The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP009756	Enterobacter cloacae strain GGT036 chromosome, complete genome	4848754	2509734	2595660	4848754	tail,terminase,tRNA,plate	Cronobacter_phage(20.0%)	83	NA	NA
WP_023621324.1|2509734_2510670_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	95.3	8.8e-142
WP_038419547.1|2510716_2512090_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	31.7	1.2e-51
WP_029882921.1|2512574_2513558_-	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_062729484.1|2513678_2514833_-	chemoreceptor protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	28.1	6.4e-09
WP_038419551.1|2515289_2517428_+	phosphodiesterase	NA	A0A127AWB9	Bacillus_phage	26.6	3.7e-10
WP_038419553.1|2517511_2518744_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	38.1	1.2e-16
WP_013096448.1|2518818_2518959_+	Ecr family regulatory small membrane protein	NA	NA	NA	NA	NA
WP_023621314.1|2519176_2519740_+	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
WP_013096446.1|2519774_2520254_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038419557.1|2520371_2521688_-	type VI secretion system ImpA family N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_038419559.1|2521711_2522167_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_038419561.1|2522569_2523061_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_038419563.1|2523644_2525261_-	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_013096425.1|2525443_2526157_+	murein tripeptide amidase MpaA	NA	NA	NA	NA	NA
WP_038419565.1|2526147_2527113_-	L-Ala-D/L-Glu epimerase	NA	NA	NA	NA	NA
WP_013096423.1|2527220_2527727_+	thiol peroxidase	NA	NA	NA	NA	NA
WP_038419566.1|2528046_2529255_+	aldose 1-epimerase family protein	NA	NA	NA	NA	NA
WP_013096421.1|2529291_2530833_-	transcriptional regulator TyrR	NA	NA	NA	NA	NA
WP_038419568.1|2530946_2531999_-	TIGR01620 family protein	NA	NA	NA	NA	NA
WP_038419570.1|2531995_2533393_-	YcjX family protein	NA	NA	NA	NA	NA
WP_038419572.1|2533544_2534555_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_038419574.1|2534588_2535503_-	OmpG family monomeric porin	NA	NA	NA	NA	NA
WP_038419576.1|2535569_2536652_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.0	1.6e-09
WP_038419578.1|2536654_2537332_-	beta-phosphoglucomutase	NA	NA	NA	NA	NA
WP_038419580.1|2537321_2539601_-	glycoside hydrolase family 65 protein	NA	NA	NA	NA	NA
WP_100168880.1|2539594_2540653_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_038420918.1|2540664_2541453_-	sugar phosphate isomerase/epimerase	NA	NA	NA	NA	NA
WP_038419586.1|2541471_2542524_-	zinc-binding alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_013096410.1|2542552_2543395_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_038419587.1|2543381_2544263_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_013096408.1|2544286_2545579_-	carbohydrate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_038419588.1|2545594_2547280_-	sugar phosphorylase	NA	NA	NA	NA	NA
WP_013096406.1|2547489_2547711_-	phage shock protein PspD	NA	NA	NA	NA	NA
WP_013096405.1|2547723_2548083_-	envelope stress response membrane protein PspC	NA	NA	NA	NA	NA
WP_013096404.1|2548082_2548307_-	envelope stress response membrane protein PspB	NA	NA	NA	NA	NA
WP_013096403.1|2548361_2549030_-	phage shock protein PspA	NA	NA	NA	NA	NA
WP_038419589.1|2549196_2550174_+	phage shock protein operon transcriptional activator	NA	NA	NA	NA	NA
WP_023622385.1|2550230_2551964_-	lipase	NA	NA	NA	NA	NA
WP_038419590.1|2551991_2553350_-	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_038419591.1|2553352_2554666_-	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_086528245.1|2554658_2556326_-	type I secretion system permease/ATPase	NA	NA	NA	NA	NA
WP_038419595.1|2557085_2558726_+	peptide ABC transporter substrate-binding protein SapA	NA	NA	NA	NA	NA
WP_013096396.1|2558722_2559688_+	peptide ABC transporter permease SapB	NA	NA	NA	NA	NA
WP_038419597.1|2559890_2560559_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	60.4	4.8e-81
WP_038419599.1|2560639_2561119_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_038419601.1|2561332_2562601_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	92.9	1.6e-231
WP_024907219.1|2562603_2563023_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	58.3	2.9e-36
WP_052123618.1|2563195_2563639_-	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	75.0	5.1e-55
WP_038419602.1|2563840_2565067_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038419604.1|2565627_2566941_-|tail	tail fiber domain-containing protein	tail	K7PGY2	Enterobacteria_phage	48.1	1.4e-81
WP_038419605.1|2567067_2567430_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020689232.1|2567394_2568036_-	hypothetical protein	NA	G8C7R6	Escherichia_phage	90.6	5.9e-113
WP_038419611.1|2568328_2571865_-|tail	phage tail protein	tail	K7PJL6	Enterobacteria_phage	89.7	0.0e+00
WP_038419612.1|2571926_2572493_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038419614.1|2572553_2573183_-|tail	tail assembly protein	tail	K7PGY0	Enterobacteria_phage	59.4	5.9e-57
WP_029882041.1|2573215_2573926_-	C40 family peptidase	NA	K7PJX1	Enterobacterial_phage	95.3	1.7e-140
WP_038419616.1|2573927_2574683_-|tail	phage minor tail protein L	tail	G8C7J7	Escherichia_phage	77.6	1.5e-115
WP_038419618.1|2574679_2575027_-|tail	phage tail protein	tail	I6PBN7	Cronobacter_phage	63.5	1.3e-37
WP_038419619.1|2575101_2575785_-	hypothetical protein	NA	A0A0R6PJY5	Moraxella_phage	43.2	6.4e-41
WP_038419621.1|2575897_2578810_-|tail	phage tail tape measure protein	tail	I6PCW3	Cronobacter_phage	37.4	1.5e-147
WP_038419622.1|2578806_2579121_-	DUF1799 domain-containing protein	NA	I6PD79	Cronobacter_phage	65.0	2.5e-16
WP_038419624.1|2579117_2579429_-	hypothetical protein	NA	I6PDG2	Cronobacter_phage	68.0	1.8e-35
WP_032643342.1|2579493_2580165_-|tail	phage tail protein	tail	I6PBN6	Cronobacter_phage	48.2	1.1e-50
WP_038419627.1|2580234_2580645_-	DUF4128 domain-containing protein	NA	I6PDJ8	Cronobacter_phage	52.9	1.3e-33
WP_020690992.1|2580641_2581226_-	hypothetical protein	NA	G8C7Q1	Escherichia_phage	53.7	3.2e-49
WP_038419630.1|2581227_2581578_-	hypothetical protein	NA	I6PD77	Cronobacter_phage	57.8	4.8e-32
WP_038419632.1|2581579_2582062_-	hypothetical protein	NA	A0A1W6JS23	Salmonella_phage	34.2	2.4e-10
WP_157929995.1|2582098_2582398_-	Ig-like domain-containing protein	NA	NA	NA	NA	NA
WP_038419633.1|2582379_2583333_-	Ig domain-containing protein	NA	A0A1B0VMF8	Pseudomonas_phage	75.3	6.9e-134
WP_038419635.1|2583344_2584115_-	hypothetical protein	NA	A0A1B0VMG1	Pseudomonas_phage	59.1	2.4e-68
WP_038419636.1|2584195_2585293_-	phage Mu F like family protein	NA	I6PD76	Cronobacter_phage	58.2	6.1e-118
WP_038419637.1|2585294_2586683_-	DUF4055 domain-containing protein	NA	A0A1B0VMH0	Pseudomonas_phage	49.7	4.2e-124
WP_038419639.1|2586684_2587992_-|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	57.0	8.6e-143
WP_038419641.1|2587969_2588968_-|terminase	terminase small subunit	terminase	I6X6R5	Burkholderia_virus	41.7	2.0e-38
WP_038419644.1|2590232_2590751_-	hypothetical protein	NA	K7PHH7	Enterobacteria_phage	81.9	7.0e-72
WP_038419645.1|2590747_2591284_-	lysozyme	NA	K7PM52	Enterobacteria_phage	90.2	9.1e-91
WP_014832171.1|2591283_2591586_-	hypothetical protein	NA	O64361	Escherichia_phage	67.3	3.1e-32
WP_029882064.1|2592658_2592850_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029882065.1|2593044_2593878_-	antitermination protein	NA	K7PKS8	Enterobacteria_phage	78.0	3.1e-122
WP_038420920.1|2593874_2594237_-	RusA family crossover junction endodeoxyribonuclease	NA	K7PM48	Enterobacteria_phage	81.4	1.5e-49
WP_029882066.1|2594239_2594440_-	hypothetical protein	NA	H6WRY8	Salmonella_phage	77.3	1.3e-26
WP_029882067.1|2594444_2595047_-	DUF1367 family protein	NA	H6WRY7	Salmonella_phage	82.0	3.4e-94
WP_038419647.1|2595435_2595660_-	DinI family protein	NA	H6WRY5	Salmonella_phage	61.0	1.2e-20
>prophage 2
NZ_CP009756	Enterobacter cloacae strain GGT036 chromosome, complete genome	4848754	2602844	2734274	4848754	terminase,capsid,protease,tail,plate,holin,portal,head,lysis,integrase	Enterobacteria_phage(37.5%)	144	2615037:2615060	2740012:2740035
WP_038419653.1|2602844_2603531_-	phage replication protein P	NA	G8C7U6	Escherichia_phage	61.7	3.5e-79
WP_038419655.1|2603527_2604445_-	replication protein	NA	K7PGZ0	Enterobacteria_phage	71.1	4.6e-111
WP_038419657.1|2604529_2605081_-	hypothetical protein	NA	K7PJT7	Enterobacteria_phage	46.4	9.8e-32
WP_071788679.1|2605083_2605302_-	helix-turn-helix domain-containing protein	NA	K7PKS2	Enterobacteria_phage	57.7	1.1e-18
WP_060614633.1|2605343_2605781_+	helix-turn-helix domain-containing protein	NA	K7PHG0	Enterobacteria_phage	75.7	8.0e-53
WP_023296473.1|2605953_2606838_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172645249.1|2606873_2607047_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014884026.1|2607608_2607773_+	hypothetical protein	NA	K7PGY4	Enterobacteria_phage	85.4	2.4e-18
WP_038419663.1|2607913_2611048_+	PD-(D/E)XK nuclease-like domain-containing protein	NA	K7P6V4	Enterobacteria_phage	53.4	2.6e-302
WP_038419665.1|2611059_2612169_+	recombinase RecT	NA	A0A2I7RQF1	Vibrio_phage	42.4	1.1e-58
WP_014832196.1|2612207_2612447_+	DUF4060 family protein	NA	K7PHF4	Enterobacteria_phage	75.6	5.5e-24
WP_045903093.1|2612668_2613898_-|integrase	site-specific integrase	integrase	K7PGY1	Enterobacteria_phage	51.9	1.7e-121
WP_038419668.1|2614032_2614923_+	peptide ABC transporter permease SapC	NA	NA	NA	NA	NA
WP_013096394.1|2614922_2615915_+	peptide ABC transporter ATP-binding protein SapD	NA	G9BWD6	Planktothrix_phage	26.5	3.6e-08
2615037:2615060	attL	GTGGGCGAATCCGGCTCCGGGAAA	NA	NA	NA	NA
WP_013096393.1|2615916_2616723_+	peptide ABC transporter ATP-binding protein SapF	NA	G3M9Y6	Bacillus_virus	28.5	4.6e-14
WP_038419670.1|2616920_2617835_+	glycosyl transferase	NA	NA	NA	NA	NA
WP_038419671.1|2617847_2618915_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_020690953.1|2618911_2619616_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.9	2.0e-29
WP_038419673.1|2619931_2620318_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052123623.1|2620446_2621349_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013096384.1|2624747_2625536_+	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_038419675.1|2625690_2626677_+	oxidoreductase	NA	NA	NA	NA	NA
WP_038419676.1|2626765_2628700_+	exoribonuclease II	NA	A0A2H4UVB7	Bodo_saltans_virus	23.6	1.9e-05
WP_013096381.1|2629025_2631017_+	cyclic di-GMP phosphodiesterase	NA	NA	NA	NA	NA
WP_020690947.1|2631013_2631883_-	crotonase/enoyl-CoA hydratase family protein	NA	NA	NA	NA	NA
WP_020690946.1|2632076_2632259_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038419677.1|2632302_2633055_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_008501216.1|2633316_2633535_+	osmotically-inducible lipoprotein OsmB	NA	NA	NA	NA	NA
WP_013096377.1|2633637_2633964_-	stress response translation initiation inhibitor YciH	NA	NA	NA	NA	NA
WP_028027957.1|2633963_2634701_-	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_013096375.1|2634887_2636057_-	lipopolysaccharide assembly protein LapB	NA	NA	NA	NA	NA
WP_013096374.1|2636063_2636372_-	LapA family protein	NA	NA	NA	NA	NA
WP_038420925.1|2636520_2637288_-	phosphatidylglycerophosphatase B	NA	NA	NA	NA	NA
WP_013096372.1|2637486_2638077_+	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.4	1.0e-42
WP_038419679.1|2638121_2640797_-	aconitate hydratase AcnA	NA	NA	NA	NA	NA
WP_086528097.1|2641372_2641534_-	YmiA family putative membrane protein	NA	NA	NA	NA	NA
WP_006175683.1|2641850_2642825_-	HTH-type transcriptional regulator CysB	NA	NA	NA	NA	NA
WP_038419681.1|2643012_2645610_-	type I DNA topoisomerase	NA	A0A2K9L5F8	Tupanvirus	34.6	1.6e-84
WP_003856804.1|2646009_2646261_+	YciN family protein	NA	NA	NA	NA	NA
WP_038419682.1|2646295_2647342_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	28.7	3.6e-19
WP_023620279.1|2647593_2648355_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.0	1.4e-07
WP_013096364.1|2648351_2648942_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_013096363.1|2648978_2649854_-	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_013096362.1|2649950_2650571_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_013096361.1|2650567_2651449_-	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_106993556.1|2651588_2651633_+	trp operon leader peptide	NA	NA	NA	NA	NA
WP_029883574.1|2651728_2653291_+	anthranilate synthase component 1	NA	NA	NA	NA	NA
WP_038419685.1|2653290_2654886_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	37.6	5.0e-52
WP_038419686.1|2654889_2656248_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	39.9	9.5e-36
WP_013096356.1|2656258_2657452_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_038419688.1|2657451_2658261_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_038419689.1|2658740_2659424_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	61.6	3.7e-81
WP_038419692.1|2659519_2660656_+	acyltransferase	NA	A0A088CPR9	Enterobacteria_phage	30.8	7.7e-31
WP_038419694.1|2660696_2661965_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	92.9	1.8e-230
WP_038419696.1|2661967_2662387_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	58.3	7.7e-37
WP_038419700.1|2662972_2664247_-	hypothetical protein	NA	K7PM99	Enterobacterial_phage	67.1	2.7e-149
WP_038419702.1|2664373_2664736_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038419703.1|2664700_2665342_-	hypothetical protein	NA	G8C7R6	Escherichia_phage	90.1	1.3e-112
WP_038419706.1|2665634_2669171_-|tail	phage tail protein	tail	K7PKR4	Enterobacteria_phage	89.2	0.0e+00
WP_038419708.1|2669223_2669814_-|tail	tail assembly protein	tail	K7PHE5	Enterobacteria_phage	98.5	3.9e-103
WP_038419710.1|2669801_2670533_-	C40 family peptidase	NA	K7P7M8	Enterobacteria_phage	97.5	3.2e-147
WP_038419713.1|2670534_2671290_-|tail	phage minor tail protein L	tail	K7PGX3	Enterobacteria_phage	98.4	3.7e-146
WP_000151491.1|2671286_2671634_-|tail	phage tail protein	tail	K7P7G7	Enterobacteria_phage	100.0	4.8e-61
WP_038419715.1|2671639_2674156_-|tail	phage tail tape measure protein	tail	K7PKR0	Enterobacteria_phage	91.6	0.0e+00
WP_038419716.1|2674133_2674454_-|tail	phage tail assembly protein T	tail	K7P6V0	Enterobacteria_phage	98.1	3.7e-55
WP_013096339.1|2674462_2674885_-|tail	phage minor tail protein G	tail	K7P7M5	Enterobacteria_phage	97.1	9.1e-54
WP_038419719.1|2674923_2675661_-|tail	phage tail protein	tail	O64327	Escherichia_phage	98.0	1.8e-129
WP_038419720.1|2675668_2676067_-|tail	tail protein	tail	K7PJT1	Enterobacteria_phage	97.7	1.2e-68
WP_038419721.1|2676063_2676618_-|tail	phage tail protein	tail	K7P7A8	Enterobacteria_phage	99.5	6.7e-81
WP_038419723.1|2676627_2676981_-|head,tail	head-tail joining protein	head,tail	K7P6U9	Enterobacteria_phage	88.9	3.1e-55
WP_038419725.1|2676991_2677405_-	DNA-packaging protein	NA	O64323	Escherichia_phage	84.0	2.1e-39
WP_038419726.1|2677450_2678476_-|capsid	major capsid protein	capsid	K7PGW9	Enterobacteria_phage	95.6	3.8e-186
WP_038419728.1|2678541_2678874_-|head	head decoration protein	head	E4WL24	Enterobacteria_phage	95.5	2.5e-54
WP_038419730.1|2678883_2680227_-	S49 family peptidase	NA	O64320	Escherichia_phage	95.5	3.7e-210
WP_038419732.1|2680207_2681800_-|portal	phage portal protein	portal	E4WL21	Enterobacteria_phage	98.3	1.6e-305
WP_038419734.1|2681796_2682003_-	gpW family protein	NA	E4WL20	Enterobacteria_phage	98.5	2.2e-29
WP_038419736.1|2682002_2683925_-|terminase	phage terminase large subunit family protein	terminase	K7P6G6	Enterobacteria_phage	96.6	0.0e+00
WP_038419737.1|2683899_2684445_-|terminase	terminase small subunit	terminase	K7P7G0	Enterobacteria_phage	98.3	8.9e-94
WP_154231913.1|2684927_2685791_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038419741.1|2686065_2686587_-	hypothetical protein	NA	K7PHH7	Enterobacteria_phage	80.6	8.6e-70
WP_038419742.1|2686583_2687120_-	lysozyme	NA	K7PM52	Enterobacteria_phage	89.6	2.0e-90
WP_052123625.1|2687119_2687422_-	hypothetical protein	NA	O64361	Escherichia_phage	66.3	4.1e-32
WP_038419743.1|2687936_2688722_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038419745.1|2688922_2689705_-	antitermination protein	NA	F1C595	Cronobacter_phage	71.7	4.8e-101
WP_038419747.1|2689701_2690058_-	RusA family crossover junction endodeoxyribonuclease	NA	K7P6W0	Enterobacteria_phage	61.9	1.1e-39
WP_038419748.1|2690050_2690344_-	hypothetical protein	NA	Q6V7S4	Burkholderia_virus	55.8	6.0e-20
WP_154231914.1|2690412_2690637_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038419751.1|2690836_2691160_-	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	59.8	7.2e-27
WP_038419752.1|2691578_2691860_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038420927.1|2691905_2692103_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052123627.1|2692491_2692794_-	hypothetical protein	NA	K7P7J4	Enterobacteria_phage	74.5	2.3e-11
WP_038419753.1|2692790_2693000_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052123630.1|2693355_2693778_-	hypothetical protein	NA	A0A193GYL1	Enterobacter_phage	32.7	1.9e-06
WP_038419755.1|2693973_2694630_-	DUF1627 domain-containing protein	NA	NA	NA	NA	NA
WP_038419756.1|2694647_2695388_-	ATP-binding protein	NA	H6WRX8	Salmonella_phage	73.1	7.8e-101
WP_038419758.1|2695390_2696308_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	38.3	1.5e-48
WP_038419760.1|2696330_2696783_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032663354.1|2696782_2697052_-	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	38.7	2.8e-08
WP_038419763.1|2697124_2697616_+	helix-turn-helix domain-containing protein	NA	A0A0R6PH50	Moraxella_phage	60.3	4.6e-17
WP_052123633.1|2697992_2698439_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038419764.1|2698866_2699139_+	hypothetical protein	NA	H6WRX2	Salmonella_phage	47.4	2.7e-14
WP_038419765.1|2699361_2700951_+	hypothetical protein	NA	S4TNL0	Salmonella_phage	29.5	1.2e-24
WP_038419767.1|2700947_2701241_+	hypothetical protein	NA	A0A096XUX1	Cronobacter_phage	36.3	2.8e-09
WP_038419771.1|2701575_2702694_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21929	Phage_21	45.0	2.2e-78
WP_038419772.1|2702859_2704071_+	selenium metabolism membrane protein YedE/FdhT	NA	NA	NA	NA	NA
WP_013096288.1|2704067_2704301_+	sulfurtransferase-like selenium metabolism protein YedF	NA	NA	NA	NA	NA
WP_038419774.1|2704432_2704867_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	46.9	5.2e-28
WP_038419776.1|2704955_2705360_+	cell envelope integrity/translocation protein TolA	NA	NA	NA	NA	NA
WP_013096285.1|2705413_2706046_-	outer membrane protein OmpW	NA	NA	NA	NA	NA
WP_013096284.1|2706327_2706732_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_013096283.1|2706757_2707501_+	UPF0259 family protein	NA	NA	NA	NA	NA
WP_038419778.1|2707557_2708097_+	septation protein A	NA	NA	NA	NA	NA
WP_013096281.1|2708202_2708598_+	acyl-CoA thioester hydrolase YciA	NA	NA	NA	NA	NA
WP_038419780.1|2708636_2709356_-	TonB system transport protein TonB	NA	NA	NA	NA	NA
WP_008502794.1|2709576_2709873_+	YciI family protein	NA	NA	NA	NA	NA
WP_038419782.1|2710065_2711367_-	FRG domain-containing protein	NA	NA	NA	NA	NA
WP_071843272.1|2711638_2711860_-	DNA-binding transcriptional regulator	NA	A0A2I8TV89	Erwinia_phage	69.9	6.0e-25
WP_038419784.1|2711939_2713106_-	phage late control D family protein	NA	Q6K1G4	Salmonella_virus	79.0	7.1e-173
WP_023333118.1|2713102_2713567_-|tail	phage tail protein	tail	A0A218M4I2	Erwinia_phage	71.4	1.2e-59
WP_038419788.1|2714412_2714763_-	GPW/gp25 family protein	NA	A0A0M4RE59	Salmonella_phage	70.7	1.2e-38
WP_038419789.1|2714759_2715401_-|plate	phage baseplate assembly protein V	plate	A0A0M4S6F6	Salmonella_phage	80.3	5.2e-93
WP_052123667.1|2715762_2716560_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_038419791.1|2716678_2717134_-	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	65.1	3.2e-44
WP_038419793.1|2717126_2717594_-|tail	phage tail protein	tail	A0A218M4K6	Erwinia_phage	72.3	1.7e-61
WP_072253209.1|2717556_2717802_-|holin	holin	holin	S4TNY4	Salmonella_phage	76.5	6.5e-28
WP_038419795.1|2717689_2718115_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A218M4K2	Erwinia_phage	66.2	8.9e-41
WP_038419797.1|2718111_2718621_-	lysozyme	NA	A0A218M4K3	Erwinia_phage	84.5	1.6e-76
WP_032664907.1|2718604_2718826_-	hypothetical protein	NA	A0A218M4L5	Erwinia_phage	75.3	1.1e-26
WP_038419800.1|2718816_2719020_-|tail	tail protein X	tail	A0A218M4L8	Erwinia_phage	79.1	5.5e-25
WP_052123635.1|2719019_2719526_-|head	head completion/stabilization protein	head	O80306	Escherichia_phage	69.0	1.0e-59
WP_038419802.1|2719625_2720381_-|terminase	terminase endonuclease subunit	terminase	Q6K1I5	Salmonella_virus	70.1	1.2e-80
WP_038419804.1|2720384_2721452_-|capsid	phage major capsid protein, P2 family	capsid	S4TUA6	Salmonella_phage	82.5	2.8e-168
WP_038419806.1|2721507_2722362_-|capsid	GPO family capsid scaffolding protein	capsid	A0A218M4L9	Erwinia_phage	73.6	5.3e-117
WP_038419808.1|2722528_2724298_+|terminase	terminase ATPase subunit family protein	terminase	A0A218M4M1	Erwinia_phage	84.9	3.0e-300
WP_038419810.1|2724299_2725325_+|portal	phage portal protein	portal	Q6K1J0	Salmonella_virus	83.6	1.9e-169
WP_038419811.1|2725826_2728043_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_038419813.1|2728275_2730567_-	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	73.8	0.0e+00
WP_038419815.1|2730568_2730832_-	DUF5405 family protein	NA	U5N3W1	Enterobacteria_phage	57.0	5.7e-22
WP_001171818.1|2730854_2731073_-	DUF2732 family protein	NA	NA	NA	NA	NA
WP_000217660.1|2731139_2731640_-	hypothetical protein	NA	M1SV55	Escherichia_phage	75.9	1.7e-70
WP_038419816.1|2732159_2732420_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038419817.1|2732471_2732747_-	hypothetical protein	NA	Q1JS60	Enterobacteria_phage	85.6	7.5e-41
WP_032667448.1|2732867_2733167_+	helix-turn-helix transcriptional regulator	NA	Q1JS61	Enterobacteria_phage	77.8	2.2e-38
WP_038419819.1|2733263_2734274_+|integrase	tyrosine-type recombinase/integrase	integrase	Q83VS6	Escherichia_phage	76.4	8.1e-149
2740012:2740035	attR	TTTCCCGGAGCCGGATTCGCCCAC	NA	NA	NA	NA
>prophage 3
NZ_CP009756	Enterobacter cloacae strain GGT036 chromosome, complete genome	4848754	3154419	3160693	4848754		Enterobacteria_phage(66.67%)	6	NA	NA
WP_014832608.1|3154419_3154956_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	56.7	4.4e-53
WP_038420114.1|3154959_3155838_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.1	1.1e-106
WP_038420116.1|3155890_3156790_-	dTDP-4-dehydrorhamnose reductase	NA	A0A140G5S3	Enterobacteria_phage	35.4	6.7e-30
WP_038420117.1|3156792_3157875_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.4	9.7e-100
WP_013097865.1|3158229_3159126_-	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	41.9	9.0e-43
WP_038420119.1|3159301_3160693_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	32.8	4.8e-19
>prophage 4
NZ_CP009756	Enterobacter cloacae strain GGT036 chromosome, complete genome	4848754	4110209	4138836	4848754	protease,tail,tRNA,holin,plate,integrase	Erwinia_phage(40.62%)	35	4119371:4119395	4138911:4138935
WP_038420619.1|4110209_4112204_-|protease	serine protease	protease	Q2A0D0	Sodalis_phage	25.1	2.4e-19
WP_029883055.1|4112552_4113233_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_013098775.1|4113264_4114278_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	58.6	8.2e-109
WP_001144069.1|4114514_4114730_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_038420621.1|4114846_4116592_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	39.2	4.9e-77
WP_013098777.1|4116757_4118605_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.4e-35
WP_020689452.1|4118708_4119215_-	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
4119371:4119395	attL	ACTCATAATCGCTTGGTCGCTGGTT	NA	NA	NA	NA
WP_014833326.1|4119570_4119771_-	ogr/Delta-like zinc finger family protein	NA	A0A2I8TV89	Erwinia_phage	77.4	5.3e-20
WP_038420622.1|4119837_4120983_-	phage late control D family protein	NA	A0A218M4J7	Erwinia_phage	62.5	1.0e-131
WP_014833328.1|4120979_4121444_-|tail	phage tail protein	tail	O80317	Escherichia_phage	70.4	4.6e-59
WP_038420624.1|4121455_4123903_-|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	37.3	9.8e-132
WP_006178610.1|4123895_4124015_-|tail	GpE family phage tail protein	tail	O80316	Escherichia_phage	89.7	9.7e-14
WP_038420626.1|4124047_4124356_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	70.1	2.6e-26
WP_014833332.1|4124410_4124929_-|tail	phage major tail tube protein	tail	A0A218M4J0	Erwinia_phage	80.8	4.5e-79
WP_038420628.1|4124940_4126134_-|tail	phage tail sheath protein	tail	U5N3V0	Enterobacteria_phage	81.4	2.6e-186
WP_038420630.1|4126257_4126764_-|tail	tail fiber assembly protein	tail	F1BUK2	Cronobacter_phage	52.7	1.7e-43
WP_038420633.1|4126773_4128819_-|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	81.9	6.3e-92
WP_020689443.1|4128830_4129361_-|tail	phage tail protein I	tail	Q37841	Escherichia_phage	86.9	2.0e-90
WP_038420635.1|4129353_4130262_-|plate	baseplate assembly protein	plate	Q6K1H4	Salmonella_virus	80.5	3.2e-128
WP_020689441.1|4130267_4130618_-	GPW/gp25 family protein	NA	A0A0M4RE59	Salmonella_phage	70.7	2.6e-38
WP_038420637.1|4130614_4131256_-|plate	phage baseplate assembly protein V	plate	A0A0M4S6F6	Salmonella_phage	77.9	7.8e-89
WP_038420639.1|4131371_4131839_-|tail	phage tail protein	tail	A0A218M4K6	Erwinia_phage	62.3	7.5e-49
WP_162837624.1|4131801_4132047_-|holin	holin	holin	S4TNY4	Salmonella_phage	73.4	2.7e-26
WP_038420641.1|4131946_4132360_-	protein lysB	NA	A0A218M4K2	Erwinia_phage	60.3	1.1e-35
WP_038420643.1|4132356_4132866_-	lysozyme	NA	A0A218M4K3	Erwinia_phage	80.8	8.1e-73
WP_020689436.1|4132849_4133071_-	primosomal protein	NA	A0A218M4L5	Erwinia_phage	73.6	7.9e-25
WP_028027926.1|4133061_4133265_-|tail	tail protein X	tail	Q858W3	Yersinia_virus	74.6	2.3e-23
WP_023619960.1|4133430_4133871_-	DinI family protein	NA	A0A218M4I0	Erwinia_phage	76.6	5.6e-54
WP_038420645.1|4133980_4135942_-	replication endonuclease	NA	A0A218M4H2	Erwinia_phage	76.3	5.0e-296
WP_038420647.1|4135943_4136165_-	TraR/DksA family transcriptional regulator	NA	A0A0M4S5Q7	Salmonella_phage	72.2	3.9e-24
WP_038420649.1|4136164_4136392_-	DUF2732 domain-containing protein	NA	A0A0M3UL87	Salmonella_phage	62.7	6.4e-14
WP_038420650.1|4136459_4136798_-	DUF5347 domain-containing protein	NA	A0A218M4I7	Erwinia_phage	73.9	1.6e-40
WP_014833350.1|4136830_4137094_-	hypothetical protein	NA	A0A218M4I5	Erwinia_phage	96.5	3.2e-41
WP_038420651.1|4137226_4137802_+	phage repressor protein CI	NA	A0A218M4J1	Erwinia_phage	63.8	7.5e-67
WP_038420652.1|4137801_4138836_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	91.6	6.3e-189
4138911:4138935	attR	ACTCATAATCGCTTGGTCGCTGGTT	NA	NA	NA	NA
