The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP009771	Klebsiella pneumoniae subsp. pneumoniae strain KPNIH33 chromosome, complete genome	5574202	591809	597634	5574202		Enterobacteria_phage(100.0%)	8	NA	NA
WP_004152202.1|591809_592376_-	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	63.8	9.7e-59
WP_004152203.1|592393_592639_-	ogr/Delta-like zinc finger family protein	NA	Q7M294	Enterobacteria_phage	56.8	5.5e-19
WP_004152204.1|592635_593373_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	59.4	1.1e-70
WP_000556592.1|593933_594200_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	71.6	2.0e-30
WP_004153681.1|594196_594745_+	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	69.4	1.1e-30
WP_004152205.1|594741_594969_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152206.1|594965_595286_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_004152207.1|595300_597634_+	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	83.9	0.0e+00
>prophage 2
NZ_CP009771	Klebsiella pneumoniae subsp. pneumoniae strain KPNIH33 chromosome, complete genome	5574202	1067079	1078733	5574202	integrase	Enterobacteria_phage(70.0%)	13	1055213:1055227	1078270:1078284
1055213:1055227	attL	AGCGCGGAGAGATTG	NA	NA	NA	NA
WP_038434633.1|1067079_1069413_-	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	81.6	0.0e+00
WP_002889897.1|1069424_1069745_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_002889911.1|1069741_1069969_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024940872.1|1069965_1070523_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	70.4	1.8e-33
WP_002889915.1|1070519_1070786_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	71.6	2.6e-30
WP_032448437.1|1071327_1072065_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	60.2	2.6e-72
WP_004152203.1|1072061_1072307_+	ogr/Delta-like zinc finger family protein	NA	Q7M294	Enterobacteria_phage	56.8	5.5e-19
WP_029779713.1|1072324_1072891_+	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	63.8	9.7e-59
WP_004152979.1|1073459_1073885_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152029.1|1073884_1074835_-	AAA family ATPase	NA	A0A1X9IGI7	Lactococcus_phage	27.1	1.2e-13
WP_002889938.1|1074822_1076013_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	62.7	6.4e-145
WP_002889940.1|1076365_1077619_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	44.9	8.9e-89
WP_004144574.1|1077629_1078733_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.5	4.8e-62
1078270:1078284	attR	AGCGCGGAGAGATTG	NA	NA	NA	NA
>prophage 3
NZ_CP009771	Klebsiella pneumoniae subsp. pneumoniae strain KPNIH33 chromosome, complete genome	5574202	1288288	1333563	5574202	lysis,holin,head,tRNA	Escherichia_phage(25.0%)	65	NA	NA
WP_004143010.1|1288288_1289674_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.4	3.5e-46
WP_004143016.1|1289719_1289932_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_004143017.1|1289933_1290800_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	34.8	1.3e-30
WP_004151317.1|1292270_1292606_-	excisionase family DNA-binding protein	NA	NA	NA	NA	NA
WP_004151316.1|1292607_1292823_-	TraR/DksA family transcriptional regulator	NA	A0A0K2FI84	Escherichia_phage	52.9	4.0e-13
WP_004151314.1|1292824_1293043_-	hypothetical protein	NA	A0A1I9LJM7	Stx_converting_phage	47.2	1.2e-09
WP_004151312.1|1293039_1293807_-	hypothetical protein	NA	D5LH17	Escherichia_phage	53.4	1.7e-66
WP_004151310.1|1293803_1294460_-	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	87.5	2.7e-113
WP_004151308.1|1294456_1294615_-	DUF1317 family protein	NA	A0A0N7CHV0	Escherichia_phage	60.8	3.0e-10
WP_004151306.1|1294611_1295292_-	YqaJ viral recombinase family protein	NA	A0A0M3ULE0	Salmonella_phage	93.4	7.9e-124
WP_004151305.1|1295288_1296134_-	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	59.2	6.9e-69
WP_004151304.1|1296149_1296434_-	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	62.8	8.0e-30
WP_004151303.1|1296522_1296717_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151302.1|1296709_1296820_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151301.1|1296816_1297032_-	hypothetical protein	NA	B5WZV1	Pseudomonas_phage	48.6	1.6e-09
WP_004151300.1|1297382_1298072_-	helix-turn-helix transcriptional regulator	NA	G8C7U1	Escherichia_phage	52.2	4.3e-61
WP_004151299.1|1298199_1298433_+	helix-turn-helix domain-containing protein	NA	G8C7U2	Escherichia_phage	50.7	4.3e-13
WP_001548453.1|1298473_1298695_+	hypothetical protein	NA	G8EYH8	Enterobacteria_phage	41.7	6.9e-05
WP_004151298.1|1298780_1298927_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004230546.1|1298967_1299819_+	hypothetical protein	NA	F1C5C3	Cronobacter_phage	56.3	5.3e-85
WP_004230547.1|1299823_1301239_+	AAA family ATPase	NA	Q9MCT4	Escherichia_phage	67.1	1.8e-183
WP_004151295.1|1301238_1301532_+	protein ren	NA	O48423	Enterobacteria_phage	65.6	3.3e-26
WP_004151294.1|1301528_1302035_+	hypothetical protein	NA	A0A0A6Z565	Enterobacter_phage	59.6	3.0e-27
WP_004151293.1|1302141_1302984_+	ead/Ea22-like family protein	NA	A0A2H4FRZ0	Salmonella_phage	60.8	1.8e-29
WP_004151292.1|1302983_1303160_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151291.1|1303156_1303804_+	DUF551 domain-containing protein	NA	A5LH60	Enterobacteria_phage	32.6	4.5e-12
WP_004151288.1|1304304_1304760_+	hypothetical protein	NA	K7P7B8	Enterobacteria_phage	69.5	8.0e-56
WP_004151287.1|1304759_1304930_+	NinE family protein	NA	G8C7V4	Escherichia_phage	73.2	1.3e-14
WP_004151286.1|1304922_1305558_+	recombination protein NinG	NA	M9NYX8	Enterobacteria_phage	77.9	2.7e-81
WP_004151285.1|1305554_1305692_+	YlcG family protein	NA	NA	NA	NA	NA
WP_004151284.1|1305684_1306215_+	HNH endonuclease	NA	A0A193GYW9	Enterobacter_phage	43.1	5.2e-30
WP_004151283.1|1306211_1306901_+	antitermination protein	NA	I6PDF8	Cronobacter_phage	54.5	1.4e-56
WP_004151282.1|1307810_1308059_+|holin	class II holin family protein	holin	NA	NA	NA	NA
WP_004151281.1|1308061_1308592_+	lysozyme	NA	G9L6J6	Escherichia_phage	78.5	6.0e-79
WP_004151280.1|1308588_1309053_+|lysis	lysis protein	lysis	Q76H63	Enterobacteria_phage	73.2	2.4e-55
WP_004151279.1|1309158_1309488_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151277.1|1309858_1310461_+	hypothetical protein	NA	G8C7P2	Escherichia_phage	80.9	5.4e-76
WP_004151276.1|1310460_1311933_+	hypothetical protein	NA	A0A1W6JNY3	Morganella_phage	82.5	1.3e-248
WP_004151275.1|1311945_1313367_+	DUF1073 domain-containing protein	NA	F1C5D7	Cronobacter_phage	57.1	9.6e-148
WP_004151274.1|1313341_1314346_+|head	phage head morphogenesis protein	head	F1C5D8	Cronobacter_phage	69.7	9.0e-116
WP_004151273.1|1314387_1314864_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151272.1|1314936_1316322_+	DUF2213 domain-containing protein	NA	F1C5D9	Cronobacter_phage	60.0	2.3e-154
WP_004151271.1|1316325_1316754_+	hypothetical protein	NA	F1C5E0	Cronobacter_phage	60.8	1.6e-42
WP_004151270.1|1316765_1317860_+	hypothetical protein	NA	F1C5E1	Cronobacter_phage	62.8	1.7e-123
WP_004151269.1|1317870_1318110_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151268.1|1318112_1318493_+	hypothetical protein	NA	F1C5E2	Cronobacter_phage	55.3	5.3e-29
WP_004151267.1|1318492_1318666_+	hypothetical protein	NA	I6R0P9	Salmonella_phage	56.1	1.4e-13
WP_004151266.1|1318665_1319028_+	hypothetical protein	NA	A0A173GCE0	Salmonella_phage	45.0	1.8e-18
WP_004151265.1|1319030_1319456_+	hypothetical protein	NA	R9TPP7	Aeromonas_phage	47.9	5.1e-28
WP_004151264.1|1319452_1319845_+	hypothetical protein	NA	G0ZNE4	Cronobacter_phage	52.7	5.1e-35
WP_004151263.1|1319913_1320666_+	Ig domain-containing protein	NA	G0ZNE6	Cronobacter_phage	42.1	5.8e-43
WP_004151262.1|1320718_1321396_+	hypothetical protein	NA	F1C5E8	Cronobacter_phage	57.9	4.8e-73
WP_004151261.1|1321571_1322327_+	KilA-N domain-containing protein	NA	K7PGT4	Enterobacteria_phage	51.0	2.4e-60
WP_004151260.1|1322329_1322584_+	hypothetical protein	NA	K7PM89	Enterobacteria_phage	73.0	6.7e-20
WP_004151259.1|1322877_1323348_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151258.1|1323364_1323724_-	Arc family DNA-binding protein	NA	A0A0P0ZBD1	Stx2-converting_phage	47.5	3.8e-16
WP_004151257.1|1323823_1323994_+	Arc family DNA-binding protein	NA	I6R9A8	Salmonella_phage	87.0	6.1e-17
WP_004151256.1|1323983_1324697_+	hypothetical protein	NA	H6WRU8	Salmonella_phage	50.2	3.9e-49
WP_004151255.1|1324762_1325548_+	phage repressor protein	NA	A0A2L1IV39	Escherichia_phage	59.7	1.9e-84
WP_004151254.1|1325675_1326179_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151253.1|1326271_1329718_+	tape measure protein	NA	Q5G8W8	Enterobacteria_phage	48.6	1.4e-163
WP_004151252.1|1329760_1330237_+	hypothetical protein	NA	A0A2P1MXB5	Escherichia_phage	49.7	3.0e-37
WP_004199076.1|1330236_1330707_+	hypothetical protein	NA	R9TPR6	Aeromonas_phage	41.0	2.5e-28
WP_004151250.1|1330703_1331099_+	C40 family peptidase	NA	F1C5F2	Cronobacter_phage	54.0	8.0e-36
WP_004151249.1|1331085_1333563_+	MoaD/ThiS family protein	NA	F1C5A7	Cronobacter_phage	45.6	2.7e-198
>prophage 4
NZ_CP009771	Klebsiella pneumoniae subsp. pneumoniae strain KPNIH33 chromosome, complete genome	5574202	1439981	1468050	5574202	transposase	Escherichia_phage(50.0%)	14	NA	NA
WP_004152397.1|1439981_1441301_+|transposase	IS1182-like element ISKpn6 family transposase	transposase	NA	NA	NA	NA
WP_004152396.1|1441550_1442432_-	carbapenem-hydrolyzing class A beta-lactamase KPC-3	NA	A0A1B0VBP7	Salmonella_phage	52.2	2.8e-73
WP_004152394.1|1442750_1443530_-	IS21-like element ISKpn7 family helper ATPase IstB	NA	A0A2L1IVB6	Escherichia_phage	61.8	2.5e-89
WP_004152392.1|1444657_1447687_-|transposase	Tn3-like element Tn4401 family transposase	transposase	NA	NA	NA	NA
WP_004152391.1|1447796_1449512_+	Tn3-like element Tn4401 family resolvase TnpR	NA	NA	NA	NA	NA
WP_004152391.1|1450049_1451765_-	Tn3-like element Tn4401 family resolvase TnpR	NA	NA	NA	NA	NA
WP_004152392.1|1451874_1454904_+|transposase	Tn3-like element Tn4401 family transposase	transposase	NA	NA	NA	NA
WP_004199214.1|1455010_1456036_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	50.3	1.4e-87
WP_004152394.1|1456032_1456812_+	IS21-like element ISKpn7 family helper ATPase IstB	NA	A0A2L1IVB6	Escherichia_phage	61.8	2.5e-89
WP_004152396.1|1457130_1458012_+	carbapenem-hydrolyzing class A beta-lactamase KPC-3	NA	A0A1B0VBP7	Salmonella_phage	52.2	2.8e-73
WP_004152397.1|1458261_1459581_-|transposase	IS1182-like element ISKpn6 family transposase	transposase	NA	NA	NA	NA
WP_004151827.1|1462206_1463286_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_004151828.1|1463299_1466392_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_085955125.1|1466687_1468050_+|transposase	IS3-like element ISKpn1 family transposase	transposase	A0A1B1P773	Bacillus_phage	51.5	1.4e-74
>prophage 5
NZ_CP009771	Klebsiella pneumoniae subsp. pneumoniae strain KPNIH33 chromosome, complete genome	5574202	1795758	1833094	5574202	terminase,tail,capsid,portal,plate,integrase,head,lysis	Salmonella_phage(87.18%)	47	1795666:1795684	1833166:1833184
1795666:1795684	attL	CAGGCAACAAAAAACCCAT	NA	NA	NA	NA
WP_014342959.1|1795758_1796739_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.2	1.4e-97
WP_004178082.1|1797226_1798714_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_004150866.1|1798812_1799757_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152885.1|1799768_1800647_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	39.9	1.7e-30
WP_000188448.1|1800792_1801014_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000460893.1|1801046_1801556_+	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
WP_000956179.1|1801563_1801764_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	97.0	1.6e-32
WP_000963473.1|1801727_1802069_+	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	99.1	4.6e-56
WP_004150864.1|1802136_1802370_+	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	96.1	4.1e-32
WP_000752622.1|1802369_1802597_+	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	98.7	6.0e-36
WP_004150863.1|1802593_1803451_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	95.4	2.0e-156
WP_004150862.1|1803447_1805862_+	replication endonuclease	NA	E5G6L9	Salmonella_phage	97.5	0.0e+00
WP_001154434.1|1806015_1806204_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
WP_001217575.1|1806214_1806448_+	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_000700647.1|1806562_1807240_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004199124.1|1807515_1809258_+	AIPR family protein	NA	NA	NA	NA	NA
WP_002895959.1|1809319_1810345_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	86.7	7.6e-171
WP_004150858.1|1810344_1812111_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.0	0.0e+00
WP_002895967.1|1812253_1813087_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	88.8	6.3e-123
WP_002895972.1|1813103_1814162_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.1	1.1e-180
WP_000059191.1|1814165_1814816_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
WP_002896151.1|1814911_1815376_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	8.4e-77
WP_002896155.1|1815375_1815579_+|tail	tail protein X	tail	A0A1S6KZY4	Salmonella_phage	88.1	1.3e-29
WP_002896158.1|1815582_1815798_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	90.1	3.6e-30
WP_002896161.1|1815778_1816288_+	lysozyme	NA	E5G6N1	Salmonella_phage	83.4	2.1e-81
WP_002896163.1|1816292_1816676_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	42.0	2.1e-17
WP_002896168.1|1816672_1817101_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	77.9	9.6e-51
WP_002896170.1|1817087_1817234_+	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	76.1	6.0e-13
WP_002896172.1|1817196_1817628_+|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	82.5	9.9e-64
WP_002896175.1|1817620_1818067_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	71.2	2.2e-50
WP_004150857.1|1818063_1818756_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002896177.1|1818850_1819423_+|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	72.3	4.7e-77
WP_002896179.1|1819419_1819782_+	GPW/gp25 family protein	NA	A0A1S6KZZ4	Salmonella_phage	84.7	5.8e-49
WP_002896182.1|1819768_1820677_+|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	66.9	7.6e-106
WP_004150856.1|1820669_1821269_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	60.5	1.3e-58
WP_019724930.1|1823487_1824222_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002896186.1|1824225_1824957_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002896188.1|1824953_1825157_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002896191.1|1825186_1826263_+|tail	phage tail protein	tail	Q37842	Escherichia_phage	44.8	1.2e-25
WP_002896193.1|1826401_1827574_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	93.3	1.9e-210
WP_002896201.1|1827583_1828099_+|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	85.4	1.3e-81
WP_002896204.1|1828151_1828451_+|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	79.0	3.7e-33
WP_002896220.1|1828465_1828585_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
WP_002896222.1|1828577_1831205_+|tail	phage tail tape measure protein	tail	E5FFG5	Burkholderia_phage	42.0	5.6e-117
WP_002896224.1|1831201_1831687_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	75.6	7.2e-63
WP_002896225.1|1831683_1832784_+	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	87.4	4.9e-176
WP_000972391.1|1832875_1833094_+	ogr/Delta-like zinc finger family protein	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
1833166:1833184	attR	CAGGCAACAAAAAACCCAT	NA	NA	NA	NA
>prophage 6
NZ_CP009771	Klebsiella pneumoniae subsp. pneumoniae strain KPNIH33 chromosome, complete genome	5574202	1867510	1876974	5574202	protease,tRNA	Dickeya_phage(16.67%)	8	NA	NA
WP_002896440.1|1867510_1868626_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
WP_004150848.1|1868622_1870563_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
WP_002896516.1|1870639_1870861_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_002896520.1|1871186_1871504_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896522.1|1871534_1873814_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
WP_001040187.1|1873934_1874153_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_002898014.1|1874506_1875208_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_004150847.1|1875252_1876974_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
>prophage 7
NZ_CP009771	Klebsiella pneumoniae subsp. pneumoniae strain KPNIH33 chromosome, complete genome	5574202	2266128	2309292	5574202	holin,terminase,integrase,tail	Enterobacteria_phage(22.73%)	59	2258106:2258121	2280945:2280960
2258106:2258121	attL	CATTTTTTTGCTCGTT	NA	NA	NA	NA
WP_038434638.1|2266128_2266938_-	peptide ABC transporter ATP-binding protein SapF	NA	A0A2H4PQG7	Staphylococcus_phage	28.9	2.7e-14
WP_004140266.1|2266939_2267932_-	peptide ABC transporter ATP-binding protein SapD	NA	G9BWD6	Planktothrix_phage	27.2	3.0e-07
WP_004151901.1|2267931_2268822_-	peptide ABC transporter permease SapC	NA	NA	NA	NA	NA
WP_004151900.1|2268968_2270186_+|integrase	site-specific integrase	integrase	K7PGY1	Enterobacteria_phage	51.9	8.6e-121
WP_004151899.1|2270393_2271056_-	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	84.6	2.7e-105
WP_004151898.1|2271052_2271481_-	hypothetical protein	NA	M9NYX4	Enterobacteria_phage	80.3	7.5e-64
WP_004201102.1|2271477_2272158_-	YqaJ viral recombinase family protein	NA	A0A0M3ULE0	Salmonella_phage	91.2	8.2e-121
WP_088224434.1|2272159_2272447_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004201103.1|2272443_2273289_-	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	59.2	1.8e-69
WP_004201105.1|2273304_2273589_-	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	79.8	1.1e-39
WP_004135674.1|2273677_2273872_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004219883.1|2273864_2273990_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004201108.1|2274300_2274504_+	hypothetical protein	NA	A0A192Y6Q5	Salmonella_phage	71.6	3.9e-18
WP_004201109.1|2274585_2275662_-	ParA family protein	NA	H2BD62	Pseudomonas_phage	37.9	9.1e-58
WP_004201113.1|2275949_2276648_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	84.1	3.7e-108
WP_004201115.1|2276759_2276987_+	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	77.1	1.4e-24
WP_001548453.1|2277027_2277249_+	hypothetical protein	NA	G8EYH8	Enterobacteria_phage	41.7	6.9e-05
WP_004201117.1|2277334_2278195_+	replication protein	NA	K7PGT1	Enterobacteria_phage	53.3	1.0e-59
WP_004201118.1|2278191_2279040_+	ATP-binding protein	NA	K7PLU3	Enterobacteria_phage	60.1	5.1e-88
WP_004218528.1|2279036_2279339_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004196831.1|2279394_2279640_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004218530.1|2279847_2280876_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004243011.1|2280985_2281264_+	hypothetical protein	NA	NA	NA	NA	NA
2280945:2280960	attR	AACGAGCAAAAAAATG	NA	NA	NA	NA
WP_004218531.1|2281396_2281864_+	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	45.8	3.4e-33
WP_004243010.1|2281844_2282012_+	NinE family protein	NA	K7P7K0	Enterobacteria_phage	62.5	4.6e-09
WP_004218532.1|2282008_2282677_+	metallophosphoesterase	NA	K7P6H8	Enterobacteria_phage	78.7	1.4e-104
WP_004218533.1|2282669_2283308_+	recombination protein NinG	NA	H6WRY9	Salmonella_phage	69.8	3.2e-74
WP_004218534.1|2283304_2283445_+	YlcG family protein	NA	NA	NA	NA	NA
WP_004232548.1|2283444_2284134_+	antiterminator-like protein	NA	I6PDF8	Cronobacter_phage	53.1	2.1e-55
WP_024940884.1|2284783_2285083_+|holin	phage holin family protein	holin	A0A286N2Q5	Klebsiella_phage	100.0	4.5e-47
WP_004218565.1|2285079_2285619_+	glycoside hydrolase family 108 protein	NA	A0A286N2Q6	Klebsiella_phage	98.9	3.3e-101
WP_004190674.1|2285615_2285960_+	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	80.7	2.0e-38
WP_004190672.1|2285956_2286232_+	hypothetical protein	NA	A0A286N2Q8	Klebsiella_phage	72.5	2.2e-08
WP_004218558.1|2287190_2287436_+	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	96.3	4.6e-34
WP_004218556.1|2288298_2289303_+|terminase	terminase small subunit	terminase	Q5QF76	Pseudomonas_virus	45.5	1.5e-38
WP_004190663.1|2289280_2290588_+|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	58.9	3.6e-149
WP_004218551.1|2290587_2291988_+	DUF4055 domain-containing protein	NA	A0A1B0VMH0	Pseudomonas_phage	53.5	1.1e-127
WP_019405022.1|2291971_2293084_+	hypothetical protein	NA	I6PD76	Cronobacter_phage	55.1	5.6e-111
WP_004227000.1|2293324_2293501_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004217351.1|2293614_2294400_+	hypothetical protein	NA	A0A1B0VMG1	Pseudomonas_phage	63.9	1.0e-66
WP_004190653.1|2294410_2295364_+	Ig domain-containing protein	NA	A0A1B0VMF8	Pseudomonas_phage	74.4	5.0e-132
WP_142689607.1|2295372_2295645_+	Ig-like domain-containing protein	NA	NA	NA	NA	NA
WP_004217348.1|2295685_2296081_+	hypothetical protein	NA	A0A1B1P9F2	Acinetobacter_phage	38.5	4.3e-13
WP_004217346.1|2296082_2296337_+	hypothetical protein	NA	J9Q7U0	Salmonella_phage	52.4	1.0e-20
WP_004190646.1|2296346_2296580_+	hypothetical protein	NA	A0A2H4J0Y9	uncultured_Caudovirales_phage	47.1	5.8e-10
WP_004217344.1|2296566_2296950_+	hypothetical protein	NA	A0A0S2SYG4	Pseudomonas_phage	45.2	7.1e-21
WP_004217343.1|2296951_2297503_+	hypothetical protein	NA	G8C7Q1	Escherichia_phage	39.9	1.3e-28
WP_004190640.1|2297499_2297892_+	electron transfer flavoprotein subunit beta	NA	NA	NA	NA	NA
WP_004217341.1|2297915_2299088_+	Ig domain-containing protein	NA	A0A0D4DBN5	Acinetobacter_phage	27.0	1.2e-23
WP_004226994.1|2299141_2299624_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016831940.1|2299761_2299968_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004217333.1|2300044_2300401_+	hypothetical protein	NA	A0A1V0E5P9	Salmonella_phage	75.0	1.1e-44
WP_099119318.1|2300625_2300817_+	hypothetical protein	NA	S4TR42	Salmonella_phage	78.3	7.8e-05
WP_004217331.1|2301078_2303976_+|tail	phage tail length tape measure family protein	tail	A0A2H4J107	uncultured_Caudovirales_phage	32.7	1.6e-104
WP_004152648.1|2304059_2304395_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152649.1|2304709_2305174_+	hypothetical protein	NA	A0A286S298	Klebsiella_phage	67.8	6.7e-58
WP_004152650.1|2305354_2305837_+	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	94.4	1.7e-80
WP_004152651.1|2305846_2306227_+	hypothetical protein	NA	A0A286S2A6	Klebsiella_phage	99.2	1.8e-72
WP_004152652.1|2306223_2309292_+	hypothetical protein	NA	A0A286S259	Klebsiella_phage	97.5	0.0e+00
>prophage 8
NZ_CP009771	Klebsiella pneumoniae subsp. pneumoniae strain KPNIH33 chromosome, complete genome	5574202	2314123	2323944	5574202	transposase	Salmonella_phage(28.57%)	7	NA	NA
WP_004152703.1|2314123_2316067_-	hypothetical protein	NA	A0A286S1P0	Klebsiella_phage	69.8	1.1e-37
WP_001067855.1|2316315_2317020_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_004178082.1|2318929_2320417_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_002901812.1|2320496_2320916_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	57.5	1.4e-35
WP_002901813.1|2320917_2322183_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	82.7	9.6e-208
WP_071531199.1|2322258_2323086_-	FRG domain-containing protein	NA	A0A1S6KZX9	Salmonella_phage	30.2	8.4e-19
WP_002901815.1|2323272_2323944_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	59.6	4.5e-79
>prophage 9
NZ_CP009771	Klebsiella pneumoniae subsp. pneumoniae strain KPNIH33 chromosome, complete genome	5574202	2356877	2428631	5574202	holin,terminase,plate,integrase,transposase	uncultured_Caudovirales_phage(35.29%)	83	2354958:2354972	2363898:2363912
2354958:2354972	attL	AGTTGATCCTCTGGC	NA	NA	NA	NA
WP_004152144.1|2356877_2357639_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.5	2.4e-20
WP_004152145.1|2357855_2359388_+	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	30.0	1.1e-21
WP_016197745.1|2359586_2360135_-	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
WP_004152147.1|2360331_2361513_+|integrase	site-specific integrase	integrase	A0A0M4QX09	Salmonella_phage	84.2	5.6e-202
WP_004152148.1|2361493_2361736_-	hypothetical protein	NA	A0A0M4RTZ2	Salmonella_phage	73.8	2.2e-20
WP_004198245.1|2361695_2361842_-	hypothetical protein	NA	A0A1B5FPC2	Escherichia_phage	70.8	2.9e-15
WP_014343018.1|2361914_2362148_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152150.1|2362390_2362603_-	hypothetical protein	NA	A0A286S2B6	Klebsiella_phage	98.6	3.4e-33
WP_004152151.1|2362599_2362824_-	hypothetical protein	NA	A0A286S2B3	Klebsiella_phage	89.2	3.1e-29
WP_004154298.1|2362813_2363524_-	Rha family transcriptional regulator	NA	A0A286S260	Klebsiella_phage	88.3	2.1e-111
WP_004152153.1|2363529_2364048_-	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	98.8	1.7e-94
2363898:2363912	attR	GCCAGAGGATCAACT	NA	NA	NA	NA
WP_004152154.1|2364152_2364980_-	hypothetical protein	NA	Q8W654	Enterobacteria_phage	84.0	5.5e-111
WP_004152155.1|2364976_2365171_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152156.1|2365167_2365593_-	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	77.9	3.5e-53
WP_004177208.1|2365589_2365808_-	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	98.6	6.6e-32
WP_004152157.1|2365779_2366034_-	hypothetical protein	NA	A0A286SGR4	Klebsiella_phage	97.6	3.1e-41
WP_004152158.1|2366026_2366392_-	hypothetical protein	NA	A0A286S1Q6	Klebsiella_phage	99.2	6.9e-58
WP_004152159.1|2366561_2366750_-	hypothetical protein	NA	A0A286S1P8	Klebsiella_phage	100.0	4.6e-26
WP_004152160.1|2366742_2367057_-	hypothetical protein	NA	A0A286S1T9	Klebsiella_phage	100.0	1.0e-49
WP_004152161.1|2367227_2367896_-	LexA family transcriptional regulator	NA	A0A286S2B2	Klebsiella_phage	99.5	2.4e-125
WP_004152162.1|2367993_2368215_+	helix-turn-helix transcriptional regulator	NA	A0A286S2C1	Klebsiella_phage	100.0	3.0e-32
WP_004198228.1|2368791_2370450_+	DEAD/DEAH box helicase	NA	A0A286N2P9	Klebsiella_phage	96.0	0.0e+00
WP_004198233.1|2370451_2371414_+	toprim domain-containing protein	NA	A0A286N2Q0	Klebsiella_phage	99.4	4.8e-183
WP_004198239.1|2371410_2371887_+	hypothetical protein	NA	A0A286N2Q1	Klebsiella_phage	100.0	1.8e-90
WP_004152167.1|2371883_2372666_+	antitermination protein	NA	F1C595	Cronobacter_phage	76.8	7.2e-113
WP_004146526.1|2373071_2373320_+|holin	class II holin family protein	holin	NA	NA	NA	NA
WP_004152169.1|2373322_2373853_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	77.1	2.7e-79
WP_004153952.1|2373849_2374239_+	lipase chaperone	NA	A0A192Y6H8	Salmonella_phage	49.2	9.4e-21
WP_004152170.1|2374473_2374794_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004218030.1|2375159_2375648_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152172.1|2375598_2376999_+|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	69.0	9.4e-188
WP_004152173.1|2377236_2378688_+	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	68.8	3.8e-192
WP_004152174.1|2378743_2379292_+	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	56.3	3.0e-49
WP_004199270.1|2379343_2380546_+	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	54.1	2.6e-106
WP_000528476.1|2380549_2381044_+	hypothetical protein	NA	A0A2H4JHM9	uncultured_Caudovirales_phage	62.7	4.2e-50
WP_001132269.1|2381055_2381997_+	DUF2184 domain-containing protein	NA	A0A2H4J191	uncultured_Caudovirales_phage	77.1	1.7e-137
WP_000725700.1|2382036_2382318_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000113538.1|2382286_2382706_+	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	60.7	3.3e-40
WP_000834982.1|2382702_2383209_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001116156.1|2383208_2383595_+	hypothetical protein	NA	A0A2H4J1A4	uncultured_Caudovirales_phage	78.2	1.1e-48
WP_004152176.1|2383689_2384130_+	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	51.7	1.6e-40
WP_004152177.1|2384133_2385279_+	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	76.9	6.3e-166
WP_004152178.1|2385289_2385580_+	DUF3277 family protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	85.5	2.6e-23
WP_085955245.1|2385520_2386713_-|transposase	IS3-like element ISKpn18 family transposase	transposase	U5P429	Shigella_phage	43.5	3.5e-50
WP_004152564.1|2387039_2387465_+	hypothetical protein	NA	A0A2H4J2V6	uncultured_Caudovirales_phage	63.4	2.6e-40
WP_004152565.1|2387500_2387653_+	hypothetical protein	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	88.0	7.6e-19
WP_004152566.1|2387642_2389646_+	lytic transglycosylase domain-containing protein	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	63.6	1.2e-247
WP_004152567.1|2389645_2390245_+	hypothetical protein	NA	A0A2H4J1B3	uncultured_Caudovirales_phage	57.6	9.9e-54
WP_004217362.1|2390320_2390548_+	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	56.0	4.6e-20
WP_004152569.1|2390550_2391573_+	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	54.2	9.2e-100
WP_004152570.1|2391572_2391914_+	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	46.6	1.8e-23
WP_004199301.1|2391963_2392146_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152571.1|2392188_2392755_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152572.1|2392808_2393462_+	hypothetical protein	NA	A0A2H4J8H6	uncultured_Caudovirales_phage	63.5	1.0e-59
WP_004152573.1|2393463_2393817_+	hypothetical protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	80.3	2.3e-50
WP_004152574.1|2393816_2395013_+|plate	baseplate J/gp47 family protein	plate	A0A0M4RD32	Salmonella_phage	72.9	3.9e-158
WP_004152575.1|2395009_2395783_+	DUF2612 domain-containing protein	NA	A0A2H4J1A9	uncultured_Caudovirales_phage	54.4	2.8e-77
WP_004152576.1|2395782_2396649_+	hypothetical protein	NA	A0A2H4IYR0	uncultured_Caudovirales_phage	64.5	1.9e-34
WP_004152577.1|2396648_2396846_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004218487.1|2399196_2399925_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002902128.1|2399935_2400667_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002902131.1|2400663_2400873_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002902133.1|2400977_2401262_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002902136.1|2401484_2401733_-	DinI-like family protein	NA	S5MQI1	Escherichia_phage	70.4	1.4e-25
WP_002902144.1|2402578_2403070_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_002902148.1|2403112_2404657_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_004218490.1|2404666_2406010_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_004151603.1|2406006_2406696_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_004151602.1|2406692_2408399_+	OmpA family protein	NA	NA	NA	NA	NA
WP_002902160.1|2408403_2408895_+	type VI secretion system effector Hcp	NA	NA	NA	NA	NA
WP_002902163.1|2409159_2411814_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	33.4	2.5e-96
WP_004228410.1|2411815_2414185_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	33.8	9.1e-18
WP_002902169.1|2414185_2414965_+	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_002902172.1|2415028_2415559_+	T6SS immunity phospholipase A1-binding lipoprotein Tli1-KP	NA	NA	NA	NA	NA
WP_002902174.1|2415627_2416158_+	T6SS immunity phospholipase A1-binding lipoprotein Tli1-KP	NA	NA	NA	NA	NA
WP_002902176.1|2416225_2416756_+	T6SS immunity phospholipase A1-binding lipoprotein Tli1-KP	NA	NA	NA	NA	NA
WP_002902178.1|2416824_2417355_+	T6SS immunity phospholipase A1-binding lipoprotein Tli1-KP	NA	NA	NA	NA	NA
WP_002902180.1|2417422_2417953_+	T6SS immunity phospholipase A1-binding lipoprotein Tli1-KP	NA	NA	NA	NA	NA
WP_004151601.1|2417940_2420358_+	DUF2235 domain-containing protein	NA	NA	NA	NA	NA
WP_002902252.1|2420402_2420660_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_002902254.1|2420656_2421796_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151599.1|2421779_2425205_+	type VI secretion protein VasK	NA	NA	NA	NA	NA
WP_004151598.1|2426876_2428631_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
>prophage 10
NZ_CP009771	Klebsiella pneumoniae subsp. pneumoniae strain KPNIH33 chromosome, complete genome	5574202	2618598	2629485	5574202		Escherichia_phage(87.5%)	9	NA	NA
WP_002210516.1|2618598_2619219_-	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
WP_004151609.1|2619211_2620477_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.5	6.6e-233
WP_004151610.1|2620488_2621391_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.3	7.7e-159
WP_002210513.1|2621651_2622413_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_004176269.1|2622433_2623294_-	class A broad-spectrum beta-lactamase SHV-11	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
WP_002904006.1|2623591_2623852_+	hypothetical protein	NA	A0A077SK33	Escherichia_phage	97.7	3.5e-40
WP_001620097.1|2623938_2625027_+	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
WP_004151612.1|2625057_2626323_-	MFS transporter	NA	NA	NA	NA	NA
WP_004151613.1|2626377_2629485_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.6	0.0e+00
>prophage 11
NZ_CP009771	Klebsiella pneumoniae subsp. pneumoniae strain KPNIH33 chromosome, complete genome	5574202	3266018	3309118	5574202	plate,tRNA,transposase	Microcystis_virus(25.0%)	41	NA	NA
WP_002910404.1|3266018_3267275_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_002910405.1|3267545_3268157_+	lipoprotein localization protein LolB	NA	NA	NA	NA	NA
WP_004217879.1|3268156_3269005_+	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_002910407.1|3269188_3270136_+	ribose-phosphate diphosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.5	2.3e-44
WP_004152259.1|3270260_3271940_+	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.4	7.9e-24
WP_002910436.1|3271940_3272987_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002910437.1|3273209_3273485_-	stress-induced protein YchH	NA	NA	NA	NA	NA
WP_002910438.1|3273757_3274342_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_002910443.1|3274459_3275551_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_002910446.1|3275633_3275843_-	DUF1869 domain-containing protein	NA	NA	NA	NA	NA
WP_002910453.1|3276044_3276959_-	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004152260.1|3277090_3278506_-	type VI secretion system ImpA family N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_004152261.1|3278525_3278969_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_002910493.1|3278971_3279508_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_004152910.1|3279488_3280505_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_002910495.1|3280534_3282298_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_004152262.1|3282431_3285842_-	type VI secretion protein VasK	NA	NA	NA	NA	NA
WP_004198077.1|3285825_3286983_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002910497.1|3286986_3287253_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_072093174.1|3287550_3287736_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171815252.1|3287996_3288299_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000019473.1|3288356_3289337_-|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_004152632.1|3289673_3290564_-	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A7H6	Microcystis_virus	29.8	4.1e-11
WP_002910539.1|3290739_3291633_-	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A075BSL8	Microcystis_phage	27.1	2.8e-12
WP_038435084.1|3291654_3291783_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152633.1|3291808_3292702_-	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A075BSL8	Microcystis_phage	27.3	1.7e-12
WP_004217423.1|3292723_3292840_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002910544.1|3292885_3293779_-	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A7H6	Microcystis_virus	30.5	6.7e-14
WP_002910547.1|3293800_3294106_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002910551.1|3295621_3296128_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004153085.1|3296124_3296454_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004199326.1|3296450_3296633_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022644641.1|3296774_3297743_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	96.3	6.5e-180
WP_002910586.1|3299348_3299858_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002910589.1|3299847_3300000_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002910591.1|3300094_3300601_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002910593.1|3300597_3301107_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152319.1|3301107_3302463_-	S-type pyocin domain-containing protein	NA	NA	NA	NA	NA
WP_004152317.1|3305426_3307124_-	OmpA family protein	NA	NA	NA	NA	NA
WP_004152316.1|3307127_3307781_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_002910645.1|3307777_3309118_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
>prophage 12
NZ_CP009771	Klebsiella pneumoniae subsp. pneumoniae strain KPNIH33 chromosome, complete genome	5574202	3715746	3723371	5574202		Escherichia_phage(28.57%)	7	NA	NA
WP_004152482.1|3715746_3716748_-	NAD-dependent epimerase	NA	E3T4Y8	Cafeteria_roenbergensis_virus	28.6	1.2e-30
WP_004152483.1|3716941_3718108_-	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.7	4.1e-112
WP_004152484.1|3718288_3718843_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	58.2	3.8e-52
WP_004152485.1|3718857_3719748_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	33.6	2.8e-28
WP_004152486.1|3719779_3720649_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	67.0	9.8e-111
WP_004152487.1|3720675_3721740_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	55.0	3.4e-105
WP_004152488.1|3721964_3723371_-	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.7	4.7e-38
>prophage 13
NZ_CP009771	Klebsiella pneumoniae subsp. pneumoniae strain KPNIH33 chromosome, complete genome	5574202	3759938	3766845	5574202	tRNA	Bacillus_phage(33.33%)	6	NA	NA
WP_004151135.1|3759938_3761417_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	1.1e-29
WP_002912634.1|3761413_3762136_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	6.4e-31
WP_002912635.1|3762454_3763816_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	94.5	2.5e-206
WP_004151134.1|3764058_3764955_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
WP_002912638.1|3765197_3765971_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.3	1.5e-25
WP_004175147.1|3765981_3766845_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	5.7e-10
>prophage 14
NZ_CP009771	Klebsiella pneumoniae subsp. pneumoniae strain KPNIH33 chromosome, complete genome	5574202	4095569	4139723	5574202	holin,terminase,integrase,tail	Salmonella_phage(32.65%)	57	4088361:4088375	4137143:4137157
4088361:4088375	attL	GCCGCTTCCGCCACC	NA	NA	NA	NA
WP_004152009.1|4095569_4097438_+	sulfatase-like hydrolase/transferase	NA	A0A2P0VMN7	Tetraselmis_virus	22.6	2.6e-07
WP_004152707.1|4097657_4098140_-	DUF2514 domain-containing protein	NA	Q858E9	Salmonella_phage	80.6	3.0e-61
WP_004152706.1|4098136_4098766_-	glycoside hydrolase family 19 protein	NA	Q858F0	Salmonella_phage	76.4	3.1e-90
WP_004146393.1|4098755_4099061_-|holin	phage holin family protein	holin	A0A193GYK3	Enterobacter_phage	82.4	2.7e-39
WP_004146394.1|4099047_4099452_-	membrane protein	NA	T1SA79	Salmonella_phage	84.1	9.3e-56
WP_004229092.1|4099575_4099728_-	hypothetical protein	NA	A0A2H5BN82	Klebsiella_phage	54.3	1.9e-06
WP_004207261.1|4099736_4102103_-	hypothetical protein	NA	A0A2H5BN49	Klebsiella_phage	79.5	9.1e-268
WP_004152432.1|4102259_4102556_+	hypothetical protein	NA	A0A0F6R8M4	Escherichia_coli_O157_typing_phage	64.0	1.1e-24
WP_004152433.1|4102870_4103560_+	Bro-N domain-containing protein	NA	G9L6E2	Escherichia_phage	65.2	1.6e-79
WP_032408580.1|4103650_4104022_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032408581.1|4104023_4106570_-	hypothetical protein	NA	W6MWW8	Pseudomonas_phage	46.0	7.6e-212
WP_032408582.1|4106569_4108276_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032408584.1|4108277_4110899_-	transglycosylase SLT domain-containing protein	NA	A0A0F6R8M6	Escherichia_coli_O157_typing_phage	32.9	7.9e-55
WP_038434656.1|4110910_4111450_-	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	79.5	3.6e-71
WP_004152438.1|4111449_4111914_-	hypothetical protein	NA	Q858G2	Salmonella_phage	81.2	1.5e-70
WP_004152439.1|4111913_4114412_-	hypothetical protein	NA	Q858G3	Salmonella_phage	84.0	0.0e+00
WP_004152440.1|4114411_4115017_-	hypothetical protein	NA	A0A0F6TJN5	Escherichia_coli_O157_typing_phage	78.5	2.8e-88
WP_004152441.1|4115016_4115340_-	hypothetical protein	NA	G9L6C8	Escherichia_phage	85.0	5.3e-46
WP_004152442.1|4115390_4115732_-	hypothetical protein	NA	G9L6C7	Escherichia_phage	70.8	4.0e-36
WP_004152443.1|4115742_4116180_-	hypothetical protein	NA	A0A193GYT9	Enterobacter_phage	91.0	4.8e-66
WP_004152444.1|4116233_4117220_-	hypothetical protein	NA	A0A193GZ49	Enterobacter_phage	93.9	1.6e-178
WP_004152445.1|4117234_4117915_-	peptidase	NA	G9L6C4	Escherichia_phage	83.5	4.0e-75
WP_004152446.1|4117917_4118214_-	hypothetical protein	NA	T1SBI9	Salmonella_phage	70.4	1.2e-33
WP_004152447.1|4118210_4119893_-|tail	tail protein	tail	A0A0F6TJD8	Escherichia_coli_O157_typing_phage	84.6	2.3e-265
WP_004141368.1|4119907_4120114_-	hypothetical protein	NA	T1SA67	Salmonella_phage	88.2	4.8e-08
WP_004152473.1|4120817_4121339_+	DUF2829 domain-containing protein	NA	A0A1B0VMG3	Pseudomonas_phage	55.2	7.8e-47
WP_004164044.1|4121382_4122858_-	hypothetical protein	NA	Q858H3	Salmonella_phage	92.9	1.9e-279
WP_004152523.1|4122854_4123439_-|terminase	terminase small subunit	terminase	T1SBI8	Salmonella_phage	88.1	2.4e-89
WP_004152524.1|4123516_4123774_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152525.1|4123848_4124187_-	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	80.0	4.7e-45
WP_004152526.1|4124186_4124426_-	hypothetical protein	NA	G8C7S3	Escherichia_phage	48.0	4.6e-10
WP_004152527.1|4124418_4125087_-	DUF551 domain-containing protein	NA	Q6UAT8	Klebsiella_phage	52.5	1.5e-05
WP_004141386.1|4125083_4125296_-	hypothetical protein	NA	A0A0F6TJE4	Escherichia_coli_O157_typing_phage	45.5	8.1e-11
WP_004152528.1|4125296_4125467_-	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	69.6	2.5e-15
WP_004152529.1|4125466_4126210_-	hypothetical protein	NA	A6N3G8	Burkholderia_virus	59.5	1.5e-19
WP_004152530.1|4126206_4126632_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152531.1|4126628_4126820_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152532.1|4126803_4127214_-	hypothetical protein	NA	A0A2P1MXC5	Escherichia_phage	42.2	3.1e-14
WP_004152534.1|4127406_4127754_-	DUF1064 domain-containing protein	NA	A0A0F6R8N5	Escherichia_coli_O157_typing_phage	82.6	5.0e-50
WP_038434657.1|4127873_4128659_-	replication protein	NA	A0A193GYX1	Enterobacter_phage	87.0	1.6e-131
WP_004207253.1|4128655_4129423_-	hypothetical protein	NA	A0A193GZ86	Enterobacter_phage	91.4	8.9e-140
WP_004152537.1|4129422_4129632_-	hypothetical protein	NA	A0A193GYW4	Enterobacter_phage	78.3	1.8e-26
WP_004152538.1|4129778_4130012_-	hypothetical protein	NA	T1SAR5	Salmonella_phage	66.2	9.2e-24
WP_004152539.1|4130165_4130747_+	helix-turn-helix transcriptional regulator	NA	Q858D7	Salmonella_phage	64.8	1.9e-65
WP_004164037.1|4130967_4131117_+	hypothetical protein	NA	G9L6A5	Escherichia_phage	84.2	7.9e-13
WP_004164029.1|4131113_4131413_+	hypothetical protein	NA	A0A0F6R7M4	Escherichia_coli_O157_typing_phage	54.5	2.1e-20
WP_004152541.1|4131409_4132309_+	YqaJ viral recombinase family protein	NA	Q858E0	Salmonella_phage	93.0	1.5e-159
WP_004152542.1|4132318_4133341_+	recombination protein RecT	NA	Q858E1	Salmonella_phage	95.3	2.4e-180
WP_004152543.1|4133392_4133641_+	AlpA family phage regulatory protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	69.5	1.1e-27
WP_004153052.1|4133750_4134044_+	PerC family transcriptional regulator	NA	T1S9J5	Salmonella_phage	71.1	8.9e-32
WP_004152545.1|4134036_4134195_+	DUF1317 family protein	NA	T1SAR0	Salmonella_phage	78.8	1.9e-17
WP_004152546.1|4134191_4134785_+	adenine methylase	NA	T1SA14	Salmonella_phage	92.4	4.3e-110
WP_004152547.1|4134781_4134964_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152548.1|4134960_4135152_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152549.1|4135168_4136419_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1X9TCT6	Enterobacter_phage	85.3	1.4e-206
WP_004151979.1|4136611_4138189_-	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
4137143:4137157	attR	GGTGGCGGAAGCGGC	NA	NA	NA	NA
WP_004151980.1|4138256_4139723_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.7	1.2e-87
>prophage 15
NZ_CP009771	Klebsiella pneumoniae subsp. pneumoniae strain KPNIH33 chromosome, complete genome	5574202	4211073	4290683	5574202	terminase,tRNA,tail,capsid,plate,portal,integrase,head,lysis	Salmonella_phage(72.0%)	87	4255777:4255823	4292344:4292390
WP_002914079.1|4211073_4211811_-|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_002914082.1|4211942_4213274_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.9	6.2e-48
WP_002914084.1|4213319_4213703_-	autonomous glycyl radical cofactor GrcA	NA	A0A193GZ98	Escherichia_phage	79.3	4.0e-32
WP_002914088.1|4214016_4214706_+	uracil-DNA glycosylase	NA	A0A077BCN4	Equid_alphaherpesvirus	53.0	1.3e-57
WP_002914089.1|4214763_4215849_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_002914091.1|4216052_4216478_+	thioredoxin TrxC	NA	A0A1J0GW78	Streptomyces_phage	40.2	6.0e-13
WP_002914092.1|4216547_4217246_+|tRNA	tRNA-uridine aminocarboxypropyltransferase	tRNA	NA	NA	NA	NA
WP_004151994.1|4217280_4219941_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_002914094.1|4220061_4221417_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_002914095.1|4221458_4221782_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_002914097.1|4221785_4223084_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	31.5	3.1e-44
WP_004150973.1|4229049_4231623_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.4	6.9e-128
WP_002914109.1|4231752_4232484_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_002914110.1|4232480_4233461_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_004145664.1|4233592_4234330_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_002914111.1|4234600_4234936_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_100250063.1|4235042_4235090_+	pheA operon leader peptide PheL	NA	NA	NA	NA	NA
WP_004150975.1|4235190_4236351_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_002914112.1|4236347_4237220_-	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_002914113.1|4237282_4238404_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_002914114.1|4238413_4239484_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.5	1.8e-90
WP_004174804.1|4239826_4240336_+	YfiR family protein	NA	NA	NA	NA	NA
WP_002914116.1|4240328_4241552_+	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_002914117.1|4241565_4242048_+	OmpA family protein	NA	NA	NA	NA	NA
WP_002914118.1|4242056_4243427_-	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_002914119.1|4243483_4243942_-	DUF2946 domain-containing protein	NA	NA	NA	NA	NA
WP_002914145.1|4244061_4244409_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_002914147.1|4244448_4245216_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_004150977.1|4245247_4245796_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_002914149.1|4245814_4246063_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_002914152.1|4246322_4247687_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_002914153.1|4247850_4248642_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_004149392.1|4248661_4249948_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_002914155.1|4250067_4250658_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_002914158.1|4250782_4251661_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_002914159.1|4251747_4253409_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_002914160.1|4253556_4253898_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_002914161.1|4253964_4254255_-	RnfH family protein	NA	NA	NA	NA	NA
WP_004188817.1|4254244_4254721_-	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_002914164.1|4254831_4255314_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	2.3e-29
4255777:4255823	attL	ATGTAGGAATTTCGGACGCGGGTTCAACTCCCGCCAGCTCCACCAAA	NA	NA	NA	NA
WP_004150980.1|4255917_4256295_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150981.1|4256322_4256541_-	ogr/Delta-like zinc finger family protein	NA	Q53ZE7	Salmonella_virus	72.2	1.9e-26
WP_004150982.1|4256607_4257702_-	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	83.6	2.4e-170
WP_004150983.1|4257698_4258184_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.1	5.2e-61
WP_004150984.1|4258180_4260811_-|tail	phage tail tape measure protein	tail	E5FFG5	Burkholderia_phage	41.9	8.9e-115
WP_002896220.1|4260803_4260923_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
WP_004150985.1|4260937_4261237_-|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	78.0	8.2e-33
WP_004150986.1|4261289_4261805_-|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	84.2	1.4e-80
WP_004150987.1|4261814_4262987_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	91.5	3.4e-207
WP_004150988.1|4263135_4264209_-|tail	phage tail protein	tail	A0A1S6KZZ8	Salmonella_phage	53.6	6.6e-40
WP_004200602.1|4264260_4265379_-	hypothetical protein	NA	A0A248XD67	Klebsiella_phage	38.0	4.4e-55
WP_004150990.1|4265388_4267338_-	CotH kinase family protein	NA	Q6QI97	Burkholderia_phage	38.9	1.0e-06
WP_004152935.1|4267339_4268011_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	58.9	3.2e-61
WP_004150992.1|4268003_4268912_-|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	68.9	1.9e-109
WP_004150993.1|4268898_4269261_-	GPW/gp25 family protein	NA	A0A1S6KZZ4	Salmonella_phage	85.6	8.4e-48
WP_004150994.1|4269257_4269830_-|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	70.8	1.4e-76
WP_004150995.1|4269924_4270791_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150996.1|4270813_4271260_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	72.3	2.5e-54
WP_004150997.1|4271252_4271675_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	83.2	8.2e-63
WP_072093160.1|4271637_4271796_-	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	75.0	9.0e-15
WP_004150998.1|4271770_4272199_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	82.5	7.1e-54
WP_004150999.1|4272195_4272579_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	45.4	1.9e-18
WP_004151000.1|4272583_4273093_-	lysozyme	NA	E5G6N1	Salmonella_phage	85.2	1.6e-81
WP_004134639.1|4273073_4273289_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	88.7	6.1e-30
WP_004151001.1|4273292_4273496_-|tail	tail protein X	tail	E5G6M9	Salmonella_phage	89.6	9.8e-30
WP_004151002.1|4273495_4273960_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	85.7	1.5e-73
WP_004134644.1|4274055_4274709_-|terminase	terminase endonuclease subunit	terminase	A0A1S6KZX1	Salmonella_phage	80.0	1.9e-90
WP_004151003.1|4274712_4275765_-|capsid	phage major capsid protein, P2 family	capsid	A0A1S6KZZ3	Salmonella_phage	91.0	6.8e-175
WP_004151004.1|4275781_4276615_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	77.6	4.4e-100
WP_019405037.1|4276755_4278519_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	91.8	0.0e+00
WP_004151006.1|4278518_4279562_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	85.6	3.1e-172
WP_024940854.1|4279618_4279888_-	hypothetical protein	NA	D2IZW1	Enterococcus_phage	41.3	1.4e-15
WP_004151007.1|4280409_4281411_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151008.1|4281410_4282490_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151009.1|4282476_4283160_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151010.1|4283255_4283489_-	DinI family protein	NA	A0A0M4S6H1	Salmonella_phage	96.1	2.0e-34
WP_004151011.1|4283500_4283689_-	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	90.3	2.2e-23
WP_004151012.1|4283851_4286236_-	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	87.9	0.0e+00
WP_004151013.1|4286232_4287084_-	DNA adenine methylase	NA	A0A1S6L011	Salmonella_phage	75.4	2.2e-115
WP_004151014.1|4287080_4287308_-	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	92.0	5.1e-35
WP_004151016.1|4287307_4287541_-	DUF2732 family protein	NA	A0A1S6L021	Salmonella_phage	90.9	6.0e-31
WP_004144796.1|4287608_4287947_-	DUF5347 domain-containing protein	NA	A0A218M4I7	Erwinia_phage	58.0	6.2e-29
WP_004151017.1|4287910_4288111_-	DUF2724 domain-containing protein	NA	A0A1S6L005	Salmonella_phage	68.8	4.5e-19
WP_004151018.1|4288118_4288628_-	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	85.8	1.1e-77
WP_001397669.1|4288660_4288903_-	hypothetical protein	NA	A0A1S6KZZ6	Salmonella_phage	98.8	4.0e-38
WP_004151019.1|4289025_4289655_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	54.5	1.4e-61
WP_004151020.1|4289657_4290683_+|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	93.8	1.5e-190
4292344:4292390	attR	ATGTAGGAATTTCGGACGCGGGTTCAACTCCCGCCAGCTCCACCAAA	NA	NA	NA	NA
>prophage 16
NZ_CP009771	Klebsiella pneumoniae subsp. pneumoniae strain KPNIH33 chromosome, complete genome	5574202	5006309	5055152	5574202	terminase,tRNA,tail,capsid,portal,protease,head	uncultured_Caudovirales_phage(68.75%)	56	NA	NA
WP_002918465.1|5006309_5006804_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	54.8	1.5e-26
WP_002918467.1|5006807_5007446_-	stringent starvation protein A	NA	NA	NA	NA	NA
WP_135801240.1|5007415_5007700_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000829818.1|5007757_5008150_-	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_002918559.1|5008165_5008594_-	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_004144945.1|5008859_5009987_-	cell division protein ZapE	NA	NA	NA	NA	NA
WP_002918565.1|5010177_5010576_+	DUF1043 family protein	NA	NA	NA	NA	NA
WP_002918566.1|5010749_5012117_+|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.3	6.0e-22
WP_002918568.1|5012204_5013263_+	outer membrane-stress sensor serine endopeptidase DegS	NA	NA	NA	NA	NA
WP_002918570.1|5013399_5014338_-	malate dehydrogenase	NA	NA	NA	NA	NA
WP_002918625.1|5014752_5015223_+	transcriptional regulator ArgR	NA	NA	NA	NA	NA
WP_002918626.1|5015598_5015862_+	peroxide/acid stress response protein YhcN	NA	NA	NA	NA	NA
WP_002918627.1|5015960_5016227_+	peroxide/acid stress response protein YhcN	NA	NA	NA	NA	NA
WP_002918629.1|5016277_5016553_-	barstar family protein	NA	NA	NA	NA	NA
WP_002918632.1|5016632_5018600_-	p-hydroxybenzoic acid efflux pump subunit AaeB	NA	NA	NA	NA	NA
WP_002918639.1|5018605_5019538_-	p-hydroxybenzoic acid efflux pump subunit AaeA	NA	NA	NA	NA	NA
WP_002918640.1|5019545_5019749_-	AaeX family protein	NA	NA	NA	NA	NA
WP_002918641.1|5019880_5020810_+	HTH-type transcriptional activator AaeR	NA	NA	NA	NA	NA
WP_002918642.1|5020845_5022291_-|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_004150952.1|5022379_5026177_-	AsmA2 domain-containing protein YhdP	NA	NA	NA	NA	NA
WP_002918644.1|5026214_5027684_-	ribonuclease G	NA	NA	NA	NA	NA
WP_002918646.1|5027686_5028268_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_002918648.1|5028275_5028764_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_004149974.1|5028763_5029756_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_002918653.1|5029826_5030870_-	rod shape-determining protein MreB	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
WP_002918686.1|5031175_5033116_-	RNase E specificity factor CsrD	NA	NA	NA	NA	NA
WP_002918687.1|5033195_5033387_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002918688.1|5033615_5034617_+	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
WP_002918689.1|5034616_5035225_+	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
WP_002918732.1|5035448_5035901_+	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_002918736.1|5035923_5036391_+	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_002918738.1|5036401_5037751_+	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_002918740.1|5037861_5038104_+	YhdT family protein	NA	NA	NA	NA	NA
WP_002918742.1|5038093_5039545_+	sodium/pantothenate symporter	NA	NA	NA	NA	NA
WP_002918745.1|5039556_5040438_+	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_004144972.1|5040795_5041761_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_000462905.1|5041785_5042082_+	DNA-binding transcriptional regulator Fis	NA	NA	NA	NA	NA
WP_004150954.1|5042235_5042427_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150955.1|5042429_5044091_-|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	98.0	0.0e+00
WP_000113647.1|5044074_5044431_-|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	99.2	5.5e-60
WP_004150957.1|5044561_5044714_-	hypothetical protein	NA	A0A2H4JCY9	uncultured_Caudovirales_phage	88.0	2.4e-17
WP_004150959.1|5044706_5045150_-	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	91.8	2.8e-77
WP_001547824.1|5045149_5045449_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	80.8	3.4e-39
WP_004150961.1|5045445_5045781_-|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	57.8	3.7e-26
WP_004150962.1|5045777_5047019_-|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	96.5	1.0e-230
WP_001547826.1|5047020_5047581_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	95.7	1.2e-98
WP_001549743.1|5047632_5048799_-|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	95.9	9.8e-207
WP_004150963.1|5049062_5049575_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150964.1|5049623_5049959_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150965.1|5050301_5052437_-	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	62.4	3.4e-205
WP_001549749.1|5052436_5052802_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150966.1|5052798_5053167_-	hypothetical protein	NA	A0A2H4JCX7	uncultured_Caudovirales_phage	81.1	3.7e-51
WP_004150967.1|5053163_5053478_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001549752.1|5053470_5053659_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106918304.1|5053651_5053921_-	host cell division inhibitor Icd-like protein	NA	A0A2H4JGW3	uncultured_Caudovirales_phage	94.4	2.4e-44
WP_004150969.1|5054372_5055152_-	phage antirepressor KilAC domain-containing protein	NA	Q8HA02	Enterobacteria_phage	51.5	6.2e-40
>prophage 1
NZ_CP009773	Klebsiella pneumoniae subsp. pneumoniae strain KPNIH33 plasmid pKPC-63d, complete sequence	75618	48	69459	75618	transposase	Escherichia_phage(16.13%)	65	NA	NA
WP_012539983.1|48_804_+	replication initiation protein RepE	NA	I3WF20	Macacine_betaherpesvirus	95.2	1.7e-135
WP_022644883.1|891_2430_-|transposase	IS66-like element ISKpn24 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	94.7	4.6e-281
WP_000612626.1|2478_2826_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_007372134.1|2822_3227_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	97.8	1.6e-68
WP_015632469.1|4008_5214_+	AAA family ATPase	NA	A0A077SL49	Escherichia_phage	69.6	4.0e-163
WP_022644882.1|5213_6188_+	ParB/RepB/Spo0J family partition protein	NA	A0A1B0V750	Salmonella_phage	55.0	9.4e-86
WP_022644881.1|6269_7541_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.5	1.6e-149
WP_020805749.1|7540_7972_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	53.3	3.6e-29
WP_001568038.1|8204_9176_+	hypothetical protein	NA	A0A222YXF2	Escherichia_phage	46.8	1.1e-73
WP_022644880.1|9178_9850_+	plasmid partitioning/stability family protein	NA	NA	NA	NA	NA
WP_001568040.1|9911_10142_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152355.1|10578_11280_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.7	7.1e-27
WP_001568042.1|11279_11501_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040120234.1|11510_11930_+	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_032072058.1|11983_12751_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025404028.1|13431_13860_+	antirestriction protein	NA	NA	NA	NA	NA
WP_022644900.1|13904_14411_+	antirestriction protein ArdA	NA	G9FHQ1	Rhodococcus_virus	31.9	6.9e-08
WP_022644899.1|14453_14645_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025404029.1|14838_15093_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	50.7	2.6e-11
WP_022644897.1|15128_15449_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022644896.1|16123_16666_+	single-stranded DNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	74.4	1.7e-49
WP_022644895.1|16714_16963_+	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_022644894.1|17031_19032_+	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	26.5	3.2e-24
WP_015632482.1|19076_19508_+	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_022644893.1|19504_20233_+	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_015632484.1|20229_20556_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087439983.1|20744_22119_+|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	74.1	1.4e-79
WP_022644891.1|22289_23330_+	ATP-binding protein	NA	M4QMW8	Micromonas_pusilla_virus	35.2	9.5e-20
WP_162859354.1|23535_25818_+	S8 family peptidase	NA	NA	NA	NA	NA
WP_015065592.1|26251_27784_-|transposase	IS3-like element ISKpn38 family transposase	transposase	A0A1B1P773	Bacillus_phage	39.8	3.1e-51
WP_004196353.1|27872_29213_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_032072095.1|29468_29891_-	nickel resistance OB fold protein NcrY	NA	NA	NA	NA	NA
WP_004196366.1|30052_31183_-	Ni(II)/Co(II) efflux transporter permease subunit NcrC	NA	NA	NA	NA	NA
WP_004196355.1|31195_31465_-	nickel-sensing transcriptional repressor NcrB	NA	NA	NA	NA	NA
WP_004196314.1|31570_32869_-	MFS transporter	NA	NA	NA	NA	NA
WP_004196325.1|33102_33861_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004196315.1|33914_34835_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004196359.1|34897_35269_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152397.1|36180_37500_+|transposase	IS1182-like element ISKpn6 family transposase	transposase	Q9MBP7	Staphylococcus_prophage	24.2	1.9e-12
WP_004152396.1|37749_38631_-	carbapenem-hydrolyzing class A beta-lactamase KPC-3	NA	A0A1B0VBP7	Salmonella_phage	52.2	2.8e-73
WP_004152394.1|38949_39729_-	IS21-like element ISKpn7 family helper ATPase IstB	NA	A0A2L1IVB6	Escherichia_phage	61.8	2.5e-89
WP_004199214.1|39725_40751_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	50.3	1.4e-87
WP_004152392.1|40857_43887_-|transposase	Tn3-like element Tn4401 family transposase	transposase	NA	NA	NA	NA
WP_004152391.1|43996_45712_+	Tn3-like element Tn4401 family resolvase TnpR	NA	NA	NA	NA	NA
WP_001217881.1|46826_47384_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	98.4	2.0e-93
WP_014454105.1|47617_48172_+	aminoglycoside N-acetyltransferase AAC(6')-Ib'	NA	NA	NA	NA	NA
WP_001206315.1|48241_49030_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_000722315.1|49089_49914_+	oxacillin-hydrolyzing class D beta-lactamase OXA-9	NA	NA	NA	NA	NA
WP_000027057.1|50613_51474_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_000480968.1|52194_53031_-	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_001082319.1|53030_53834_-	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
WP_001043260.1|53894_54710_-	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
WP_000954592.1|55039_55216_+	DUF4102 domain-containing protein	NA	T1S9J3	Salmonella_phage	68.6	1.0e-06
WP_000427619.1|55397_56402_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_020802676.1|58970_61868_-|transposase	Tn3-like element Tn5403 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.8	5.5e-182
WP_000509966.1|61962_62568_+	recombinase family protein	NA	A0A1S5Y2X8	uncultured_archaeal_virus	35.3	5.5e-20
WP_025404032.1|62707_63013_+	IncN plasmid KikA protein	NA	NA	NA	NA	NA
WP_001452736.1|63048_63360_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064577928.1|63568_64057_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_001749967.1|64061_64268_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072094655.1|64679_66083_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.6	9.0e-106
WP_004098817.1|66116_67331_-	type II site-specific deoxyribonuclease	NA	E5E3X4	Burkholderia_phage	42.5	1.2e-34
WP_001389365.1|67591_68356_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_001144737.1|68498_68765_-	plasmid mobilization relaxosome protein MobC	NA	NA	NA	NA	NA
WP_004201280.1|68985_69459_-	trimethoprim-resistant dihydrofolate reductase DfrA14	NA	G3MBI7	Bacillus_virus	28.9	8.4e-16
