The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP009748	Bacillus subtilis strain ATCC 13952, complete genome	3876276	607936	617827	3876276		Synechococcus_phage(50.0%)	9	NA	NA
WP_014469853.1|607936_609229_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	27.3	1.3e-18
WP_014469854.1|609304_610024_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3G7P8	Synechococcus_phage	45.2	9.8e-48
WP_014469855.1|610023_610278_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	A0A0E3FKD5	Synechococcus_phage	35.8	2.1e-05
WP_014469856.1|610274_610958_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_014469857.1|610941_613170_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	40.9	3.8e-159
WP_014469858.1|613145_614576_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.9	2.8e-54
WP_014469859.1|614667_615708_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	41.4	8.2e-64
WP_014469860.1|615704_616292_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	39.9	1.0e-26
WP_014469861.1|616288_617827_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	52.1	2.3e-78
>prophage 2
NZ_CP009748	Bacillus subtilis strain ATCC 13952, complete genome	3876276	1084161	1117738	3876276	coat,protease,tRNA	Planktothrix_phage(16.67%)	37	NA	NA
WP_012117281.1|1084161_1085154_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_013351824.1|1085898_1087533_+	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_013351825.1|1087639_1088575_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_013351826.1|1088578_1089496_+	oligopeptide ABC transporter permease OppC	NA	NA	NA	NA	NA
WP_013351827.1|1089508_1090585_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.9	1.7e-16
WP_014470613.1|1090577_1091495_+	oligopeptide ABC transporter ATP-binding protein OppF	NA	M1HP82	Acanthocystis_turfacea_Chlorella_virus	24.6	1.5e-05
WP_013351829.1|1091602_1092790_+	putative glycoside hydrolase	NA	NA	NA	NA	NA
WP_013351830.1|1092907_1093486_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003327578.1|1093663_1094059_+	transcriptional regulator Spx	NA	NA	NA	NA	NA
WP_013351831.1|1094116_1094773_-	TerC family protein	NA	A0A0S4KZH7	Pseudomonas_phage	41.0	1.3e-30
WP_014470612.1|1095048_1095705_+	adaptor protein MecA	NA	NA	NA	NA	NA
WP_013351833.1|1095856_1097017_+	competence protein CoiA	NA	NA	NA	NA	NA
WP_013351834.1|1097245_1099075_+	oligoendopeptidase F	NA	NA	NA	NA	NA
WP_013351835.1|1099562_1100465_-|protease	protease adaptor protein SpxH	protease	NA	NA	NA	NA
WP_013351836.1|1100461_1100860_-	thiol management oxidoreductase	NA	NA	NA	NA	NA
WP_013351837.1|1101084_1101771_-	lytic transglycosylase domain-containing protein	NA	A0A1P8CWQ1	Bacillus_phage	70.3	1.3e-38
WP_013351838.1|1101775_1102348_-	CYTH domain-containing protein	NA	NA	NA	NA	NA
WP_013351839.1|1102472_1102838_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013351840.1|1102865_1103501_+	GTP diphosphokinase	NA	NA	NA	NA	NA
WP_013351841.1|1103518_1104319_+	NAD kinase	NA	NA	NA	NA	NA
WP_013351842.1|1104333_1105227_+	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	30.6	5.7e-05
WP_013351843.1|1105260_1106010_-	bis(5'-nucleosyl)-tetraphosphatase PrpE	NA	A0A1V0SJW2	Klosneuvirus	26.0	2.9e-10
WP_014470611.1|1106235_1108080_+	monovalent cation:proton antiporter family protein	NA	NA	NA	NA	NA
WP_013351845.1|1108328_1109039_+	thiaminase II	NA	NA	NA	NA	NA
WP_014470610.1|1109013_1109631_+	thiazole tautomerase TenI	NA	NA	NA	NA	NA
WP_013351847.1|1109614_1110724_+	glycine oxidase ThiO	NA	NA	NA	NA	NA
WP_013351848.1|1110720_1110924_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_007610655.1|1110920_1111691_+	thiazole synthase	NA	NA	NA	NA	NA
WP_013351849.1|1111687_1112698_+	thiazole biosynthesis adenylyltransferase ThiF	NA	NA	NA	NA	NA
WP_013351850.1|1112720_1113533_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_013351851.1|1113663_1114440_+	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_013351852.1|1114537_1115125_+|coat	spore coat protein	coat	NA	NA	NA	NA
WP_013351853.1|1115182_1115626_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_013351854.1|1115774_1116257_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_013351855.1|1116406_1116907_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_013351856.1|1116999_1117314_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470608.1|1117351_1117738_-|coat	spore coat protein	coat	NA	NA	NA	NA
>prophage 3
NZ_CP009748	Bacillus subtilis strain ATCC 13952, complete genome	3876276	1129569	1184656	3876276	head,holin,integrase,plate,portal,tail,terminase	uncultured_Caudovirales_phage(52.83%)	81	1129511:1129528	1178952:1178969
1129511:1129528	attL	TGGGGACGAATTGGGGAC	NA	NA	NA	NA
WP_014470602.1|1129569_1130799_-|integrase	site-specific integrase	integrase	A0A0K2CZ62	Paenibacillus_phage	50.0	4.2e-107
WP_014470601.1|1130803_1131325_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4JA43	uncultured_Caudovirales_phage	64.0	1.6e-55
WP_014470600.1|1131391_1131874_-	PH domain-containing protein	NA	O64019	Bacillus_phage	90.6	4.8e-75
WP_014470599.1|1131890_1132865_-	thermonuclease family protein	NA	A0A1P8CWK6	Bacillus_phage	77.5	4.5e-80
WP_014470598.1|1133183_1133570_-	helix-turn-helix transcriptional regulator	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	70.7	1.1e-26
WP_014470597.1|1133727_1133952_+	helix-turn-helix transcriptional regulator	NA	A0A2H4J4N8	uncultured_Caudovirales_phage	79.7	3.6e-25
WP_014470596.1|1133962_1134154_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_014470595.1|1134304_1134877_+	helix-turn-helix transcriptional regulator	NA	A0A2H4J884	uncultured_Caudovirales_phage	56.6	3.4e-59
WP_014470594.1|1134873_1135131_+	hypothetical protein	NA	A0A2H4J4M9	uncultured_Caudovirales_phage	42.7	2.1e-08
WP_014470593.1|1135127_1135331_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014470592.1|1135433_1135619_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014470591.1|1135618_1136536_+	hypothetical protein	NA	A0A0A7S0A9	Clostridium_phage	62.1	1.5e-88
WP_076983677.1|1136555_1137293_+	PD-(D/E)XK nuclease-like domain-containing protein	NA	A0A0A7RUC1	Clostridium_phage	44.0	2.2e-50
WP_014470589.1|1137292_1137481_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014472599.1|1137490_1138198_+	DnaD domain protein	NA	NA	NA	NA	NA
WP_031378524.1|1138115_1138910_+	ATP-binding protein	NA	A6XMI1	Bacillus_virus	50.0	4.5e-62
WP_014470585.1|1139140_1139569_+	RusA family crossover junction endodeoxyribonuclease	NA	S6B1L9	Thermus_phage	62.0	3.6e-42
WP_003155894.1|1139860_1140064_+	XtrA/YqaO family protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	75.4	3.4e-22
WP_014470583.1|1140095_1140563_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014470582.1|1140559_1140790_+	hypothetical protein	NA	J9PL10	Bacillus_phage	44.2	2.3e-11
WP_014470581.1|1140786_1141188_+	hypothetical protein	NA	A0A0S2MUR2	Bacillus_phage	45.2	4.5e-26
WP_014470580.1|1141201_1141459_+	hypothetical protein	NA	F8WQ54	Bacillus_phage	41.2	3.9e-07
WP_014470579.1|1141462_1142302_+	phosphoadenosine phosphosulfate reductase family protein	NA	A0A0S2SXP3	Bacillus_phage	57.2	7.8e-89
WP_014470578.1|1142383_1142797_+	hypothetical protein	NA	O64129	Bacillus_phage	86.8	5.0e-65
WP_076983676.1|1142793_1143057_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014470577.1|1143007_1143358_-	Ig-like domain-containing protein	NA	NA	NA	NA	NA
WP_014472595.1|1143492_1143927_+	hypothetical protein	NA	A0A2H4J8A0	uncultured_Caudovirales_phage	72.1	2.8e-50
WP_014472594.1|1144239_1144962_+	adenylate/guanylate cyclase domain-containing protein	NA	NA	NA	NA	NA
WP_014470573.1|1144971_1145610_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014470572.1|1145815_1146106_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014470570.1|1146450_1146657_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014470569.1|1146656_1147118_+	hypothetical protein	NA	A0A2H4J4R7	uncultured_Caudovirales_phage	51.2	4.4e-25
WP_014470568.1|1147264_1147894_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014470567.1|1148022_1148334_+	hypothetical protein	NA	Q9T202	Bacillus_phage	54.6	2.1e-23
WP_014470566.1|1148511_1149267_+	hypothetical protein	NA	A0A2P1JTW4	Anoxybacillus_phage	57.2	7.1e-57
WP_014470565.1|1149253_1150459_+|terminase	PBSX family phage terminase large subunit	terminase	A0A2H4J8B0	uncultured_Caudovirales_phage	84.0	1.2e-202
WP_014470564.1|1150462_1151896_+|portal	phage portal protein	portal	A0A2H4J4Q7	uncultured_Caudovirales_phage	58.9	4.2e-151
WP_014470563.1|1151846_1152026_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014470562.1|1152163_1152883_+	DUF4355 domain-containing protein	NA	A0A1L2K2N1	Aeribacillus_phage	50.6	2.5e-51
WP_014470561.1|1152897_1153758_+	hypothetical protein	NA	A0A1L2JY55	Aeribacillus_phage	77.1	4.5e-124
WP_014470560.1|1153771_1153975_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014470559.1|1153986_1154856_+	hypothetical protein	NA	A0A2H4JD21	uncultured_Caudovirales_phage	43.0	3.9e-51
WP_014470558.1|1154870_1155206_+|head,tail	phage head-tail connector protein	head,tail	A0A2H4J6J9	uncultured_Caudovirales_phage	56.8	1.2e-29
WP_014470557.1|1155210_1155714_+	hypothetical protein	NA	A0A2H4J4S5	uncultured_Caudovirales_phage	58.9	6.2e-49
WP_014470556.1|1155713_1156103_+	hypothetical protein	NA	A0A2H4JDP3	uncultured_Caudovirales_phage	58.8	9.3e-29
WP_014470555.1|1156059_1156530_+	hypothetical protein	NA	A0A2H4J4R9	uncultured_Caudovirales_phage	57.0	4.4e-49
WP_014470554.1|1156534_1157569_+	DUF3383 family protein	NA	A0A2H4J8B9	uncultured_Caudovirales_phage	63.6	7.0e-124
WP_014470553.1|1157585_1157981_+	hypothetical protein	NA	A0A2H4J4R5	uncultured_Caudovirales_phage	64.3	2.3e-38
WP_014470552.1|1158081_1158381_+	hypothetical protein	NA	A0A2D1GQ87	Lysinibacillus_phage	41.7	1.7e-06
WP_014470551.1|1158539_1163195_+	transglycosylase SLT domain-containing protein	NA	A0A2H4JA91	uncultured_Caudovirales_phage	49.7	5.2e-118
WP_014470550.1|1163195_1163753_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A2H4JD33	uncultured_Caudovirales_phage	67.0	2.4e-62
WP_014470549.1|1163767_1164127_+	hypothetical protein	NA	A0A2H4J6L1	uncultured_Caudovirales_phage	72.9	1.1e-44
WP_014470548.1|1164110_1165079_+	hypothetical protein	NA	A0A2H4J4T4	uncultured_Caudovirales_phage	58.9	7.6e-104
WP_014472588.1|1165078_1165426_+	hypothetical protein	NA	A0A2H4JDQ2	uncultured_Caudovirales_phage	58.3	2.9e-29
WP_014470546.1|1165422_1165779_+	DUF2634 domain-containing protein	NA	A0A2H4J4S8	uncultured_Caudovirales_phage	60.2	5.7e-33
WP_014470545.1|1165771_1166947_+|plate	baseplate J/gp47 family protein	plate	A0A2H4J8D2	uncultured_Caudovirales_phage	71.9	1.1e-152
WP_014470544.1|1166943_1167573_+	hypothetical protein	NA	A0A2H4J4S3	uncultured_Caudovirales_phage	82.8	1.4e-90
WP_014470543.1|1167587_1168808_+	hypothetical protein	NA	A0A1P8CWR7	Bacillus_phage	41.3	6.1e-50
WP_014470542.1|1168826_1169291_+	hypothetical protein	NA	O64053	Bacillus_phage	34.9	6.6e-05
WP_014470541.1|1169280_1169475_+	XkdX family protein	NA	A0A2H4JAA1	uncultured_Caudovirales_phage	64.5	8.2e-18
WP_013351240.1|1169538_1169817_+	hemolysin XhlA family protein	NA	A0A2H4JD40	uncultured_Caudovirales_phage	71.7	1.1e-28
WP_014470539.1|1169832_1170096_+|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	69.0	2.0e-27
WP_014470538.1|1170150_1171308_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1P8CWN6	Bacillus_phage	64.1	4.7e-68
WP_014470537.1|1171348_1171726_-	DUF3139 domain-containing protein	NA	NA	NA	NA	NA
WP_014470536.1|1171741_1172617_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470535.1|1173086_1173317_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_014470534.1|1173482_1173923_-	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_014472584.1|1173935_1175756_-	HNH endonuclease	NA	A0A1P8CWI7	Bacillus_phage	43.2	3.9e-109
WP_014470531.1|1176509_1177058_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038462744.1|1177074_1177797_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014470529.1|1177815_1178853_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013351872.1|1179438_1179774_-	hypothetical protein	NA	NA	NA	NA	NA
1178952:1178969	attR	TGGGGACGAATTGGGGAC	NA	NA	NA	NA
WP_014471698.1|1179795_1180149_-	EndoU domain-containing protein	NA	A0A0A7RVN1	Clostridium_phage	50.4	2.4e-23
WP_014471699.1|1180315_1180498_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470527.1|1180757_1181012_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014470526.1|1181061_1181619_+	SMI1/KNR4 family protein	NA	O64022	Bacillus_phage	82.2	1.4e-89
WP_014470525.1|1181691_1182636_+	ketopantoate reductase family protein	NA	NA	NA	NA	NA
WP_014470524.1|1182945_1183167_+	SMI1/KNR4 family protein	NA	A0A1P8CWM6	Bacillus_phage	69.4	1.6e-25
WP_013351877.1|1183291_1183753_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_013351878.1|1183956_1184292_+	hypothetical protein	NA	A0A1P8CWM9	Bacillus_phage	56.8	3.2e-25
WP_127721184.1|1184575_1184656_-|holin	putative holin-like toxin	holin	NA	NA	NA	NA
>prophage 4
NZ_CP009748	Bacillus subtilis strain ATCC 13952, complete genome	3876276	1227176	1262661	3876276	holin,plate,portal,tail,terminase,capsid	Bacillus_phage(30.3%)	46	NA	NA
WP_014470508.1|1227176_1228529_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	24.9	1.0e-13
WP_014470507.1|1228955_1229147_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013351927.1|1229314_1230079_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_013351928.1|1230222_1230690_-	DinB family protein	NA	NA	NA	NA	NA
WP_088030497.1|1230894_1232031_+	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	47.9	2.2e-94
WP_003154881.1|1232020_1232155_+	PhrA family phosphatase inhibitor	NA	NA	NA	NA	NA
WP_013351930.1|1232298_1233252_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A218KC88	Bacillus_phage	69.9	9.9e-64
WP_013351931.1|1233289_1233667_-	PH domain-containing protein	NA	A5GYQ0	Lactococcus_phage	37.6	3.3e-15
WP_013351932.1|1233776_1234379_+	poly-gamma-glutamate hydrolase family protein	NA	A0A0Y0AJU6	Bacillus_phage	46.3	3.7e-40
WP_013351933.1|1234521_1235112_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4JA43	uncultured_Caudovirales_phage	52.3	1.8e-39
WP_013351934.1|1235259_1235598_-	helix-turn-helix transcriptional regulator	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	49.2	9.9e-19
WP_013351935.1|1235788_1235968_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014470504.1|1235957_1236785_+	hypothetical protein	NA	S6BFM4	Thermus_phage	28.5	4.2e-18
WP_038462769.1|1236684_1237485_+	ATP-binding protein	NA	A6XMI1	Bacillus_virus	44.7	1.4e-58
WP_013351938.1|1237749_1238091_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013351939.1|1238080_1238284_+	XtrA/YqaO family protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	48.5	9.2e-12
WP_013351940.1|1238396_1238906_+	sigma-70 family RNA polymerase sigma factor	NA	A0A0K2CNQ1	Brevibacillus_phage	43.3	3.2e-21
WP_014470502.1|1239020_1239815_+|terminase	terminase small subunit	terminase	A0A0S2MVB6	Bacillus_phage	49.4	1.2e-59
WP_013351942.1|1239811_1241110_+|terminase	PBSX family phage terminase large subunit	terminase	M4ZRM5	Bacillus_phage	59.7	2.3e-148
WP_044051899.1|1241158_1242550_+|portal	phage portal protein	portal	A0A1B1P7C8	Bacillus_phage	55.8	1.0e-138
WP_013351944.1|1242569_1243412_+|portal	phage portal protein	portal	A0A1B1P7E4	Bacillus_phage	57.6	5.7e-55
WP_013351945.1|1243438_1244374_+|capsid	phage major capsid protein	capsid	A0A1B1P7E3	Bacillus_phage	62.8	3.3e-104
WP_014470501.1|1244390_1244774_+	DUF3199 family protein	NA	NA	NA	NA	NA
WP_013351946.1|1244770_1245127_+	DUF3599 family protein	NA	NA	NA	NA	NA
WP_013351947.1|1245123_1245627_+	HK97 gp10 family phage protein	NA	A0A249XXA4	Clostridium_phage	41.7	9.2e-37
WP_013351948.1|1245623_1246070_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013351949.1|1246066_1246276_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013351950.1|1246275_1247673_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A0A0A7RTT5	Clostridium_phage	40.9	3.4e-81
WP_003154837.1|1247674_1248118_+|tail	phage tail tube protein	tail	A0A0K2CNG3	Brevibacillus_phage	45.2	8.4e-26
WP_003154836.1|1248192_1248639_+|portal	phage portal protein	portal	A0A0A7RTY8	Clostridium_phage	35.8	1.0e-10
WP_015239684.1|1248680_1248833_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038462773.1|1248820_1253701_+	transglycosylase SLT domain-containing protein	NA	A0A1L2JY60	Aeribacillus_phage	47.0	8.4e-42
WP_013351953.1|1253693_1254353_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A090DBR9	Clostridium_phage	33.5	4.5e-23
WP_013351954.1|1254366_1255344_+	hypothetical protein	NA	A0A1L6BY20	Clostridium_phage	29.8	3.7e-34
WP_013351955.1|1255343_1255610_+	DUF2577 family protein	NA	S6C459	Thermus_phage	37.5	2.6e-06
WP_014470499.1|1255759_1256185_+	DUF2634 domain-containing protein	NA	A0A2H4J6K5	uncultured_Caudovirales_phage	35.2	3.3e-11
WP_014471720.1|1256177_1257224_+|plate	baseplate J/gp47 family protein	plate	S6AVU3	Thermus_phage	43.8	2.3e-69
WP_014470497.1|1257207_1257786_+	YmfQ family protein	NA	A0A0A7RTT8	Clostridium_phage	30.3	1.8e-12
WP_013351959.1|1257782_1258055_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014470496.1|1258057_1259821_+	hypothetical protein	NA	A0A2H4J4R1	uncultured_Caudovirales_phage	50.0	6.6e-13
WP_014470495.1|1259832_1260159_+	XkdW family protein	NA	A0A2H4JCI0	uncultured_Caudovirales_phage	39.8	1.2e-13
WP_014470494.1|1260158_1260323_+	XkdX family protein	NA	A0A2H4JAA1	uncultured_Caudovirales_phage	60.4	1.0e-13
WP_014470493.1|1260377_1261175_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013351964.1|1261228_1261492_+	hemolysin XhlA family protein	NA	A0A2H4JD40	uncultured_Caudovirales_phage	64.3	4.0e-23
WP_014470492.1|1261505_1261769_+|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	65.5	6.7e-23
WP_014470491.1|1261782_1262661_+	N-acetylmuramoyl-L-alanine amidase	NA	Q9ZXD7	Bacillus_phage	60.9	2.2e-81
>prophage 5
NZ_CP009748	Bacillus subtilis strain ATCC 13952, complete genome	3876276	1804289	1814638	3876276		Bacillus_phage(71.43%)	12	NA	NA
WP_013352403.1|1804289_1804910_+	lytic polysaccharide monooxygenase	NA	A0A0K1Y848	Apis_mellifera_filamentous_virus	35.5	9.7e-20
WP_016935991.1|1805071_1805161_-	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_013352404.1|1805577_1806114_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470354.1|1806763_1809181_-	peptidase G2	NA	D6R401	Bacillus_phage	50.1	5.0e-221
WP_013352407.1|1809468_1809708_+	TM2 domain-containing protein	NA	M4ZS56	Bacillus_phage	63.0	4.5e-18
WP_013352408.1|1809878_1810313_+	dUTP diphosphatase	NA	A0A1P8CX51	Bacillus_phage	87.3	4.6e-69
WP_013352409.1|1810322_1810508_-	DUF4177 domain-containing protein	NA	NA	NA	NA	NA
WP_013352410.1|1810713_1811535_+	poly-gamma-glutamate hydrolase family protein	NA	O64134	Bacillus_phage	42.6	5.3e-50
WP_013352412.1|1811777_1812608_+	prohibitin family protein	NA	A0A172JI70	Bacillus_phage	72.3	8.5e-104
WP_013352413.1|1812635_1813085_-	YndM family protein	NA	NA	NA	NA	NA
WP_013352414.1|1813240_1813669_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007611720.1|1814017_1814638_-	repressor LexA	NA	A0A1B2APZ1	Phage_Wrath	62.3	8.5e-16
>prophage 6
NZ_CP009748	Bacillus subtilis strain ATCC 13952, complete genome	3876276	2062887	2090555	3876276	tRNA	Bacillus_phage(90.62%)	41	NA	NA
WP_014470255.1|2062887_2063442_-	Holliday junction resolvase RecU	NA	O64195	Bacillus_phage	92.7	1.1e-91
WP_014470254.1|2063539_2063779_+	helix-turn-helix transcriptional regulator	NA	A0A1P8CX60	Bacillus_phage	65.8	6.5e-25
WP_014470252.1|2064009_2064363_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470251.1|2064362_2064722_-	hypothetical protein	NA	R4JGJ3	Bacillus_phage	46.3	1.9e-20
WP_014470250.1|2064718_2065102_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470249.1|2065113_2065440_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470248.1|2065538_2066057_-	dihydrofolate reductase	NA	A0A0H3UYW4	Geobacillus_virus	40.6	7.1e-32
WP_014470247.1|2066056_2066896_-	thymidylate synthase	NA	A0A1P8CX42	Bacillus_phage	89.6	9.4e-151
WP_080292729.1|2066910_2067321_-	hypothetical protein	NA	A0A1P8CX52	Bacillus_phage	60.0	5.8e-37
WP_014470245.1|2067367_2067667_-	hypothetical protein	NA	A0A1P8CX63	Bacillus_phage	57.0	3.2e-21
WP_014470244.1|2067659_2067932_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470242.1|2068559_2068988_-	dUTP diphosphatase	NA	A0A1P8CX51	Bacillus_phage	90.1	2.0e-72
WP_014470241.1|2069036_2069393_-|tRNA	peptidyl-tRNA hydrolase	tRNA	A0A1V0SFB5	Hokovirus	29.8	9.8e-09
WP_014470238.1|2069863_2070583_-	hypothetical protein	NA	A0A2I6UHL5	Bacillus_phage	44.7	5.2e-49
WP_014470236.1|2071141_2071663_-	HNH endonuclease	NA	A0A1P8CX39	Bacillus_phage	88.4	4.0e-83
WP_104843608.1|2074495_2075173_-	ribonucleotide-diphosphate reductase subunit alpha	NA	A0A1P8CX40	Bacillus_phage	96.0	1.4e-120
WP_014470230.1|2075180_2075576_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A1P8CX56	Bacillus_phage	94.7	1.5e-63
WP_014470229.1|2075572_2075929_-	hypothetical protein	NA	O64171	Bacillus_phage	96.6	2.3e-58
WP_014470228.1|2075980_2076313_-	hypothetical protein	NA	O64168	Bacillus_phage	86.0	5.5e-14
WP_014470227.1|2076326_2076539_-	DUF1653 domain-containing protein	NA	A0A1P8CX21	Bacillus_phage	81.4	2.3e-29
WP_014470226.1|2076545_2076923_-	hypothetical protein	NA	A0A172JI43	Bacillus_phage	47.4	4.2e-18
WP_014470225.1|2076956_2077250_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470224.1|2077291_2077597_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470223.1|2077641_2077989_-	hypothetical protein	NA	O64164	Bacillus_phage	89.5	4.5e-51
WP_014470222.1|2078002_2078410_-	hypothetical protein	NA	A0A1P8CX27	Bacillus_phage	74.0	1.3e-49
WP_014470221.1|2078422_2078743_-	hypothetical protein	NA	A0A1P8CX20	Bacillus_phage	79.2	8.4e-44
WP_014470219.1|2078896_2079370_-	hypothetical protein	NA	O64162	Bacillus_phage	67.3	2.1e-59
WP_014470218.1|2079487_2079667_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470217.1|2079696_2079921_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038462847.1|2079963_2080161_-	hypothetical protein	NA	O64159	Bacillus_phage	64.6	2.6e-19
WP_014470215.1|2080425_2080653_-	hypothetical protein	NA	A0A1P8CX31	Bacillus_phage	69.3	1.2e-23
WP_014470214.1|2080690_2080909_-	hypothetical protein	NA	O64155	Bacillus_phage	61.4	1.1e-15
WP_144653880.1|2080955_2082449_-	DNA (cytosine-5-)-methyltransferase	NA	Q02778	Bacillus_phage	99.2	1.8e-266
WP_014470212.1|2082534_2082777_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470211.1|2082797_2083316_-	5'-3'-deoxyribonucleotidase	NA	A0A1P8CX15	Bacillus_phage	87.2	4.5e-87
WP_014470210.1|2083324_2083822_-	AAA family ATPase	NA	A0A1P8CX28	Bacillus_phage	81.2	8.7e-72
WP_014470208.1|2083981_2084185_-	YorP family protein	NA	O64150	Bacillus_phage	82.1	3.5e-27
WP_014470205.1|2084727_2085474_-	3D domain-containing protein	NA	O64147	Bacillus_phage	53.0	1.6e-53
WP_014470204.1|2085481_2087773_-	DNA polymerase I	NA	A0A0K0N6N8	Gordonia_phage	28.0	7.8e-06
WP_014470203.1|2087790_2089479_-	DHH family phosphoesterase	NA	A0A1P8CX07	Bacillus_phage	43.3	3.3e-123
WP_014470202.1|2089490_2090555_-	hypothetical protein	NA	A0A218KBY7	Bacillus_phage	38.9	6.5e-64
>prophage 7
NZ_CP009748	Bacillus subtilis strain ATCC 13952, complete genome	3876276	2093954	2121187	3876276	integrase	Bacillus_phage(83.78%)	48	2085829:2085842	2117161:2117174
2085829:2085842	attL	TCTTTTGTACTTTA	NA	NA	NA	NA
WP_014470199.1|2093954_2095292_-	hypothetical protein	NA	A0A0K2FMB7	Brevibacillus_phage	28.5	7.7e-06
WP_014470198.1|2095324_2095681_-	hypothetical protein	NA	O64139	Bacillus_phage	76.1	2.0e-41
WP_014470197.1|2095831_2096209_-	hypothetical protein	NA	A0A1P8CX06	Bacillus_phage	76.2	4.5e-52
WP_014470196.1|2096230_2096947_-	serine/threonine protein phosphatase	NA	M4H0M1	Listeria_phage	38.3	9.7e-40
WP_014470195.1|2096985_2098728_-	right-handed parallel beta-helix repeat-containing protein	NA	O64135	Bacillus_phage	64.5	1.0e-220
WP_014470194.1|2098724_2099546_-	poly-gamma-glutamate hydrolase family protein	NA	O64134	Bacillus_phage	61.0	1.3e-85
WP_014470193.1|2099656_2099875_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470192.1|2099949_2100222_-	hypothetical protein	NA	A0A1P8CWZ5	Bacillus_phage	80.0	2.1e-35
WP_014470191.1|2100211_2101099_-	hypothetical protein	NA	A0A1P8CWZ3	Bacillus_phage	93.9	3.6e-161
WP_014470190.1|2101147_2101627_-	hypothetical protein	NA	A0A191ZDH8	Pseudoalteromonas_virus	35.4	4.0e-13
WP_014471975.1|2101642_2101894_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470188.1|2101919_2102165_-	hypothetical protein	NA	O64132	Bacillus_phage	84.1	2.5e-27
WP_014470187.1|2102235_2102910_+	SOS response-associated peptidase	NA	A0A1P8CX02	Bacillus_phage	96.5	1.4e-77
WP_014470186.1|2102979_2103792_+	ATP-dependent DNA ligase	NA	O64130	Bacillus_phage	88.1	4.2e-140
WP_014470184.1|2104009_2104207_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470183.1|2104512_2104758_-	hypothetical protein	NA	A0A1P8CX04	Bacillus_phage	91.5	6.7e-33
WP_014470181.1|2105057_2105420_-	hypothetical protein	NA	A0A0S2MUT8	Bacillus_phage	49.0	4.4e-33
WP_014470180.1|2105459_2105711_-	hypothetical protein	NA	A0A1S5SBT9	Streptococcus_phage	56.5	1.6e-18
WP_014470178.1|2106075_2106450_+	hypothetical protein	NA	A0A1P8CWZ2	Bacillus_phage	63.4	1.7e-35
WP_096034861.1|2106463_2106685_-	hypothetical protein	NA	O64123	Bacillus_phage	93.0	3.7e-30
WP_014470176.1|2106807_2107647_-	site-specific DNA-methyltransferase	NA	A0A2H4IZ65	uncultured_Caudovirales_phage	59.1	1.6e-78
WP_014470175.1|2107685_2108078_-	hypothetical protein	NA	A0A0A8WEI8	Clostridium_phage	46.9	6.3e-25
WP_014470174.1|2108110_2108305_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470173.1|2108328_2108565_-	hypothetical protein	NA	O64116	Bacillus_phage	82.1	2.2e-33
WP_014470172.1|2108585_2108771_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470171.1|2108804_2109602_-	hypothetical protein	NA	A0A0S2SXZ1	Bacillus_phage	54.2	1.6e-70
WP_014470170.1|2109670_2110006_-	hypothetical protein	NA	O64111	Bacillus_phage	76.6	2.2e-42
WP_014470169.1|2110002_2110212_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470168.1|2110211_2110589_-	hypothetical protein	NA	R4JKA5	Bacillus_phage	38.8	1.9e-18
WP_038463252.1|2110585_2110786_-	hypothetical protein	NA	M4ZRU5	Bacillus_phage	84.4	2.5e-25
WP_014470166.1|2110914_2111163_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470165.1|2111149_2111329_-	hypothetical protein	NA	O64105	Bacillus_phage	59.3	1.1e-08
WP_014472526.1|2111447_2111645_-	hypothetical protein	NA	O64104	Bacillus_phage	61.5	6.0e-16
WP_014470163.1|2111723_2111939_-	YopT family protein	NA	O64103	Bacillus_phage	64.3	2.8e-19
WP_014470161.1|2112570_2113548_-	hypothetical protein	NA	O64101	Bacillus_phage	74.5	7.6e-136
WP_014470160.1|2113568_2114960_-	hypothetical protein	NA	O64100	Bacillus_phage	74.6	9.6e-201
WP_014470159.1|2115046_2116129_-|integrase	tyrosine-type recombinase/integrase	integrase	O64099	Bacillus_phage	63.3	1.1e-124
WP_014470158.1|2116112_2116346_-	helix-turn-helix transcriptional regulator	NA	O64098	Bacillus_phage	60.0	8.9e-11
WP_038462857.1|2116390_2116729_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470156.1|2116734_2116935_-	hypothetical protein	NA	O64096	Bacillus_phage	61.5	1.9e-14
WP_014470155.1|2117261_2117390_-	lysogeny pheromone AimP family peptide	NA	NA	NA	NA	NA
2117161:2117174	attR	TAAAGTACAAAAGA	NA	NA	NA	NA
WP_014470154.1|2117416_2118577_-	hypothetical protein	NA	A0A288WGA2	Bacillus_phage	23.2	1.6e-07
WP_014470151.1|2119003_2119666_-	UPF0489 family protein	NA	NA	NA	NA	NA
WP_014470150.1|2119684_2120221_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470148.1|2120321_2120453_-	hypothetical protein	NA	A0A1P8CWV9	Bacillus_phage	90.7	2.7e-17
WP_014470147.1|2120464_2120680_-	hypothetical protein	NA	O64089	Bacillus_phage	52.1	8.8e-13
WP_014470146.1|2120682_2120934_-	hypothetical protein	NA	A0A1P8CWV6	Bacillus_phage	63.4	7.1e-22
WP_014417903.1|2121004_2121187_+	hypothetical protein	NA	A0A1P8CWV7	Bacillus_phage	87.9	1.7e-25
>prophage 8
NZ_CP009748	Bacillus subtilis strain ATCC 13952, complete genome	3876276	2129571	2151315	3876276		Bacillus_phage(87.5%)	21	NA	NA
WP_014470130.1|2129571_2130279_-	phage antirepressor KilAC domain-containing protein	NA	A0A1P8CWY0	Bacillus_phage	49.2	1.3e-52
WP_014470129.1|2130547_2132344_-	ATP-dependent helicase	NA	A0A1P8CWU5	Bacillus_phage	99.7	0.0e+00
WP_014472015.1|2132345_2132948_-	hypothetical protein	NA	A0A1P8CWV1	Bacillus_phage	100.0	3.9e-106
WP_014470127.1|2132949_2133867_-	hypothetical protein	NA	A0A1P8CWU6	Bacillus_phage	87.9	2.4e-139
WP_014470126.1|2133872_2134727_-	hypothetical protein	NA	A0A1P8CWT8	Bacillus_phage	85.6	5.3e-125
WP_014470125.1|2135042_2136260_-	hypothetical protein	NA	A0A1P8CWT6	Bacillus_phage	83.7	6.4e-201
WP_003230987.1|2136341_2136530_-	hypothetical protein	NA	O64081	Bacillus_phage	96.8	9.7e-24
WP_076983670.1|2136574_2136790_-	hypothetical protein	NA	A0A1P8CWU4	Bacillus_phage	95.8	1.6e-30
WP_014470124.1|2136843_2137020_-	hypothetical protein	NA	O64080	Bacillus_phage	92.1	1.3e-09
WP_014470123.1|2137982_2139095_-	cell division protein FtsZ	NA	NA	NA	NA	NA
WP_014470122.1|2139094_2139394_-	hypothetical protein	NA	NA	NA	NA	NA
WP_102421742.1|2139548_2139827_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_014470120.1|2139901_2140081_+	hypothetical protein	NA	O64077	Bacillus_phage	58.9	1.5e-10
WP_014470119.1|2140121_2142638_+	hypothetical protein	NA	O64076	Bacillus_phage	83.1	0.0e+00
WP_014470118.1|2142895_2143171_+	HU family DNA-binding protein	NA	A0A1P8CWT5	Bacillus_phage	95.6	7.0e-39
WP_014470117.1|2144325_2144526_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014470116.1|2144794_2145004_+	YonK family protein	NA	NA	NA	NA	NA
WP_014470115.1|2145015_2146233_+	hypothetical protein	NA	O64073	Bacillus_phage	97.3	9.8e-226
WP_014470112.1|2146633_2147134_+	hypothetical protein	NA	A0A1P8CWS3	Bacillus_phage	32.5	1.1e-18
WP_014470111.1|2147242_2148250_+	hypothetical protein	NA	Q331V7	Clostridium_botulinum_C_phage	24.5	9.6e-09
WP_014470110.1|2148249_2151315_+	heavy metal transporter	NA	A0A0K2FLD6	Brevibacillus_phage	30.0	8.1e-51
>prophage 9
NZ_CP009748	Bacillus subtilis strain ATCC 13952, complete genome	3876276	2156619	2168297	3876276	integrase	Bacillus_phage(83.33%)	19	2150034:2150049	2177416:2177431
2150034:2150049	attL	CTTTTCAAAAGACAGT	NA	NA	NA	NA
WP_014470103.1|2156619_2157285_+	hypothetical protein	NA	A0A1P8CWR8	Bacillus_phage	51.1	1.6e-49
WP_014470102.1|2157281_2157788_+	hypothetical protein	NA	O64060	Bacillus_phage	66.7	1.7e-62
WP_014470101.1|2157784_2158510_+	hypothetical protein	NA	A0A1P8CWQ7	Bacillus_phage	31.8	4.7e-26
WP_038462869.1|2158548_2159346_+	hypothetical protein	NA	A0A1P8CWR0	Bacillus_phage	36.2	1.5e-17
WP_014470099.1|2159366_2159834_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014470098.1|2159905_2160262_+	hypothetical protein	NA	O64055	Bacillus_phage	78.8	2.4e-47
WP_014470097.1|2160261_2161593_+	hypothetical protein	NA	A0A1P8CWR7	Bacillus_phage	42.6	1.3e-21
WP_014470096.1|2161606_2161882_+	hypothetical protein	NA	M4ZR44	Bacillus_phage	36.2	1.2e-09
WP_014470095.1|2161882_2162035_+	XkdX family protein	NA	NA	NA	NA	NA
WP_014470094.1|2162053_2162902_+	glycerophosphoryl diester phosphodiesterase	NA	NA	NA	NA	NA
WP_014470093.1|2162990_2163476_+	hypothetical protein	NA	A0A1P8CWQ6	Bacillus_phage	73.5	2.2e-59
WP_014470092.1|2163475_2163892_+	hypothetical protein	NA	A0A1P8CWQ4	Bacillus_phage	65.5	5.3e-46
WP_014470091.1|2163905_2164907_+|integrase	site-specific integrase	integrase	A0A1P8CWP6	Bacillus_phage	87.0	5.7e-171
WP_014472516.1|2164951_2165167_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014470089.1|2165334_2165835_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014470088.1|2165831_2166884_+	serine/threonine protein kinase	NA	G9L673	Escherichia_phage	40.9	2.3e-61
WP_014470087.1|2166912_2167095_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014470086.1|2167188_2167599_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014470085.1|2167670_2168297_+	hypothetical protein	NA	A0A0H3UZD5	Geobacillus_virus	32.8	1.9e-23
2177416:2177431	attR	ACTGTCTTTTGAAAAG	NA	NA	NA	NA
>prophage 10
NZ_CP009748	Bacillus subtilis strain ATCC 13952, complete genome	3876276	2182945	2195734	3876276	holin	Bacillus_phage(100.0%)	13	NA	NA
WP_014470079.1|2182945_2183992_+	N-acetylmuramoyl-L-alanine amidase family protein	NA	A0A1J0MS59	Bacillus_phage	52.0	5.7e-81
WP_014472511.1|2184099_2184471_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014470077.1|2184483_2184735_+|holin	phage holin	holin	A0A1P8CWN5	Bacillus_phage	85.5	6.9e-33
WP_014472510.1|2185090_2185351_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014470073.1|2186828_2188079_-	UV-damage repair protein uvrX	NA	O64031	Bacillus_phage	91.8	1.0e-222
WP_014470072.1|2188071_2188404_-	YolD-like family protein	NA	A0A1P8CWP2	Bacillus_phage	73.6	5.3e-41
WP_014470071.1|2189521_2189725_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009967548.1|2189953_2190070_+	type I toxin-antitoxin system toxin BsrG	NA	Q96209	Bacillus_phage	100.0	9.8e-11
WP_014470070.1|2190377_2190836_-	SMI1/KNR4 family protein	NA	A0A1P8CWJ1	Bacillus_phage	84.2	5.2e-71
WP_014470069.1|2190848_2192735_-	HNH endonuclease	NA	A0A1P8CWI7	Bacillus_phage	55.0	5.6e-111
WP_014470068.1|2193241_2194012_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076982859.1|2194055_2194490_-	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_014470066.1|2194753_2195734_+	thermonuclease family protein	NA	A0A1P8CWK6	Bacillus_phage	75.9	8.5e-79
>prophage 11
NZ_CP009748	Bacillus subtilis strain ATCC 13952, complete genome	3876276	2298414	2304667	3876276		Staphylococcus_phage(66.67%)	10	NA	NA
WP_013352726.1|2298414_2299008_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	36.6	2.0e-14
WP_013352727.1|2298997_2299753_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	25.3	1.9e-09
WP_076983148.1|2299960_2300050_+	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_038462893.1|2300137_2300659_+	DUF309 domain-containing protein	NA	NA	NA	NA	NA
WP_014470034.1|2300603_2300819_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013352729.1|2300724_2301099_-	GNAT family N-acetyltransferase RibT	NA	NA	NA	NA	NA
WP_013352730.1|2301215_2301680_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	60.0	7.2e-44
WP_013352731.1|2301712_2302909_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	54.7	2.1e-116
WP_014470033.1|2302923_2303571_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	44.3	2.0e-39
WP_013352733.1|2303551_2304667_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	35.7	2.2e-54
>prophage 12
NZ_CP009748	Bacillus subtilis strain ATCC 13952, complete genome	3876276	2584763	2644209	3876276	coat,protease,tRNA	uncultured_Mediterranean_phage(25.0%)	59	NA	NA
WP_013353029.1|2584763_2585207_-|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_014472139.1|2585219_2587424_-	GTP diphosphokinase	NA	A0A2I2L310	Orpheovirus	34.8	1.5e-09
WP_013353031.1|2587582_2588095_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	47.2	7.2e-29
WP_013353032.1|2588100_2590458_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	34.6	2.8e-91
WP_013353033.1|2590513_2590840_-	DUF1049 domain-containing protein	NA	NA	NA	NA	NA
WP_013353034.1|2590903_2591401_-	cation:proton antiporter regulatory subunit	NA	NA	NA	NA	NA
WP_013353035.1|2591531_2593751_-	protein translocase subunit SecDF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	32.9	3.5e-27
WP_013353036.1|2593787_2594084_-	post-transcriptional regulator	NA	NA	NA	NA	NA
WP_013353037.1|2594198_2595755_+	stage V sporulation protein B	NA	NA	NA	NA	NA
WP_013353038.1|2595762_2596419_-	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_013353039.1|2596585_2596972_+	TIGR04086 family membrane protein	NA	NA	NA	NA	NA
WP_003152695.1|2597024_2597285_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	46.9	1.5e-06
WP_014472142.1|2597316_2598462_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	44.8	3.7e-89
WP_013353041.1|2598489_2599518_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_013353042.1|2599543_2599744_-	DUF2905 domain-containing protein	NA	NA	NA	NA	NA
WP_013353043.1|2599736_2600741_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	30.0	5.2e-07
WP_003152683.1|2600751_2601357_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_038463270.1|2601491_2601968_-	BofC C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_014470776.1|2602377_2602971_-	YhcN/YlaJ family sporulation lipoprotein	NA	NA	NA	NA	NA
WP_014470777.1|2603119_2604271_-|coat	spore coat assembly protein SafA	coat	NA	NA	NA	NA
WP_014470778.1|2604397_2605501_-	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_014470779.1|2605500_2606349_-	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
WP_014470780.1|2606330_2607896_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_013353051.1|2608001_2609153_+	IscS subfamily cysteine desulfurase	NA	A0A1X7C038	Faustovirus	27.5	5.1e-30
WP_013353052.1|2609149_2609692_+	transcription repressor NadR	NA	NA	NA	NA	NA
WP_013353053.1|2609718_2610576_-	prephenate dehydratase	NA	NA	NA	NA	NA
WP_007408173.1|2610591_2611035_-	transcriptional regulator ThrR	NA	NA	NA	NA	NA
WP_013353054.1|2611088_2612375_-	GTPase ObgE	NA	NA	NA	NA	NA
WP_013353055.1|2612406_2612985_-	Spo0B domain-containing protein	NA	NA	NA	NA	NA
WP_003152662.1|2613301_2613586_-	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_038462961.1|2613598_2613940_-|protease	ribosomal-processing cysteine protease Prp	protease	NA	NA	NA	NA
WP_003152660.1|2613942_2614251_-	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_013353057.1|2614396_2615263_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_013353058.1|2615255_2616059_-	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_003152655.1|2616187_2616991_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_013353059.1|2616993_2617674_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_014470782.1|2617727_2618246_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_013353061.1|2618242_2619106_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_013353062.1|2619136_2620150_-	rod shape-determining protein MreB	NA	NA	NA	NA	NA
WP_013353063.1|2620241_2620937_-	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_013353064.1|2620968_2621538_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_013353065.1|2621679_2622681_-	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_013353066.1|2622807_2623560_-	prepilin peptidase	NA	NA	NA	NA	NA
WP_013353067.1|2623699_2624992_-	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_013353068.1|2625050_2627693_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	42.3	3.7e-161
WP_013353069.1|2628143_2628335_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013353070.1|2628349_2629372_-|coat	spore coat protein YsxE	coat	NA	NA	NA	NA
WP_013353071.1|2629405_2630929_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_013353072.1|2631061_2632351_-	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_088613212.1|2632379_2633354_-	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_013353074.1|2633356_2634139_-	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_013353075.1|2634128_2635070_-	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_007408154.1|2635104_2635935_-	cytochrome c biogenesis protein CcsA	NA	NA	NA	NA	NA
WP_013353076.1|2635942_2637310_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_013353077.1|2637506_2637998_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013353078.1|2638030_2638618_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_013353079.1|2638614_2640939_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	43.9	8.8e-183
WP_013353080.1|2641137_2642796_-|protease	ATP-dependent protease LonB	protease	A0A167RA83	Powai_lake_megavirus	32.7	1.9e-14
WP_014470784.1|2642946_2644209_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	65.3	2.5e-147
>prophage 13
NZ_CP009748	Bacillus subtilis strain ATCC 13952, complete genome	3876276	2868985	2944531	3876276	head,integrase,protease,plate,portal,tail,terminase,holin,capsid	Bacillus_phage(30.0%)	82	2906936:2906983	2944703:2944750
WP_014470850.1|2868985_2869390_-|holin	holin family protein	holin	NA	NA	NA	NA
WP_003152242.1|2869525_2869963_-	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	61.4	6.5e-47
WP_013353276.1|2870087_2870237_+	YtzI protein	NA	NA	NA	NA	NA
WP_013353277.1|2870233_2870677_-	FixH family protein	NA	NA	NA	NA	NA
WP_013353278.1|2870793_2871267_-	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
WP_013353279.1|2871392_2871620_+	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	64.9	1.2e-23
WP_013353280.1|2871616_2872186_-	carbonic anhydrase	NA	NA	NA	NA	NA
WP_003152229.1|2872312_2872561_-	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_014470851.1|2872757_2874089_+	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_013353282.1|2874111_2875152_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_014470852.1|2875209_2875368_+	DUF1540 domain-containing protein	NA	NA	NA	NA	NA
WP_013353285.1|2875540_2876656_-	o-succinylbenzoate synthase	NA	Q6A202	Oenococcus_phage	21.6	2.4e-13
WP_013353286.1|2876652_2878116_-	o-succinylbenzoate--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	35.2	2.4e-77
WP_013353287.1|2878203_2879022_-	1,4-dihydroxy-2-naphthoyl-CoA synthase	NA	NA	NA	NA	NA
WP_013353288.1|2879080_2879905_-	2-succinyl-6-hydroxy-2, 4-cyclohexadiene-1-carboxylate synthase	NA	NA	NA	NA	NA
WP_014470854.1|2879892_2881629_-	2-succinyl-5-enolpyruvyl-6-hydroxy-3- cyclohexene-1-carboxylic-acid synthase	NA	NA	NA	NA	NA
WP_013353290.1|2881625_2883038_-	isochorismate synthase MenF	NA	NA	NA	NA	NA
WP_013353291.1|2883321_2884041_+	TraR/DksA C4-type zinc finger protein	NA	NA	NA	NA	NA
WP_013353292.1|2884184_2884655_+	tryptophan-rich sensory protein	NA	NA	NA	NA	NA
WP_014470856.1|2892002_2892584_+	energy-coupled thiamine transporter ThiT	NA	NA	NA	NA	NA
WP_013353294.1|2892615_2894145_-	flotillin family protein	NA	A0A2I2L4B2	Orpheovirus	27.5	1.6e-07
WP_013353295.1|2894164_2894695_-	NfeD family protein	NA	NA	NA	NA	NA
WP_013353296.1|2894841_2895330_+	DinB family protein	NA	NA	NA	NA	NA
WP_013353297.1|2895331_2895913_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_013353298.1|2895983_2897192_-|holin	choline dehydrogenase	holin	NA	NA	NA	NA
WP_013353299.1|2897209_2898682_-	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_013353300.1|2898882_2899443_+	GbsR/MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014470857.1|2899609_2900149_+	DUF1016 domain-containing protein	NA	NA	NA	NA	NA
WP_013353302.1|2900312_2900981_+	TrkA family potassium uptake protein	NA	NA	NA	NA	NA
WP_013353303.1|2901004_2901850_-	glucosaminidase domain-containing protein	NA	A0A0K2CP65	Brevibacillus_phage	45.2	7.2e-26
WP_013353304.1|2901989_2903165_-	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_013353306.1|2904081_2904405_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013353308.1|2905097_2906228_-	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	40.8	4.7e-65
WP_014470862.1|2906615_2906819_+	hypothetical protein	NA	NA	NA	NA	NA
2906936:2906983	attL	GTATGGAGCCAAGGGGGCTCGAACCCCTGACCTCTACGCTGCCAGCGT	NA	NA	NA	NA
WP_144653877.1|2907356_2907548_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470865.1|2909081_2909315_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013353310.1|2909511_2909907_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013353311.1|2909896_2910310_-	hypothetical protein	NA	NA	NA	NA	NA
WP_127721122.1|2910492_2910720_+	helix-turn-helix domain-containing protein	NA	A0A2K5B263	Erysipelothrix_phage	40.3	1.7e-06
WP_014470867.1|2910842_2911145_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014470868.1|2911200_2911506_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013353313.1|2911520_2912936_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470869.1|2912986_2913352_+	DUF1433 domain-containing protein	NA	NA	NA	NA	NA
WP_014470870.1|2913382_2913625_-	helix-turn-helix domain-containing protein	NA	A0A2H4JDR0	uncultured_Caudovirales_phage	54.4	8.7e-17
WP_013353316.1|2914088_2914760_-	M15 family metallopeptidase	NA	F8WPX5	Bacillus_phage	72.5	1.7e-65
WP_013353317.1|2914801_2915209_-|holin	phage holin family protein	holin	D6R405	Bacillus_phage	67.2	1.6e-39
WP_013353318.1|2915246_2915420_-	XkdX family protein	NA	M4ZS22	Bacillus_phage	86.0	4.4e-15
WP_013353319.1|2915422_2915704_-	hypothetical protein	NA	O64053	Bacillus_phage	48.4	8.2e-19
WP_044051888.1|2915700_2916948_-|plate	BppU family phage baseplate upper protein	plate	D6R402	Bacillus_phage	54.5	1.3e-79
WP_013353321.1|2916991_2919580_-	peptidase G2	NA	D6R401	Bacillus_phage	52.0	1.3e-248
WP_013353322.1|2919594_2921475_-|tail	phage tail protein	tail	M5AC19	Bacillus_phage	26.8	8.5e-51
WP_013353323.1|2921489_2922323_-|tail	phage tail family protein	tail	NA	NA	NA	NA
WP_013353324.1|2922334_2926108_-|tail	phage tail tape measure protein	tail	A0A2H4JA91	uncultured_Caudovirales_phage	56.4	9.5e-110
WP_013353325.1|2926174_2926360_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013353326.1|2926371_2926722_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013353327.1|2926809_2927394_-	UDP-N-acetylmuramoylalanine--D-glutamate ligase	NA	U3PCW8	Staphylococcus_phage	37.2	1.1e-25
WP_013353328.1|2927426_2927810_-	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_014470873.1|2927806_2928190_-	HK97 gp10 family phage protein	NA	A0A0M5M1E5	Enterococcus_phage	34.4	8.6e-11
WP_013353329.1|2928189_2928513_-|head	phage head closure protein	head	A0A249XUC8	Enterococcus_phage	41.0	8.0e-10
WP_014470874.1|2928499_2928796_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4J8T8	uncultured_Caudovirales_phage	37.6	6.2e-09
WP_013353330.1|2928851_2930045_-|capsid	phage major capsid protein	capsid	U5U4N8	Lactobacillus_phage	50.9	2.3e-70
WP_014470875.1|2930082_2930679_-|head,protease	HK97 family phage prohead protease	head,protease	A0A1Q1PVX3	Staphylococcus_phage	53.8	2.3e-42
WP_013353331.1|2930671_2931916_-|portal	phage portal protein	portal	A0A2H4J331	uncultured_Caudovirales_phage	38.0	3.9e-68
WP_014470876.1|2931920_2932124_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013353332.1|2932135_2933839_-|terminase	terminase large subunit	terminase	A0A1Q1PVU8	Staphylococcus_phage	34.9	1.8e-92
WP_013353333.1|2933835_2934309_-|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JB21	uncultured_Caudovirales_phage	33.6	4.0e-18
WP_013353334.1|2934580_2934814_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013353335.1|2934828_2935212_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470877.1|2935226_2935517_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470878.1|2935510_2935702_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470879.1|2935705_2936089_-	hypothetical protein	NA	A0A2H4JI60	uncultured_Caudovirales_phage	36.2	4.3e-10
WP_013353336.1|2936088_2936367_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013353337.1|2936363_2936543_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470882.1|2936965_2937157_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013353338.1|2937149_2937338_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013353339.1|2937522_2938272_-	Bro-N domain-containing protein	NA	A0A0B5A507	Paenibacillus_phage	39.8	1.6e-21
WP_076983889.1|2939843_2940089_+	hypothetical protein	NA	A0A1P8CWU6	Bacillus_phage	67.5	1.2e-05
WP_014470885.1|2941134_2941269_-	lysogeny pheromone AimP family peptide	NA	NA	NA	NA	NA
WP_013353340.1|2941313_2942276_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470886.1|2942480_2942660_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_013353341.1|2942846_2943380_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_013353342.1|2943379_2944531_+|integrase	site-specific integrase	integrase	A0A0A8WIF9	Clostridium_phage	29.8	7.8e-31
2944703:2944750	attR	GTATGGAGCCAAGGGGGCTCGAACCCCTGACCTCTACGCTGCCAGCGT	NA	NA	NA	NA
>prophage 14
NZ_CP009748	Bacillus subtilis strain ATCC 13952, complete genome	3876276	3049743	3102179	3876276	coat,integrase,plate,bacteriocin,portal,tail,terminase,holin	Bacillus_phage(28.57%)	60	3046108:3046122	3096396:3096410
3046108:3046122	attL	GCAAACCGATCATTG	NA	NA	NA	NA
WP_003151973.1|3049743_3050079_-|bacteriocin	uberolysin/carnocyclin family circular bacteriocin	bacteriocin	NA	NA	NA	NA
WP_014470922.1|3050145_3050718_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470925.1|3051890_3052652_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_014470927.1|3053137_3053440_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470928.1|3053566_3053824_-|holin	holin	holin	A0A0U4JE55	Bacillus_phage	56.5	6.6e-23
WP_038463031.1|3053844_3054783_-	N-acetylmuramoyl-L-alanine amidase	NA	Q9ZXD7	Bacillus_phage	65.0	1.4e-94
WP_013351581.1|3054862_3055072_-	hypothetical protein	NA	A0A290GDY2	Caldibacillus_phage	45.1	2.6e-09
WP_014470930.1|3055075_3055264_-	XkdX family protein	NA	NA	NA	NA	NA
WP_014470931.1|3055264_3055534_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080292733.1|3055548_3057099_-|plate	BppU family phage baseplate upper protein	plate	M4ZRP1	Bacillus_phage	54.0	6.1e-55
WP_038463035.1|3057144_3059709_-	peptidase G2	NA	D6R401	Bacillus_phage	74.5	0.0e+00
WP_014470934.1|3059723_3061124_-|tail	phage tail protein	tail	A6M966	Geobacillus_virus	31.2	8.6e-40
WP_014470935.1|3061135_3062560_-|tail	phage tail family protein	tail	A0A2H4JBY6	uncultured_Caudovirales_phage	44.0	3.1e-61
WP_014470936.1|3062566_3064789_-|tail	phage tail tape measure protein	tail	A0A0N9SJR9	Paenibacillus_phage	37.8	3.4e-59
WP_014470937.1|3065037_3065646_-|tail	phage tail tape measure protein	tail	A0A0N9SJR9	Paenibacillus_phage	42.2	7.0e-31
WP_013351572.1|3065646_3065883_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470938.1|3065978_3066350_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470939.1|3066407_3066962_-	hypothetical protein	NA	A0A0N9SHI3	Paenibacillus_phage	58.4	4.0e-49
WP_014470940.1|3066986_3067376_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470941.1|3067382_3067790_-	hypothetical protein	NA	A0A0N9SJT1	Paenibacillus_phage	53.7	1.8e-30
WP_038463040.1|3067786_3068122_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470943.1|3068122_3068509_-	hypothetical protein	NA	A0A0N9SGG4	Paenibacillus_phage	39.8	4.6e-20
WP_014470944.1|3068522_3068714_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470945.1|3068770_3069679_-	hypothetical protein	NA	A0A0N9S7T7	Paenibacillus_phage	52.5	9.3e-80
WP_014470946.1|3069710_3070277_-	hypothetical protein	NA	M1NRH2	Streptococcus_phage	30.7	6.1e-05
WP_014470947.1|3070367_3071192_-	type IV secretion protein Rhs	NA	A0A0N9SJR1	Paenibacillus_phage	52.4	2.0e-73
WP_014470948.1|3071191_3072832_-|portal	phage portal protein	portal	A0A2H4J180	uncultured_Caudovirales_phage	55.5	1.4e-163
WP_014470949.1|3072837_3073269_-	hypothetical protein	NA	A0A2H4J6Z8	uncultured_Caudovirales_phage	49.6	2.5e-30
WP_014470950.1|3073285_3075040_-|terminase	phage terminase large subunit	terminase	A0A2H4J484	uncultured_Caudovirales_phage	71.6	5.7e-251
WP_014470951.1|3075122_3075671_+|integrase	site-specific integrase	integrase	A0A2H4J6I5	uncultured_Caudovirales_phage	51.6	2.4e-38
WP_014470954.1|3076171_3076417_-	hypothetical protein	NA	A0A2H4IZN0	uncultured_Caudovirales_phage	68.3	1.6e-05
WP_014470955.1|3076688_3076967_-	hypothetical protein	NA	A0A217EQU8	Bacillus_phage	42.4	3.9e-13
WP_014470956.1|3077803_3078403_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470957.1|3079095_3079887_-	hypothetical protein	NA	A0A0N9S810	Paenibacillus_phage	31.9	7.2e-28
WP_014470958.1|3079973_3080471_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470959.1|3080484_3081261_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470960.1|3081373_3081607_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_014470961.1|3081723_3082527_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470963.1|3083195_3083537_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470964.1|3083533_3083860_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470965.1|3083897_3084440_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470967.1|3085037_3086213_-	hypothetical protein	NA	A0A0U3TNF6	Bacillus_phage	35.3	2.9e-57
WP_014470968.1|3086332_3086548_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_014470970.1|3086863_3087202_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470972.1|3087797_3088025_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_014470973.1|3088084_3088267_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014470974.1|3088297_3089023_-	helix-turn-helix domain-containing protein	NA	A0A288WFX2	Bacillus_phage	31.9	6.6e-20
WP_014470975.1|3089182_3090214_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A142F1N9	Bacillus_phage	26.3	6.7e-34
WP_013353444.1|3090444_3090807_-	iron-sulfur cluster assembly accessory protein	NA	A0A2H4N7M3	Lake_Baikal_phage	43.9	4.0e-18
WP_014470976.1|3090881_3091736_-	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_014470977.1|3091856_3093077_-	NupC/NupG family nucleoside CNT transporter	NA	B2YG43	Musca_hytrovirus	22.5	1.7e-12
WP_014470978.1|3093211_3093448_-	YuzB family protein	NA	NA	NA	NA	NA
WP_014470979.1|3093714_3094782_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_014470980.1|3094819_3095146_-	YuzD family protein	NA	NA	NA	NA	NA
WP_010329960.1|3095324_3095561_+	NifU family protein	NA	Q58MC7	Prochlorococcus_phage	45.6	2.2e-09
WP_038463286.1|3095593_3097576_-	S9 family peptidase	NA	NA	NA	NA	NA
3096396:3096410	attR	GCAAACCGATCATTG	NA	NA	NA	NA
WP_013353450.1|3097677_3098607_-	homoserine kinase	NA	NA	NA	NA	NA
WP_014470982.1|3098603_3099662_-	threonine synthase	NA	NA	NA	NA	NA
WP_013353452.1|3099661_3100963_-	homoserine dehydrogenase	NA	NA	NA	NA	NA
WP_014472214.1|3101162_3102179_-|coat	spore coat protein YutH	coat	NA	NA	NA	NA
