQI1	Escherichia_phage	70.4	1.4e-25
WP_002902144.1|2330320_2330812_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_002902148.1|2330854_2332399_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_004218490.1|2332408_2333752_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_004151603.1|2333748_2334438_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_004151602.1|2334434_2336141_+	OmpA family protein	NA	NA	NA	NA	NA
WP_002902160.1|2336145_2336637_+	type VI secretion system effector Hcp	NA	NA	NA	NA	NA
WP_002902163.1|2336901_2339556_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	33.4	2.5e-96
WP_004228410.1|2339557_2341927_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	33.8	9.1e-18
WP_002902169.1|2341927_2342707_+	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_002902172.1|2342770_2343301_+	T6SS immunity phospholipase A1-binding lipoprotein Tli1-KP	NA	NA	NA	NA	NA
WP_002902174.1|2343369_2343900_+	T6SS immunity phospholipase A1-binding lipoprotein Tli1-KP	NA	NA	NA	NA	NA
WP_002902176.1|2343967_2344498_+	T6SS immunity phospholipase A1-binding lipoprotein Tli1-KP	NA	NA	NA	NA	NA
WP_002902178.1|2344566_2345097_+	T6SS immunity phospholipase A1-binding lipoprotein Tli1-KP	NA	NA	NA	NA	NA
WP_002902180.1|2345164_2345695_+	T6SS immunity phospholipase A1-binding lipoprotein Tli1-KP	NA	NA	NA	NA	NA
WP_004151601.1|2345682_2348100_+	DUF2235 domain-containing protein	NA	NA	NA	NA	NA
WP_002902252.1|2348144_2348402_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_002902254.1|2348398_2349538_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151599.1|2349521_2352947_+	type VI secretion protein VasK	NA	NA	NA	NA	NA
WP_004151598.1|2354618_2356373_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
>prophage 7
NZ_CP009775	Klebsiella pneumoniae subsp. pneumoniae strain KPNIH32 chromosome, complete genome	5515525	2554287	2565174	5515525		Escherichia_phage(87.5%)	9	NA	NA
WP_002210516.1|2554287_2554908_-	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
WP_004151609.1|2554900_2556166_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.5	6.6e-233
WP_004151610.1|2556177_2557080_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.3	7.7e-159
WP_002210513.1|2557340_2558102_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_004176269.1|2558122_2558983_-	class A broad-spectrum beta-lactamase SHV-11	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
WP_002904006.1|2559280_2559541_+	hypothetical protein	NA	A0A077SK33	Escherichia_phage	97.7	3.5e-40
WP_001620097.1|2559627_2560716_+	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
WP_004151612.1|2560746_2562012_-	MFS transporter	NA	NA	NA	NA	NA
WP_004151613.1|2562066_2565174_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.6	0.0e+00
>prophage 8
NZ_CP009775	Klebsiella pneumoniae subsp. pneumoniae strain KPNIH32 chromosome, complete genome	5515525	3220723	3260760	5515525	transposase,plate,tRNA	Tupanvirus(20.0%)	39	NA	NA
WP_002910404.1|3220723_3221980_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_002910405.1|3222250_3222862_+	lipoprotein localization protein LolB	NA	NA	NA	NA	NA
WP_004217879.1|3222861_3223710_+	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_002910407.1|3223893_3224841_+	ribose-phosphate diphosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.5	2.3e-44
WP_004152259.1|3224965_3226645_+	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.4	7.9e-24
WP_002910436.1|3226645_3227692_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002910437.1|3227914_3228190_-	stress-induced protein YchH	NA	NA	NA	NA	NA
WP_002910438.1|3228462_3229047_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_002910443.1|3229164_3230256_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_002910446.1|3230338_3230548_-	DUF1869 domain-containing protein	NA	NA	NA	NA	NA
WP_002910453.1|3230749_3231664_-	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004152260.1|3231795_3233211_-	type VI secretion system ImpA family N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_004152261.1|3233230_3233674_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_002910493.1|3233676_3234213_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_004152910.1|3234193_3235210_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_002910495.1|3235239_3237003_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_004152262.1|3237136_3240547_-	type VI secretion protein VasK	NA	NA	NA	NA	NA
WP_004198077.1|3240530_3241688_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002910497.1|3241691_3241958_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_072093174.1|3242255_3242441_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171815252.1|3242701_3243004_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000019473.1|3243061_3244042_-|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_077265050.1|3244087_3244345_-	sulfatase modifying factor 1	NA	NA	NA	NA	NA
WP_004217423.1|3244366_3244483_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002910544.1|3244528_3245422_-	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A7H6	Microcystis_virus	30.5	6.7e-14
WP_002910547.1|3245443_3245749_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072093244.1|3245772_3246804_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002910551.1|3247263_3247770_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004153085.1|3247766_3248096_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004199326.1|3248092_3248275_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022644641.1|3248416_3249385_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	96.3	6.5e-180
WP_002910586.1|3250990_3251500_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002910589.1|3251489_3251642_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002910591.1|3251736_3252243_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002910593.1|3252239_3252749_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152319.1|3252749_3254105_-	S-type pyocin domain-containing protein	NA	NA	NA	NA	NA
WP_004152317.1|3257068_3258766_-	OmpA family protein	NA	NA	NA	NA	NA
WP_004152316.1|3258769_3259423_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_002910645.1|3259419_3260760_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
>prophage 9
NZ_CP009775	Klebsiella pneumoniae subsp. pneumoniae strain KPNIH32 chromosome, complete genome	5515525	3663854	3671479	5515525		Escherichia_phage(28.57%)	7	NA	NA
WP_004152482.1|3663854_3664856_-	NAD-dependent epimerase	NA	E3T4Y8	Cafeteria_roenbergensis_virus	28.6	1.2e-30
WP_004152483.1|3665049_3666216_-	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.7	4.1e-112
WP_004152484.1|3666396_3666951_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	58.2	3.8e-52
WP_004152485.1|3666965_3667856_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	33.6	2.8e-28
WP_004152486.1|3667887_3668757_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	67.0	9.8e-111
WP_004152487.1|3668783_3669848_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	55.0	3.4e-105
WP_004152488.1|3670072_3671479_-	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.7	4.7e-38
>prophage 10
NZ_CP009775	Klebsiella pneumoniae subsp. pneumoniae strain KPNIH32 chromosome, complete genome	5515525	3708046	3714953	5515525	tRNA	Bacillus_phage(33.33%)	6	NA	NA
WP_004151135.1|3708046_3709525_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	1.1e-29
WP_002912634.1|3709521_3710244_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	6.4e-31
WP_002912635.1|3710562_3711924_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	94.5	2.5e-206
WP_004151134.1|3712166_3713063_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
WP_002912638.1|3713305_3714079_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.3	1.5e-25
WP_004175147.1|3714089_3714953_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	5.7e-10
>prophage 11
NZ_CP009775	Klebsiella pneumoniae subsp. pneumoniae strain KPNIH32 chromosome, complete genome	5515525	4014729	4088379	5515525	integrase,terminase,tail,holin,transposase,protease,tRNA,capsid	Salmonella_phage(40.0%)	86	4020371:4020388	4087368:4087385
WP_004152006.1|4014729_4016733_-|tRNA	tRNA(Met) cytidine acetyltransferase	tRNA	NA	NA	NA	NA
WP_002913800.1|4016742_4017618_-	neutral zinc metallopeptidase	NA	NA	NA	NA	NA
WP_002913801.1|4017737_4018451_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A127KMU1	Cyanophage	35.7	1.1e-38
WP_002913802.1|4018666_4019701_-	outer membrane protein assembly factor BamC	NA	NA	NA	NA	NA
WP_002913803.1|4019717_4020596_-	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
4020371:4020388	attL	CAGCGATAACCGGAATAC	NA	NA	NA	NA
WP_002913804.1|4020749_4021316_+	glycine cleavage system transcriptional repressor	NA	NA	NA	NA	NA
WP_002913805.1|4021319_4021790_+	thioredoxin-dependent thiol peroxidase	NA	NA	NA	NA	NA
WP_002913806.1|4021851_4022913_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_004221267.1|4022967_4023084_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002913807.1|4023135_4024599_+|protease	beta-barrel assembly-enhancing protease	protease	NA	NA	NA	NA
WP_002913810.1|4024608_4024968_+	arsenate reductase (glutaredoxin)	NA	NA	NA	NA	NA
WP_002913812.1|4025095_4026007_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	58.8	3.5e-74
WP_020947395.1|4026003_4026705_-	DnaA inactivator Hda	NA	NA	NA	NA	NA
WP_002913824.1|4026803_4028090_-	uracil permease	NA	Q9KX94	Enterobacteria_phage	38.1	1.9e-65
WP_002913827.1|4028185_4028812_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_002913829.1|4029029_4030463_-	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
WP_002913833.1|4030472_4031366_-	ROK family protein	NA	NA	NA	NA	NA
WP_002913836.1|4031629_4032667_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	44.5	8.2e-72
WP_004152007.1|4032663_4033305_+	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	41.1	1.2e-28
WP_002913838.1|4033485_4035546_+	polyphosphate kinase 1	NA	NA	NA	NA	NA
WP_002913839.1|4035549_4037082_+	exopolyphosphatase	NA	NA	NA	NA	NA
WP_002913841.1|4037135_4039364_-	sensor domain-containing phosphodiesterase	NA	NA	NA	NA	NA
WP_004174861.1|4039734_4039908_+	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	78.8	1.4e-16
WP_004221278.1|4040004_4040916_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002913847.1|4040989_4042222_+	MFS transporter	NA	NA	NA	NA	NA
WP_004162150.1|4042515_4043694_+	anaerobic sulfatase maturase	NA	NA	NA	NA	NA
WP_004152009.1|4043677_4045546_+	sulfatase-like hydrolase/transferase	NA	A0A2P0VMN7	Tetraselmis_virus	22.6	2.6e-07
WP_004152707.1|4045765_4046248_-	DUF2514 domain-containing protein	NA	Q858E9	Salmonella_phage	80.6	3.0e-61
WP_004152706.1|4046244_4046874_-	glycoside hydrolase family 19 protein	NA	Q858F0	Salmonella_phage	76.4	3.1e-90
WP_004146393.1|4046863_4047169_-|holin	phage holin family protein	holin	A0A193GYK3	Enterobacter_phage	82.4	2.7e-39
WP_004146394.1|4047155_4047560_-	membrane protein	NA	T1SA79	Salmonella_phage	84.1	9.3e-56
WP_004229092.1|4047683_4047836_-	hypothetical protein	NA	A0A2H5BN82	Klebsiella_phage	54.3	1.9e-06
WP_004221284.1|4047844_4050214_-|tail	phage tail fibers	tail	A0A2H5BN49	Klebsiella_phage	79.5	9.1e-268
WP_004152452.1|4050365_4050662_+	hypothetical protein	NA	T1SA06	Salmonella_phage	65.5	6.2e-25
WP_004152453.1|4050752_4051010_+	DUF1902 domain-containing protein	NA	A0A0M4R2Z9	Salmonella_phage	54.1	2.3e-12
WP_004152454.1|4051013_4051211_+	type II toxin-antitoxin system HicA family toxin	NA	A0A0M4RCZ9	Salmonella_phage	69.8	2.0e-19
WP_157833602.1|4051319_4051508_+	ash family protein	NA	NA	NA	NA	NA
WP_004152455.1|4051591_4052287_+	hypothetical protein	NA	A0A193GYJ9	Enterobacter_phage	52.7	4.4e-61
WP_004152456.1|4052477_4052660_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152457.1|4052664_4053063_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152458.1|4053337_4053952_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152459.1|4053961_4057351_-	hypothetical protein	NA	G9L6D4	Escherichia_phage	42.0	6.3e-121
WP_004152460.1|4057350_4060095_-	hypothetical protein	NA	A0A193GYI3	Enterobacter_phage	39.2	9.1e-94
WP_004152461.1|4060107_4060605_-	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	40.5	5.7e-23
WP_004152462.1|4060597_4061068_-	hypothetical protein	NA	Q858G2	Salmonella_phage	55.3	7.3e-44
WP_004152463.1|4061069_4063547_-	hypothetical protein	NA	G9L6D0	Escherichia_phage	56.5	3.6e-267
WP_004153043.1|4063546_4064158_-	hypothetical protein	NA	T1SAQ2	Salmonella_phage	48.8	1.2e-46
WP_004152465.1|4064206_4064485_-	hypothetical protein	NA	T1SA01	Salmonella_phage	58.9	6.7e-21
WP_004152466.1|4064477_4064870_-	hypothetical protein	NA	T1SA71	Salmonella_phage	89.9	1.5e-55
WP_004152467.1|4064879_4065887_-|capsid	phage capsid protein	capsid	T1S9H9	Salmonella_phage	92.5	2.7e-181
WP_019404949.1|4065899_4066577_-	peptidase	NA	T1SAP9	Salmonella_phage	63.6	2.0e-50
WP_004152470.1|4066579_4066885_-	hypothetical protein	NA	Q2A090	Sodalis_phage	51.3	1.1e-16
WP_004152471.1|4066881_4068561_-|tail	tail protein	tail	T1S9Z7	Salmonella_phage	58.9	3.4e-192
WP_004152472.1|4068564_4068768_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152473.1|4069473_4069995_+	DUF2829 domain-containing protein	NA	A0A1B0VMG3	Pseudomonas_phage	55.2	7.8e-47
WP_004164044.1|4070038_4071514_-	hypothetical protein	NA	Q858H3	Salmonella_phage	92.9	1.9e-279
WP_004152523.1|4071510_4072095_-|terminase	terminase small subunit	terminase	T1SBI8	Salmonella_phage	88.1	2.4e-89
WP_004152524.1|4072172_4072430_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152525.1|4072504_4072843_-	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	80.0	4.7e-45
WP_004152526.1|4072842_4073082_-	hypothetical protein	NA	G8C7S3	Escherichia_phage	48.0	4.6e-10
WP_004152527.1|4073074_4073743_-	DUF551 domain-containing protein	NA	Q6UAT8	Klebsiella_phage	52.5	1.5e-05
WP_004141386.1|4073739_4073952_-	hypothetical protein	NA	A0A0F6TJE4	Escherichia_coli_O157_typing_phage	45.5	8.1e-11
WP_004152528.1|4073952_4074123_-	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	69.6	2.5e-15
WP_004152529.1|4074122_4074866_-	hypothetical protein	NA	A6N3G8	Burkholderia_virus	59.5	1.5e-19
WP_004152530.1|4074862_4075288_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152531.1|4075284_4075476_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152532.1|4075459_4075870_-	hypothetical protein	NA	A0A2P1MXC5	Escherichia_phage	42.2	3.1e-14
WP_004152534.1|4076062_4076410_-	DUF1064 domain-containing protein	NA	A0A0F6R8N5	Escherichia_coli_O157_typing_phage	82.6	5.0e-50
WP_004152535.1|4076529_4077315_-	replication protein	NA	A0A193GYX1	Enterobacter_phage	87.4	8.2e-133
WP_004152536.1|4077311_4078079_-	primosomal protein	NA	A0A193GZ86	Enterobacter_phage	91.0	3.4e-139
WP_004152537.1|4078078_4078288_-	hypothetical protein	NA	A0A193GYW4	Enterobacter_phage	78.3	1.8e-26
WP_004152538.1|4078434_4078668_-	hypothetical protein	NA	T1SAR5	Salmonella_phage	66.2	9.2e-24
WP_004152539.1|4078821_4079403_+	helix-turn-helix transcriptional regulator	NA	Q858D7	Salmonella_phage	64.8	1.9e-65
WP_004164037.1|4079623_4079773_+	hypothetical protein	NA	G9L6A5	Escherichia_phage	84.2	7.9e-13
WP_004164029.1|4079769_4080069_+	hypothetical protein	NA	A0A0F6R7M4	Escherichia_coli_O157_typing_phage	54.5	2.1e-20
WP_004152541.1|4080065_4080965_+	YqaJ viral recombinase family protein	NA	Q858E0	Salmonella_phage	93.0	1.5e-159
WP_004152542.1|4080974_4081997_+	recombination protein RecT	NA	Q858E1	Salmonella_phage	95.3	2.4e-180
WP_004152543.1|4082048_4082297_+	AlpA family phage regulatory protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	69.5	1.1e-27
WP_004153052.1|4082406_4082700_+	PerC family transcriptional regulator	NA	T1S9J5	Salmonella_phage	71.1	8.9e-32
WP_004152545.1|4082692_4082851_+	DUF1317 family protein	NA	T1SAR0	Salmonella_phage	78.8	1.9e-17
WP_004152546.1|4082847_4083441_+	adenine methylase	NA	T1SA14	Salmonella_phage	92.4	4.3e-110
WP_004152547.1|4083437_4083620_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152548.1|4083616_4083808_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152549.1|4083824_4085075_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1X9TCT6	Enterobacter_phage	85.3	1.4e-206
WP_004151979.1|4085267_4086845_-	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_004151980.1|4086912_4088379_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.7	1.2e-87
4087368:4087385	attR	CAGCGATAACCGGAATAC	NA	NA	NA	NA
>prophage 12
NZ_CP009775	Klebsiella pneumoniae subsp. pneumoniae strain KPNIH32 chromosome, complete genome	5515525	4159604	4241124	5515525	head,portal,integrase,terminase,tail,lysis,plate,tRNA,capsid	Salmonella_phage(70.59%)	88	4204308:4204354	4242785:4242831
WP_002914079.1|4159604_4160342_-|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_002914082.1|4160473_4161805_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.9	6.2e-48
WP_002914084.1|4161850_4162234_-	autonomous glycyl radical cofactor GrcA	NA	A0A193GZ98	Escherichia_phage	79.3	4.0e-32
WP_002914088.1|4162547_4163237_+	uracil-DNA glycosylase	NA	A0A077BCN4	Equid_alphaherpesvirus	53.0	1.3e-57
WP_002914089.1|4163294_4164380_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_002914091.1|4164583_4165009_+	thioredoxin TrxC	NA	A0A1J0GW78	Streptomyces_phage	40.2	6.0e-13
WP_002914092.1|4165078_4165777_+|tRNA	tRNA-uridine aminocarboxypropyltransferase	tRNA	NA	NA	NA	NA
WP_004151994.1|4165811_4168472_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_002914094.1|4168592_4169948_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_002914095.1|4169989_4170313_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_002914097.1|4170316_4171615_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	31.5	3.1e-44
WP_004150973.1|4177580_4180154_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.4	6.9e-128
WP_002914109.1|4180283_4181015_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_002914110.1|4181011_4181992_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_004145664.1|4182123_4182861_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_002914111.1|4183131_4183467_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_100250063.1|4183573_4183621_+	pheA operon leader peptide PheL	NA	NA	NA	NA	NA
WP_004150975.1|4183721_4184882_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_002914112.1|4184878_4185751_-	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_002914113.1|4185813_4186935_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_002914114.1|4186944_4188015_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.5	1.8e-90
WP_004174804.1|4188357_4188867_+	YfiR family protein	NA	NA	NA	NA	NA
WP_002914116.1|4188859_4190083_+	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_002914117.1|4190096_4190579_+	OmpA family protein	NA	NA	NA	NA	NA
WP_002914118.1|4190587_4191958_-	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_002914119.1|4192014_4192473_-	DUF2946 domain-containing protein	NA	NA	NA	NA	NA
WP_002914145.1|4192592_4192940_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_002914147.1|4192979_4193747_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_004150977.1|4193778_4194327_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_002914149.1|4194345_4194594_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_002914152.1|4194853_4196218_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_002914153.1|4196381_4197173_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_004149392.1|4197192_4198479_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_002914155.1|4198598_4199189_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_002914158.1|4199313_4200192_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_002914159.1|4200278_4201940_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_002914160.1|4202087_4202429_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_002914161.1|4202495_4202786_-	RnfH family protein	NA	NA	NA	NA	NA
WP_004188817.1|4202775_4203252_-	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_002914164.1|4203362_4203845_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	2.3e-29
4204308:4204354	attL	ATGTAGGAATTTCGGACGCGGGTTCAACTCCCGCCAGCTCCACCAAA	NA	NA	NA	NA
WP_004150980.1|4204448_4204826_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150981.1|4204853_4205072_-	ogr/Delta-like zinc finger family protein	NA	Q53ZE7	Salmonella_virus	72.2	1.9e-26
WP_004150982.1|4205138_4206233_-	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	83.6	2.4e-170
WP_004150983.1|4206229_4206715_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.1	5.2e-61
WP_004150984.1|4206711_4209342_-|tail	phage tail tape measure protein	tail	E5FFG5	Burkholderia_phage	41.9	8.9e-115
WP_002896220.1|4209334_4209454_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
WP_004150985.1|4209468_4209768_-|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	78.0	8.2e-33
WP_004150986.1|4209820_4210336_-|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	84.2	1.4e-80
WP_004150987.1|4210345_4211518_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	91.5	3.4e-207
WP_004150988.1|4211666_4212740_-|tail	phage tail protein	tail	A0A1S6KZZ8	Salmonella_phage	53.6	6.6e-40
WP_004200602.1|4212791_4213910_-	hypothetical protein	NA	A0A248XD67	Klebsiella_phage	38.0	4.4e-55
WP_004150990.1|4213919_4215869_-	CotH kinase family protein	NA	Q6QI97	Burkholderia_phage	38.9	1.0e-06
WP_004152935.1|4215870_4216542_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	58.9	3.2e-61
WP_004150992.1|4216534_4217443_-|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	68.9	1.9e-109
WP_004150993.1|4217429_4217792_-	GPW/gp25 family protein	NA	A0A1S6KZZ4	Salmonella_phage	85.6	8.4e-48
WP_004150994.1|4217788_4218361_-|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	70.8	1.4e-76
WP_004150995.1|4218455_4219322_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150996.1|4219344_4219791_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	72.3	2.5e-54
WP_004150997.1|4219783_4220206_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	83.2	8.2e-63
WP_072093160.1|4220168_4220327_-	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	75.0	9.0e-15
WP_004150998.1|4220301_4220730_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	82.5	7.1e-54
WP_004150999.1|4220726_4221110_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	45.4	1.9e-18
WP_004151000.1|4221114_4221624_-	lysozyme	NA	E5G6N1	Salmonella_phage	85.2	1.6e-81
WP_004134639.1|4221604_4221820_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	88.7	6.1e-30
WP_004151001.1|4221823_4222027_-|tail	tail protein X	tail	E5G6M9	Salmonella_phage	89.6	9.8e-30
WP_004151002.1|4222026_4222491_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	85.7	1.5e-73
WP_004134644.1|4222586_4223240_-|terminase	terminase endonuclease subunit	terminase	A0A1S6KZX1	Salmonella_phage	80.0	1.9e-90
WP_004151003.1|4223243_4224296_-|capsid	phage major capsid protein, P2 family	capsid	A0A1S6KZZ3	Salmonella_phage	91.0	6.8e-175
WP_004151004.1|4224312_4225146_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	77.6	4.4e-100
WP_019405037.1|4225286_4227050_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	91.8	0.0e+00
WP_004151006.1|4227049_4228093_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	85.6	3.1e-172
WP_024940854.1|4228149_4228419_-	hypothetical protein	NA	D2IZW1	Enterococcus_phage	41.3	1.4e-15
WP_004151007.1|4228940_4229942_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151008.1|4229941_4231021_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151009.1|4231007_4231691_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151010.1|4231786_4232020_-	DinI family protein	NA	A0A0M4S6H1	Salmonella_phage	96.1	2.0e-34
WP_004151011.1|4232031_4232220_-	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	90.3	2.2e-23
WP_004178082.1|4232327_4233815_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_004151012.1|4234292_4236677_-	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	87.9	0.0e+00
WP_004151013.1|4236673_4237525_-	DNA adenine methylase	NA	A0A1S6L011	Salmonella_phage	75.4	2.2e-115
WP_004151014.1|4237521_4237749_-	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	92.0	5.1e-35
WP_004151016.1|4237748_4237982_-	DUF2732 family protein	NA	A0A1S6L021	Salmonella_phage	90.9	6.0e-31
WP_004144796.1|4238049_4238388_-	DUF5347 domain-containing protein	NA	A0A218M4I7	Erwinia_phage	58.0	6.2e-29
WP_004151017.1|4238351_4238552_-	DUF2724 domain-containing protein	NA	A0A1S6L005	Salmonella_phage	68.8	4.5e-19
WP_004151018.1|4238559_4239069_-	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	85.8	1.1e-77
WP_001397669.1|4239101_4239344_-	hypothetical protein	NA	A0A1S6KZZ6	Salmonella_phage	98.8	4.0e-38
WP_004151019.1|4239466_4240096_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	54.5	1.4e-61
WP_004151020.1|4240098_4241124_+|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	93.8	1.5e-190
4242785:4242831	attR	ATGTAGGAATTTCGGACGCGGGTTCAACTCCCGCCAGCTCCACCAAA	NA	NA	NA	NA
>prophage 13
NZ_CP009775	Klebsiella pneumoniae subsp. pneumoniae strain KPNIH32 chromosome, complete genome	5515525	4967632	5016475	5515525	head,portal,terminase,tail,protease,tRNA,capsid	uncultured_Caudovirales_phage(68.75%)	56	NA	NA
WP_002918465.1|4967632_4968127_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	54.8	1.5e-26
WP_002918467.1|4968130_4968769_-	stringent starvation protein A	NA	NA	NA	NA	NA
WP_135801240.1|4968738_4969023_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000829818.1|4969080_4969473_-	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_002918559.1|4969488_4969917_-	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_004144945.1|4970182_4971310_-	cell division protein ZapE	NA	NA	NA	NA	NA
WP_002918565.1|4971500_4971899_+	DUF1043 family protein	NA	NA	NA	NA	NA
WP_002918566.1|4972072_4973440_+|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.3	6.0e-22
WP_002918568.1|4973527_4974586_+	outer membrane-stress sensor serine endopeptidase DegS	NA	NA	NA	NA	NA
WP_002918570.1|4974722_4975661_-	malate dehydrogenase	NA	NA	NA	NA	NA
WP_002918625.1|4976075_4976546_+	transcriptional regulator ArgR	NA	NA	NA	NA	NA
WP_002918626.1|4976921_4977185_+	peroxide/acid stress response protein YhcN	NA	NA	NA	NA	NA
WP_002918627.1|4977283_4977550_+	peroxide/acid stress response protein YhcN	NA	NA	NA	NA	NA
WP_002918629.1|4977600_4977876_-	barstar family protein	NA	NA	NA	NA	NA
WP_002918632.1|4977955_4979923_-	p-hydroxybenzoic acid efflux pump subunit AaeB	NA	NA	NA	NA	NA
WP_002918639.1|4979928_4980861_-	p-hydroxybenzoic acid efflux pump subunit AaeA	NA	NA	NA	NA	NA
WP_002918640.1|4980868_4981072_-	AaeX family protein	NA	NA	NA	NA	NA
WP_002918641.1|4981203_4982133_+	HTH-type transcriptional activator AaeR	NA	NA	NA	NA	NA
WP_002918642.1|4982168_4983614_-|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_004150952.1|4983702_4987500_-	AsmA2 domain-containing protein YhdP	NA	NA	NA	NA	NA
WP_002918644.1|4987537_4989007_-	ribonuclease G	NA	NA	NA	NA	NA
WP_002918646.1|4989009_4989591_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_002918648.1|4989598_4990087_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_004149974.1|4990086_4991079_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_002918653.1|4991149_4992193_-	rod shape-determining protein MreB	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
WP_002918686.1|4992498_4994439_-	RNase E specificity factor CsrD	NA	NA	NA	NA	NA
WP_002918687.1|4994518_4994710_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002918688.1|4994938_4995940_+	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
WP_002918689.1|4995939_4996548_+	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
WP_002918732.1|4996771_4997224_+	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_002918736.1|4997246_4997714_+	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_002918738.1|4997724_4999074_+	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_002918740.1|4999184_4999427_+	YhdT family protein	NA	NA	NA	NA	NA
WP_002918742.1|4999416_5000868_+	sodium/pantothenate symporter	NA	NA	NA	NA	NA
WP_002918745.1|5000879_5001761_+	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_004144972.1|5002118_5003084_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_000462905.1|5003108_5003405_+	DNA-binding transcriptional regulator Fis	NA	NA	NA	NA	NA
WP_004150954.1|5003558_5003750_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150955.1|5003752_5005414_-|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	98.0	0.0e+00
WP_000113647.1|5005397_5005754_-|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	99.2	5.5e-60
WP_004150957.1|5005884_5006037_-	hypothetical protein	NA	A0A2H4JCY9	uncultured_Caudovirales_phage	88.0	2.4e-17
WP_004150959.1|5006029_5006473_-	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	91.8	2.8e-77
WP_001547824.1|5006472_5006772_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	80.8	3.4e-39
WP_004150961.1|5006768_5007104_-|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	57.8	3.7e-26
WP_004150962.1|5007100_5008342_-|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	96.5	1.0e-230
WP_001547826.1|5008343_5008904_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	95.7	1.2e-98
WP_001549743.1|5008955_5010122_-|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	95.9	9.8e-207
WP_004150963.1|5010385_5010898_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150964.1|5010946_5011282_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150965.1|5011624_5013760_-	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	62.4	3.4e-205
WP_001549749.1|5013759_5014125_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150966.1|5014121_5014490_-	hypothetical protein	NA	A0A2H4JCX7	uncultured_Caudovirales_phage	81.1	3.7e-51
WP_004150967.1|5014486_5014801_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001549752.1|5014793_5014982_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106918304.1|5014974_5015244_-	host cell division inhibitor Icd-like protein	NA	A0A2H4JGW3	uncultured_Caudovirales_phage	94.4	2.4e-44
WP_004150969.1|5015695_5016475_-	phage antirepressor KilAC domain-containing protein	NA	Q8HA02	Enterobacteria_phage	51.5	6.2e-40
>prophage 1
NZ_CP009776	Klebsiella pneumoniae subsp. pneumoniae strain KPNIH32 plasmid pKPC-def, complete sequence	115320	48	74631	115320	transposase	Escherichia_phage(27.78%)	69	NA	NA
WP_012539983.1|48_804_+	replication initiation protein RepE	NA	I3WF20	Macacine_betaherpesvirus	95.2	1.7e-135
WP_022644883.1|891_2430_-|transposase	IS66-like element ISKpn24 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	94.7	4.6e-281
WP_000612626.1|2478_2826_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_007372134.1|2822_3227_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	97.8	1.6e-68
WP_015632469.1|4008_5214_+	AAA family ATPase	NA	A0A077SL49	Escherichia_phage	69.6	4.0e-163
WP_022644882.1|5213_6188_+	ParB/RepB/Spo0J family partition protein	NA	A0A1B0V750	Salmonella_phage	55.0	9.4e-86
WP_022644881.1|6269_7541_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.5	1.6e-149
WP_020805749.1|7540_7972_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	53.3	3.6e-29
WP_001568038.1|8204_9176_+	hypothetical protein	NA	A0A222YXF2	Escherichia_phage	46.8	1.1e-73
WP_022644880.1|9178_9850_+	plasmid partitioning/stability family protein	NA	NA	NA	NA	NA
WP_001568040.1|9911_10142_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152355.1|10578_11280_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.7	7.1e-27
WP_001568042.1|11279_11501_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022644879.1|11510_11930_+	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_022644878.1|11983_12751_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022644877.1|13431_13860_+	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.9	2.2e-10
WP_013214014.1|13902_14409_+	antirestriction protein ArdA	NA	G9FHQ1	Rhodococcus_virus	31.4	1.2e-07
WP_001568047.1|14451_14643_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032409268.1|14830_15085_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	50.7	8.8e-12
WP_022644897.1|15120_15441_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022644896.1|16115_16658_+	single-stranded DNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	74.4	1.7e-49
WP_022644895.1|16706_16955_+	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_022644894.1|17023_19024_+	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	26.5	3.2e-24
WP_015632482.1|19068_19500_+	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_022644893.1|19496_20225_+	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_015632484.1|20221_20548_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087439983.1|20736_22111_+|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	74.1	1.4e-79
WP_022644891.1|22281_23322_+	ATP-binding protein	NA	M4QMW8	Micromonas_pusilla_virus	35.2	9.5e-20
WP_162859354.1|23527_25810_+	S8 family peptidase	NA	NA	NA	NA	NA
WP_015065592.1|26243_27776_-|transposase	IS3-like element ISKpn38 family transposase	transposase	A0A1B1P773	Bacillus_phage	39.8	3.1e-51
WP_004196353.1|27864_29205_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_032072095.1|29460_29883_-	nickel resistance OB fold protein NcrY	NA	NA	NA	NA	NA
WP_004196366.1|30044_31175_-	Ni(II)/Co(II) efflux transporter permease subunit NcrC	NA	NA	NA	NA	NA
WP_004196355.1|31187_31457_-	nickel-sensing transcriptional repressor NcrB	NA	NA	NA	NA	NA
WP_004196314.1|31562_32861_-	MFS transporter	NA	NA	NA	NA	NA
WP_004196325.1|33094_33853_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004196315.1|33906_34827_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004196359.1|34889_35261_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152397.1|36172_37492_+|transposase	IS1182-like element ISKpn6 family transposase	transposase	Q9MBP7	Staphylococcus_prophage	24.2	1.9e-12
WP_004152396.1|37741_38623_-	carbapenem-hydrolyzing class A beta-lactamase KPC-3	NA	A0A1B0VBP7	Salmonella_phage	52.2	2.8e-73
WP_004152394.1|38941_39721_-	IS21-like element ISKpn7 family helper ATPase IstB	NA	A0A2L1IVB6	Escherichia_phage	61.8	2.5e-89
WP_004199214.1|39717_40743_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	50.3	1.4e-87
WP_004152392.1|40849_43879_-|transposase	Tn3-like element Tn4401 family transposase	transposase	NA	NA	NA	NA
WP_004152391.1|43988_45704_+	Tn3-like element Tn4401 family resolvase TnpR	NA	NA	NA	NA	NA
WP_001217881.1|46818_47376_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	98.4	2.0e-93
WP_014454105.1|47609_48164_+	aminoglycoside N-acetyltransferase AAC(6')-Ib'	NA	NA	NA	NA	NA
WP_001206315.1|48233_49022_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_000722315.1|49081_49906_+	oxacillin-hydrolyzing class D beta-lactamase OXA-9	NA	NA	NA	NA	NA
WP_000027057.1|50605_51466_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_000480968.1|52186_53023_-	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_001082319.1|53022_53826_-	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
WP_001043260.1|53886_54702_-	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
WP_000954592.1|55031_55208_+	DUF4102 domain-containing protein	NA	T1S9J3	Salmonella_phage	68.6	1.0e-06
WP_000427619.1|55389_56394_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_001067855.1|58290_58995_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_025404032.1|59030_59336_+	IncN plasmid KikA protein	NA	NA	NA	NA	NA
WP_001452736.1|59371_59683_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064577928.1|59891_60380_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_001749967.1|60384_60591_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072094655.1|61002_62406_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.6	9.0e-106
WP_004098817.1|62439_63654_-	type II site-specific deoxyribonuclease	NA	E5E3X4	Burkholderia_phage	42.5	1.2e-34
WP_001389365.1|63914_64679_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_001144737.1|64821_65088_-	plasmid mobilization relaxosome protein MobC	NA	NA	NA	NA	NA
WP_004201280.1|65308_65782_-	trimethoprim-resistant dihydrofolate reductase DfrA14	NA	G3MBI7	Bacillus_virus	28.9	8.4e-16
WP_001067855.1|66757_67462_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_002904004.1|67598_68459_+	class A extended-spectrum beta-lactamase SHV-12	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
WP_002210513.1|68479_69241_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_002903955.1|69502_70405_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
WP_004199413.1|71613_74631_-|transposase	Tn3-like element IS3000 family transposase	transposase	A0A125RQ78	Bacillus_phage	24.7	5.5e-52
>prophage 1
NZ_CP009777	Klebsiella pneumoniae subsp. pneumoniae strain KPNIH32 plasmid pKPN-a68, complete sequence	212192	498	36779	212192	protease,transposase,integrase	Escherichia_phage(38.46%)	34	108:119	18553:18564
108:119	attL	GCACACGCAGCA	NA	NA	NA	NA
WP_000845039.1|498_1512_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001083725.1|1656_2154_+	trimethoprim-resistant dihydrofolate reductase DfrA12	NA	A0A0A0PL85	Bacillus_phage	40.9	7.5e-23
WP_001336345.1|2265_2556_+	DUF1010 domain-containing protein	NA	NA	NA	NA	NA
WP_001206356.1|2561_3353_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_000679427.1|3516_3864_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|3857_4697_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_064765192.1|4893_5097_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000427619.1|5278_6283_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_000184001.1|6510_7716_+	chromate efflux transporter	NA	NA	NA	NA	NA
WP_000130000.1|7726_8032_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001389365.1|8258_9023_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_001137892.1|9515_10100_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000004159.1|10099_11338_-	MFS transporter	NA	NA	NA	NA	NA
WP_000219391.1|11334_12240_-	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_001067855.1|12361_13066_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000018329.1|13216_14032_+	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	100.0	6.1e-163
WP_044117068.1|14221_14890_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	99.5	1.9e-130
WP_000427619.1|15181_16186_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_004217321.1|17520_18225_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_004153729.1|19080_19908_+	phosphonate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.6	2.6e-20
18553:18564	attR	GCACACGCAGCA	NA	NA	NA	NA
WP_004152695.1|19904_20768_+	phosphate/phosphite/phosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004152694.1|20776_21604_+	phosphonate ABC transporter, permease protein PhnE	NA	NA	NA	NA	NA
WP_004152693.1|21612_22623_+	phosphonate dehydrogenase PtxD	NA	A0A1V0SBV6	Catovirus	25.1	1.4e-15
WP_004152692.1|22616_23486_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000019473.1|24694_25675_-|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_004118209.1|26876_27140_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_004118208.1|27154_27418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152118.1|27661_27943_+	helix-turn-helix domain-containing protein	NA	A0A1B1IUF9	uncultured_Mediterranean_phage	38.2	5.2e-05
WP_004152117.1|27977_28547_+	small heat shock protein sHSP20	NA	NA	NA	NA	NA
WP_004152116.1|28661_31457_+	heat shock survival AAA family ATPase ClpK	NA	K4FB40	Cronobacter_phage	41.0	5.2e-129
WP_004152115.1|31456_31654_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009483782.1|31891_32641_+	phosphate-starvation-inducible PsiE family protein	NA	NA	NA	NA	NA
WP_004152113.1|32627_33590_+|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_020314316.1|35432_36779_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP009777	Klebsiella pneumoniae subsp. pneumoniae strain KPNIH32 plasmid pKPN-a68, complete sequence	212192	156282	211449	212192	integrase,transposase,bacteriocin	Stx2-converting_phage(23.08%)	41	153131:153148	192581:192598
153131:153148	attL	AGGCGATTCAACAGGTGG	NA	NA	NA	NA
WP_004178051.1|156282_158604_+|bacteriocin	klebicin B-related nuclease bacteriocin	bacteriocin	NA	NA	NA	NA
WP_004152296.1|158605_158884_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_009485932.1|159224_159704_+	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	35.2	9.8e-20
WP_004199332.1|160024_160303_+	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_004171457.1|160519_160597_+	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_004152292.1|160589_161447_+	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_032408946.1|162893_165077_-	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
WP_004152291.1|165073_166390_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_004152290.1|166393_168703_-	TerB N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_003846917.1|170408_171662_-	lactose permease	NA	NA	NA	NA	NA
WP_004152287.1|171713_174788_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	96.7	0.0e+00
WP_004152286.1|174909_175992_-	DNA-binding transcriptional repressor LacI	NA	C6ZCU4	Enterobacteria_phage	96.4	6.8e-186
WP_004152284.1|176452_177463_+	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_000427619.1|177866_178871_+|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_166687952.1|179125_179410_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_004118251.1|179740_180034_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	96.9	2.7e-49
WP_004152282.1|180132_180900_-	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	25.2	9.8e-14
WP_004152281.1|180900_181857_-	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	NA	NA	NA	NA
WP_004118243.1|181853_182852_-	iron-dicitrate ABC transporter permease FecC	NA	NA	NA	NA	NA
WP_004118241.1|182848_183751_-	Fe(3+) dicitrate ABC transporter substrate-binding protein FecB	NA	NA	NA	NA	NA
WP_004152280.1|183795_186120_-	Fe(3+) dicitrate transport protein FecA	NA	NA	NA	NA	NA
WP_004118237.1|186205_187159_-	fec operon regulator FecR	NA	NA	NA	NA	NA
WP_004118235.1|187155_187677_-	RNA polymerase sigma factor FecI	NA	NA	NA	NA	NA
WP_161989521.1|188638_188851_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004118231.1|188779_188947_+|integrase	integrase	integrase	NA	NA	NA	NA
WP_004118840.1|189231_190359_+	transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004118229.1|190355_190949_+	ANTAR domain-containing protein	NA	NA	NA	NA	NA
WP_004152279.1|190945_191794_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_004118227.1|191793_192714_+	ABC transporter permease	NA	NA	NA	NA	NA
192581:192598	attR	AGGCGATTCAACAGGTGG	NA	NA	NA	NA
WP_004152278.1|192726_194331_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004118225.1|194375_195323_+	acetamidase/formamidase family protein	NA	A0A1V0S8X7	Catovirus	22.7	9.6e-11
WP_004118832.1|195330_197064_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.6	6.9e-15
WP_004152557.1|200886_201234_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	95.7	2.0e-59
WP_020956879.1|201230_201617_-|transposase	transposase	transposase	B6DZU5	Stx2-converting_phage	90.7	1.1e-58
WP_004118217.1|202164_202800_-	His-Xaa-Ser repeat protein HxsA	NA	NA	NA	NA	NA
WP_000005560.1|202796_203909_-	His-Xaa-Ser system radical SAM maturase HxsC	NA	S5WIP3	Leptospira_phage	33.8	1.5e-47
WP_004118216.1|203901_205290_-	His-Xaa-Ser system radical SAM maturase HxsB	NA	S5VT21	Leptospira_phage	29.0	6.3e-51
WP_000333416.1|205289_205562_-	His-Xaa-Ser system protein HxsD	NA	NA	NA	NA	NA
WP_000412211.1|207178_207838_+	type A-1 chloramphenicol O-acetyltransferase	NA	G3CFL0	Escherichia_phage	100.0	8.4e-131
WP_000656305.1|208038_208416_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001138064.1|208482_211449_-|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.6	0.0e+00
