The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP006764	Corynebacterium doosanense CAU 212 = DSM 45436 strain CAU 212(T) chromosome, complete genome	2671798	89511	199457	2671798	transposase	Escherichia_phage(28.0%)	110	NA	NA
WP_156111856.1|89511_90456_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_026159483.1|91782_92718_+	NAD-dependent protein deacetylase	NA	A0A068EPD4	Bacillus_phage	24.7	1.0e-12
WP_018022860.1|92718_92910_-	helix-turn-helix transcriptional regulator	NA	S5M643	Brevibacillus_phage	45.8	8.4e-07
WP_018022861.1|92911_93361_-	hypothetical protein	NA	NA	NA	NA	NA
WP_018022862.1|93429_94422_-	triacylglycerol lipase	NA	NA	NA	NA	NA
WP_038573124.1|94423_95038_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_018022864.1|95068_96481_+	AMP nucleosidase	NA	NA	NA	NA	NA
WP_018022865.1|96680_97622_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026159485.1|97754_98813_-	alanine dehydrogenase	NA	NA	NA	NA	NA
WP_018022867.1|99183_100059_+	hypothetical protein	NA	NA	NA	NA	NA
WP_018022868.1|100158_101220_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026159486.1|101255_103130_+	gamma-glutamyltransferase	NA	NA	NA	NA	NA
WP_018022870.1|103133_106241_-	3'-5' exoribonuclease	NA	A0A1X9SH08	Bradyrhizobium_phage	30.2	3.5e-09
WP_018022871.1|106298_108182_-	DUF2075 domain-containing protein	NA	NA	NA	NA	NA
WP_018022872.1|108261_108771_-	hypothetical protein	NA	NA	NA	NA	NA
WP_018022873.1|108962_109313_+	hypothetical protein	NA	NA	NA	NA	NA
WP_018022874.1|109530_110586_-	DUF2183 domain-containing protein	NA	NA	NA	NA	NA
WP_018022875.1|110659_111319_+	DUF1801 domain-containing protein	NA	NA	NA	NA	NA
WP_018022876.1|111332_111836_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_018022877.1|111848_112412_-	DNA-3-methyladenine glycosylase	NA	NA	NA	NA	NA
WP_018022878.1|112442_113018_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038573126.1|113008_113560_+	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_026159487.1|113585_114662_-	ROK family transcriptional regulator	NA	NA	NA	NA	NA
WP_018022881.1|114731_115430_-	hypothetical protein	NA	NA	NA	NA	NA
WP_018022882.1|115469_116207_-	NAD-dependent deacylase	NA	A0A126HHA0	Vibrio_phage	32.8	1.1e-14
WP_018022883.1|116262_117963_+	DUF885 domain-containing protein	NA	NA	NA	NA	NA
WP_018022884.1|117963_118302_+	hypothetical protein	NA	NA	NA	NA	NA
WP_018022885.1|118298_119378_-	AbrB family transcriptional regulator	NA	NA	NA	NA	NA
WP_018022886.1|119402_120173_+	TSUP family transporter	NA	NA	NA	NA	NA
WP_018022887.1|120129_121323_-	DUF1624 domain-containing protein	NA	NA	NA	NA	NA
WP_018022888.1|121332_123639_-	ATP-dependent RNA helicase	NA	A0A2H4UU36	Bodo_saltans_virus	26.0	2.5e-28
WP_018022889.1|123628_124207_-	sugar O-acetyltransferase	NA	NA	NA	NA	NA
WP_018022890.1|124274_124991_+	alpha-ketoglutarate-dependent dioxygenase AlkB	NA	NA	NA	NA	NA
WP_018022891.1|124995_125799_-	M23 family metallopeptidase	NA	G8I8L5	Mycobacterium_phage	52.5	4.9e-24
WP_026159489.1|126112_126838_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_018022893.1|126869_127160_+	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
WP_018022894.1|127163_127970_+	VOC family protein	NA	NA	NA	NA	NA
WP_018022895.1|127966_128257_+	MGMT family protein	NA	NA	NA	NA	NA
WP_018022896.1|128253_128586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_018022897.1|128582_128894_+	hypothetical protein	NA	NA	NA	NA	NA
WP_018022898.1|128952_129237_+	hypothetical protein	NA	NA	NA	NA	NA
WP_018022899.1|129261_130308_+	NAD(P)-dependent alcohol dehydrogenase	NA	M1PHA2	Moumouvirus	42.3	1.3e-69
WP_018022900.1|130645_131098_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156111857.1|131072_132276_+|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	31.6	2.6e-29
WP_038573135.1|132287_133568_+|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	53.2	1.1e-113
WP_018023091.1|133824_134355_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_020384715.1|134351_135101_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_156111858.1|135472_136147_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	59.5	1.7e-73
WP_018023075.1|136428_136836_-	VOC family protein	NA	NA	NA	NA	NA
WP_018023074.1|136909_137488_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_038573137.1|138198_139011_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156111859.1|138944_139619_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	59.0	3.7e-73
WP_026159522.1|140182_140872_+	DUF998 domain-containing protein	NA	NA	NA	NA	NA
WP_081957025.1|141030_142200_+	serine hydrolase	NA	NA	NA	NA	NA
WP_038573139.1|142113_142824_-|transposase	IS6-like element ISCef5 family transposase	transposase	A0A077SL39	Escherichia_phage	59.8	6.2e-79
WP_155861413.1|142837_143608_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038573141.1|143740_144100_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038573144.1|145072_146635_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_018023087.1|146631_147378_+	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	31.2	8.1e-13
WP_162179678.1|147614_147893_-|transposase	Mu transposase C-terminal domain-containing protein	transposase	NA	NA	NA	NA
WP_018022986.1|148453_149338_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_018022985.1|149357_151628_+	PQQ-binding-like beta-propeller repeat protein	NA	NA	NA	NA	NA
WP_155861399.1|151609_152545_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_018022983.1|152541_153369_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_081610408.1|153459_154806_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_155861400.1|154823_155966_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	32.3	3.8e-22
WP_018022980.1|155977_156631_+	HAD family phosphatase	NA	NA	NA	NA	NA
WP_169331879.1|156660_157356_-	HAD-IC family P-type ATPase	NA	E4ZFI9	Streptococcus_phage	41.0	2.1e-31
WP_026159502.1|158080_159148_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	49.6	1.3e-24
WP_018022976.1|159308_159548_-	hypothetical protein	NA	NA	NA	NA	NA
WP_018022973.1|161553_162465_-	DNA processing protein DprA	NA	S6BFL3	Thermus_phage	42.2	2.1e-26
WP_155861398.1|162933_164334_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011069225.1|164244_164955_-|transposase	IS6-like element IS1628 family transposase	transposase	A0A077SL39	Escherichia_phage	58.5	5.2e-78
WP_038573159.1|164953_165178_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081610415.1|165231_166200_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_018023057.1|166575_167742_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_127483347.1|167764_168583_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_018023059.1|168588_169434_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_018023038.1|169652_170555_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_018022987.1|170575_171286_-	ThuA domain-containing protein	NA	NA	NA	NA	NA
WP_173405499.1|171327_172413_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_018022989.1|172625_172799_-	hypothetical protein	NA	NA	NA	NA	NA
WP_018022990.1|172955_173852_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_026159504.1|173888_174845_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_018022992.1|174866_175772_-	phosphodiesterase	NA	NA	NA	NA	NA
WP_018022993.1|175805_176561_-	tyrosine-protein phosphatase	NA	NA	NA	NA	NA
WP_018022994.1|176557_177922_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_018022995.1|177963_179106_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.8	5.4e-24
WP_018022996.1|179207_179357_-	hypothetical protein	NA	NA	NA	NA	NA
WP_018022997.1|179375_180149_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_018022999.1|181777_182167_-	hypothetical protein	NA	NA	NA	NA	NA
WP_018023000.1|182449_183628_-	hypothetical protein	NA	G9FH43	Rhodococcus_phage	38.6	1.7e-20
WP_018023038.1|183771_184674_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_018023039.1|184815_185472_-	ParA family protein	NA	NA	NA	NA	NA
WP_081610413.1|185667_185907_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_155861405.1|186690_186879_+	hypothetical protein	NA	NA	NA	NA	NA
WP_018023041.1|187093_187741_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156111860.1|187935_189009_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011069225.1|189007_189718_+|transposase	IS6-like element IS1628 family transposase	transposase	A0A077SL39	Escherichia_phage	58.5	5.2e-78
WP_018023089.1|190521_191061_+	chlorite dismutase family protein	NA	NA	NA	NA	NA
WP_011069225.1|191626_192337_+|transposase	IS6-like element IS1628 family transposase	transposase	A0A077SL39	Escherichia_phage	58.5	5.2e-78
WP_018023049.1|192539_193523_-	hypothetical protein	NA	NA	NA	NA	NA
WP_018023048.1|193939_194107_-	toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_038573165.1|194166_194754_-	ParA family protein	NA	A0A222ZPB1	Mycobacterium_phage	40.4	2.6e-30
WP_155861408.1|194987_195563_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_020384704.1|195670_195838_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155861407.1|195888_196425_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038573166.1|197305_198016_-|transposase	IS6-like element ISCef5 family transposase	transposase	A0A077SL39	Escherichia_phage	59.8	6.2e-79
WP_038573168.1|198024_198255_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156111861.1|198253_199457_+|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	31.2	9.0e-30
>prophage 2
NZ_CP006764	Corynebacterium doosanense CAU 212 = DSM 45436 strain CAU 212(T) chromosome, complete genome	2671798	308665	371089	2671798	portal,capsid,head,holin,transposase,protease,tail,integrase	Corynebacterium_phage(62.5%)	76	331741:331789	369722:369770
WP_026159297.1|308665_309853_+|protease	MarP family serine protease	protease	NA	NA	NA	NA
WP_018021512.1|309849_310749_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_026159296.1|310819_311323_-|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_038573528.1|311470_312277_-	HAD-IB family hydrolase	NA	NA	NA	NA	NA
WP_018021509.1|312689_313778_+	hypothetical protein	NA	NA	NA	NA	NA
WP_018021508.1|313774_314914_+	TadA family conjugal transfer-associated ATPase	NA	NA	NA	NA	NA
WP_018021507.1|314910_315684_+	hypothetical protein	NA	NA	NA	NA	NA
WP_018021506.1|315680_316244_+	type II secretion system F family protein	NA	NA	NA	NA	NA
WP_018021505.1|316263_316452_+	DUF4244 domain-containing protein	NA	NA	NA	NA	NA
WP_018021504.1|316460_316763_+	hypothetical protein	NA	NA	NA	NA	NA
WP_018021503.1|316759_317083_+	flp pilus-assembly TadE/G-like family protein	NA	NA	NA	NA	NA
WP_026159295.1|317084_319436_-	DUF1998 domain-containing protein	NA	A0A1B1IUF6	uncultured_Mediterranean_phage	27.9	3.2e-07
WP_018021501.1|319688_319892_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	60.0	1.4e-15
WP_018021500.1|319939_320566_-	DedA family protein	NA	NA	NA	NA	NA
WP_018021499.1|320780_323741_+	type I DNA topoisomerase	NA	M1PXL0	Moumouvirus	33.5	4.0e-95
WP_018021497.1|325845_326454_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_018021496.1|326450_327107_+	hypothetical protein	NA	NA	NA	NA	NA
WP_018021495.1|327087_328131_-	hypothetical protein	NA	NA	NA	NA	NA
WP_018021494.1|328211_328724_-	hypothetical protein	NA	NA	NA	NA	NA
WP_018021493.1|328735_328879_-	hypothetical protein	NA	NA	NA	NA	NA
WP_018021492.1|328875_330402_-	adenylate/guanylate cyclase domain-containing protein	NA	A0A1B1IWY2	uncultured_Mediterranean_phage	32.3	1.0e-22
WP_051063999.1|330400_331651_+	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	29.5	3.0e-12
331741:331789	attL	CTCACTCGTAATGAGAAGGTCGCGAGTTCGATTCTCGCAGGCGGCTCCA	NA	NA	NA	NA
WP_155861313.1|332020_332569_+	ImmA/IrrE family metallo-endopeptidase	NA	Q854W5	Mycobacterium_virus	39.7	1.5e-16
WP_018021489.1|332561_332990_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081610323.1|333064_334582_-|integrase	site-specific integrase	integrase	A0A1W6JRD7	Corynebacterium_phage	59.6	1.8e-131
WP_018021486.1|335120_335498_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026159293.1|335599_335992_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_155861296.1|335966_336431_-	hypothetical protein	NA	NA	NA	NA	NA
WP_018021483.1|336587_336815_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_018021482.1|337021_337240_-	hypothetical protein	NA	NA	NA	NA	NA
WP_018021481.1|337346_337571_+	hypothetical protein	NA	NA	NA	NA	NA
WP_018021480.1|337634_337844_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_018021479.1|337840_338665_+	phage antirepressor KilAC domain-containing protein	NA	A0A2H4GSX0	Mycobacterium_phage	43.4	2.4e-50
WP_018021477.1|338803_339796_+	hypothetical protein	NA	NA	NA	NA	NA
WP_018021476.1|339792_340017_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155861295.1|340037_340262_+	hypothetical protein	NA	NA	NA	NA	NA
WP_018021474.1|340248_340548_+	hypothetical protein	NA	NA	NA	NA	NA
WP_018021473.1|340544_340883_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155861293.1|340938_341187_+	hypothetical protein	NA	NA	NA	NA	NA
WP_018021471.1|341183_341417_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156111864.1|341413_341608_+	hypothetical protein	NA	NA	NA	NA	NA
WP_018021470.1|341558_342383_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155861312.1|342436_342889_+	hypothetical protein	NA	A0A220NQT0	Corynebacterium_phage	41.3	2.5e-17
WP_018021468.1|342885_343206_+	hypothetical protein	NA	NA	NA	NA	NA
WP_018021467.1|343202_343430_+	hypothetical protein	NA	NA	NA	NA	NA
WP_018021466.1|343489_344701_+	hypothetical protein	NA	A0A220NQT1	Corynebacterium_phage	51.0	3.6e-71
WP_018021465.1|344700_345312_+	hypothetical protein	NA	A0A220NQT3	Corynebacterium_phage	40.8	1.7e-32
WP_026159292.1|345390_345678_+	HNH endonuclease	NA	A0A1W6JRD4	Corynebacterium_phage	50.5	3.1e-21
WP_018021463.1|345858_346209_+	hypothetical protein	NA	NA	NA	NA	NA
WP_018021462.1|346198_347824_+	hypothetical protein	NA	A0A1W6JRF6	Corynebacterium_phage	69.3	8.1e-167
WP_018021461.1|347837_349112_+|portal	phage portal protein	portal	A0A1W6JRE1	Corynebacterium_phage	61.6	2.8e-146
WP_018021460.1|349108_350248_+|head,protease	HK97 family phage prohead protease	head,protease	A0A1W6JRD9	Corynebacterium_phage	59.0	1.2e-100
WP_018021459.1|350240_351470_+|capsid	phage major capsid protein	capsid	A0A1W6JRF1	Corynebacterium_phage	57.0	4.2e-123
WP_018021458.1|351469_351649_+	hypothetical protein	NA	NA	NA	NA	NA
WP_018021457.1|351667_352180_+	hypothetical protein	NA	A0A1W6JRD8	Corynebacterium_phage	41.9	6.5e-30
WP_018021456.1|352176_352536_+	hypothetical protein	NA	A0A1W6JQB1	Corynebacterium_phage	53.4	2.3e-26
WP_018021455.1|352516_352792_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155861311.1|352836_353190_+	hypothetical protein	NA	A0A1W6JQC5	Corynebacterium_phage	56.4	3.6e-27
WP_026159290.1|353258_354161_+	putative Ig domain-containing protein	NA	A0A1W6JQC9	Corynebacterium_phage	46.0	4.9e-65
WP_018021453.1|354273_354642_+	hypothetical protein	NA	A0A1W6JQC1	Corynebacterium_phage	43.8	1.0e-21
WP_081610330.1|354668_354995_+	hypothetical protein	NA	A0A142KAG1	Gordonia_phage	41.3	1.3e-15
WP_018021451.1|355004_360482_+|tail	phage tail tape measure protein	tail	A0A1W6JQH4	Corynebacterium_phage	38.9	1.4e-154
WP_018021450.1|360504_361287_+	hypothetical protein	NA	Q9MBI8	Corynebacterium_phage	25.8	8.2e-08
WP_018021449.1|361290_362883_+	hypothetical protein	NA	A0A2H4PJ13	Corynebacterium_phage	39.7	7.1e-107
WP_018021448.1|362892_363432_+	hypothetical protein	NA	NA	NA	NA	NA
WP_018021447.1|363432_364179_+	hypothetical protein	NA	A0A1W6JQC3	Corynebacterium_phage	32.5	2.3e-20
WP_026159289.1|364191_365499_+	hypothetical protein	NA	A0A0M4RS02	Arthrobacter_phage	43.2	2.6e-06
WP_018021446.1|365560_366157_+	hypothetical protein	NA	A0A1W6JQE1	Corynebacterium_phage	38.3	3.3e-33
WP_018021445.1|366166_366466_+	hypothetical protein	NA	NA	NA	NA	NA
WP_018021444.1|366726_367593_+	N-acetylmuramoyl-L-alanine amidase	NA	D4P733	Rhodococcus_phage	35.4	2.9e-22
WP_018021443.1|367585_367813_+	hypothetical protein	NA	NA	NA	NA	NA
WP_018021442.1|367816_368290_+	hypothetical protein	NA	A0A220NQQ7	Corynebacterium_phage	32.0	1.8e-10
WP_155861292.1|368255_368636_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155861291.1|368772_369096_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155861290.1|369873_370305_+|transposase	transposase	transposase	A0A1B3AZF8	Gordonia_phage	49.5	3.0e-12
369722:369770	attR	CTCACTCGTAATGAGAAGGTCGCGAGTTCGATTCTCGCAGGCGGCTCCA	NA	NA	NA	NA
WP_162138661.1|370186_371089_+|transposase	IS3 family transposase	transposase	A0A1B3AZE5	Gordonia_phage	53.0	3.0e-78
