The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP004381	Burkholderia thailandensis E254 chromosome 1, complete sequence	3805980	66093	74810	3805980		Acanthocystis_turfacea_chlorella_virus(16.67%)	8	NA	NA
WP_009908916.1|66093_67005_+	alpha/beta hydrolase	NA	A7K906	Acanthocystis_turfacea_chlorella_virus	24.6	4.2e-11
WP_009889864.1|67340_68264_-	histone deacetylase family protein	NA	A0A2K9KZC4	Tupanvirus	36.2	3.2e-43
WP_009889862.1|68442_69684_+	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_009904404.1|69778_70681_-	cysteine synthase CysM	NA	A0A1X9I5F1	Streptococcus_phage	39.9	4.3e-53
WP_009889858.1|71015_71333_-	competence protein ComE	NA	NA	NA	NA	NA
WP_009908914.1|71404_72397_-	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	30.9	9.1e-28
WP_080511617.1|72454_73378_-	D-glycero-beta-D-manno-heptose-7-phosphate kinase	NA	A0A2H4N7X4	Lake_Baikal_phage	27.9	1.3e-15
WP_009908912.1|73409_74810_-	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	38.7	1.1e-79
>prophage 2
NZ_CP004381	Burkholderia thailandensis E254 chromosome 1, complete sequence	3805980	421168	430399	3805980		unidentified_phage(16.67%)	7	NA	NA
WP_009889266.1|421168_422713_+	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	31.2	3.3e-24
WP_009889265.1|422748_423276_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_009889263.1|423272_423956_+	deoxynucleoside kinase	NA	A0A249XZR7	Enterococcus_phage	26.0	3.3e-05
WP_009904054.1|424020_424836_+	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0N7HVJ8	Ostreococcus_lucimarinus_virus	32.9	3.3e-36
WP_038712436.1|425011_427021_-	bifunctional anthranilate synthase component I family protein/class IV aminotransferase	NA	S4VT78	Pandoravirus	35.2	1.7e-52
WP_009889258.1|427052_428183_-	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	38.0	1.8e-24
WP_009889255.1|428446_430399_-	molecular chaperone DnaK	NA	A0A1V0SH73	Hokovirus	49.5	1.2e-148
>prophage 3
NZ_CP004381	Burkholderia thailandensis E254 chromosome 1, complete sequence	3805980	694235	753216	3805980	tRNA,transposase,plate,protease	Pseudomonas_phage(33.33%)	47	NA	NA
WP_009888666.1|694235_695534_+|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_009909912.1|695602_696685_+	peptide chain release factor 1	NA	A0A0S4KWG0	Pseudomonas_phage	46.6	6.7e-08
WP_009888662.1|696710_697568_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_009888661.1|697647_697956_+	Grx4 family monothiol glutaredoxin	NA	NA	NA	NA	NA
WP_009888659.1|697969_698566_+	UbiX family flavin prenyltransferase	NA	NA	NA	NA	NA
WP_009888656.1|698821_699610_+	dioxygenase	NA	NA	NA	NA	NA
WP_009888654.1|699766_701368_-	APC family permease	NA	NA	NA	NA	NA
WP_004196837.1|701802_702006_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	73.1	6.3e-21
WP_009888639.1|702183_703446_-	Hsp70 family protein	NA	NA	NA	NA	NA
WP_009888637.1|703662_704268_-	nitroreductase family protein	NA	NA	NA	NA	NA
WP_009909916.1|704579_705863_-	MFS transporter	NA	NA	NA	NA	NA
WP_009888634.1|706021_706669_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_009888632.1|706989_707595_+	DUF1415 domain-containing protein	NA	NA	NA	NA	NA
WP_009888631.1|707655_708552_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_009888630.1|708683_709820_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_009888629.1|710509_711016_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043288838.1|711618_713769_+	peptidase M1	NA	A0A0P0IY26	Acinetobacter_phage	25.7	1.3e-47
WP_009888623.1|714812_715061_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009888621.1|715162_715384_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009888619.1|716034_717303_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_009888617.1|717317_719573_+	peptidase domain-containing ABC transporter	NA	A0A2R8FG22	Brazilian_cedratvirus	31.9	2.3e-10
WP_009888616.1|719569_721018_+	TolC family protein	NA	NA	NA	NA	NA
WP_009910677.1|721214_722180_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025369750.1|722305_723157_+	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_011402549.1|723442_727348_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_009888606.1|727344_728334_+	type VI secretion system-associated protein TagF	NA	NA	NA	NA	NA
WP_009888604.1|728338_729274_+	OmpA family protein	NA	NA	NA	NA	NA
WP_009888602.1|729473_730604_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_009910486.1|730689_733353_-	type VI secretion system ATPase TssH	NA	A0A223W0B1	Agrobacterium_phage	31.2	1.8e-91
WP_009888601.1|733386_734487_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_043296087.1|734450_736289_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_009888597.1|736369_736852_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_009906860.1|736909_737413_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_009888594.1|737485_738976_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_009888592.1|738992_739511_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_043036367.1|739547_740237_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_025404121.1|740610_741225_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_009888581.1|741333_742680_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_009888580.1|742676_743462_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_158338514.1|744095_744224_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_080755162.1|745796_746879_-	DUF4238 domain-containing protein	NA	NA	NA	NA	NA
WP_127462273.1|747195_747873_-	hypothetical protein	NA	NA	NA	NA	NA
WP_127462275.1|748321_749716_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080755163.1|749767_751237_-	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_080755210.1|751233_751467_-	hypothetical protein	NA	NA	NA	NA	NA
WP_127462277.1|751703_752453_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009909975.1|752703_753216_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	52.5	1.1e-21
>prophage 4
NZ_CP004381	Burkholderia thailandensis E254 chromosome 1, complete sequence	3805980	983242	1044564	3805980	integrase,tRNA,transposase,protease	uncultured_virus(28.57%)	44	983199:983258	1043150:1043217
983199:983258	attL	CAGGACGTGTCAGGAATTTCGTGTGCTGAGGCCGGTTAAAGGTCTCAGTTGATGGCGGAG	NA	NA	NA	NA
WP_102860126.1|983242_984442_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	42.7	9.2e-43
WP_080755165.1|984602_985430_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009893658.1|985797_986202_+	PaaI family thioesterase	NA	NA	NA	NA	NA
WP_009893657.1|986240_987110_+	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_009902110.1|987231_988248_-	D-2-hydroxyacid dehydrogenase family protein	NA	NA	NA	NA	NA
WP_009893648.1|988685_989741_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_009908309.1|989969_992579_-	DNA topoisomerase III	NA	A0A2P1ELA0	Moumouvirus	25.6	3.8e-17
WP_009893645.1|992788_993160_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_009893644.1|993220_994408_-	DNA-protecting protein DprA	NA	S6BFL3	Thermus_phage	39.8	4.7e-23
WP_009893641.1|994639_995143_+	peptide deformylase	NA	A0A067XQZ3	Caulobacter_phage	31.5	3.2e-13
WP_009908310.1|995174_996161_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	36.5	3.9e-07
WP_009893639.1|996281_996917_+	LysE family translocator	NA	NA	NA	NA	NA
WP_009893638.1|997025_997883_+|protease	zinc metalloprotease HtpX	protease	NA	NA	NA	NA
WP_043296126.1|998145_999414_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	42.7	9.8e-43
WP_025404143.1|999989_1001558_+	MFS transporter	NA	NA	NA	NA	NA
WP_011402635.1|1001977_1003498_-	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_009906651.1|1003803_1004832_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_025369704.1|1004932_1006000_-	ADP-heptose--LPS heptosyltransferase	NA	NA	NA	NA	NA
WP_009906653.1|1006032_1007736_-	thiamine pyrophosphate-binding protein	NA	NA	NA	NA	NA
WP_011402636.1|1007868_1009257_-	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_043296128.1|1009290_1010409_-	alginate lyase family protein	NA	NA	NA	NA	NA
WP_009910201.1|1010560_1013488_-	aminomethyl-transferring glycine dehydrogenase	NA	M4QFZ1	Prochlorococcus_phage	51.2	1.2e-258
WP_009906658.1|1013891_1014272_-	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_009906659.1|1014376_1015495_-	glycine cleavage system aminomethyltransferase GcvT	NA	NA	NA	NA	NA
WP_009906661.1|1016127_1016487_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009906662.1|1016656_1017709_-	oxidoreductase	NA	NA	NA	NA	NA
WP_009910205.1|1018169_1018901_-	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_025369702.1|1020072_1022160_+	UvrD-helicase domain-containing protein	NA	A7KV33	Bacillus_phage	35.8	9.9e-101
WP_011402642.1|1022440_1023343_-	cytochrome c5 family protein	NA	NA	NA	NA	NA
WP_043296130.1|1023835_1024843_+|integrase	site-specific integrase	integrase	A0A1L7DQ84	Ralstonia_phage	39.0	1.1e-49
WP_043296132.1|1025048_1026317_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	42.2	2.4e-41
WP_127462281.1|1026659_1027070_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043296135.1|1028928_1030455_+	site-specific DNA-methyltransferase	NA	A0A220NUF4	Escherichia_phage	37.5	2.2e-57
WP_043296137.1|1030463_1033160_+	DEAD/DEAH box helicase family protein	NA	NA	NA	NA	NA
WP_043296138.1|1033247_1033817_-	recombinase family protein	NA	E5FFF9	Burkholderia_phage	55.4	5.0e-47
WP_127462283.1|1033789_1034083_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043296139.1|1034558_1037111_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	27.3	9.8e-50
WP_043296140.1|1037121_1037928_+	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_043296142.1|1037958_1040535_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077190848.1|1041084_1041516_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043296147.1|1041512_1041797_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_043296150.1|1042332_1042686_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043296152.1|1042689_1043034_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043296157.1|1043274_1044564_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	43.9	1.3e-42
1043150:1043217	attR	CAGGACGTGTCAGGAATTTCGTGTGCTGAGGCCGGTTAAAGGTCTCAGTTGATGGCGGAGGTGAATCG	NA	NA	NA	NA
>prophage 5
NZ_CP004381	Burkholderia thailandensis E254 chromosome 1, complete sequence	3805980	1973553	1984435	3805980	protease	Streptococcus_phage(16.67%)	9	NA	NA
WP_009892620.1|1973553_1975668_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	26.8	1.2e-56
WP_011401863.1|1975931_1976447_-	DUF192 domain-containing protein	NA	A0A1B1IUW8	uncultured_Mediterranean_phage	41.2	1.5e-13
WP_080511442.1|1976642_1976858_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009892615.1|1977118_1977697_-	pseudouridine synthase	NA	NA	NA	NA	NA
WP_009892614.1|1977961_1979221_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	63.0	6.8e-12
WP_043296272.1|1979382_1980978_+	multicopper oxidase family protein	NA	NA	NA	NA	NA
WP_004196460.1|1981089_1981293_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	81.8	6.8e-23
WP_009892611.1|1981823_1982138_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A218MMY6	uncultured_virus	44.6	2.6e-13
WP_009892610.1|1982134_1984435_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	41.9	5.1e-167
>prophage 6
NZ_CP004381	Burkholderia thailandensis E254 chromosome 1, complete sequence	3805980	2147774	2156791	3805980	integrase	uncultured_Caudovirales_phage(28.57%)	11	2148662:2148679	2162470:2162487
WP_080511449.1|2147774_2148929_+	AAA family ATPase	NA	A0A0U4B0G9	Pseudomonas_phage	35.2	2.3e-59
2148662:2148679	attL	GTTCAGCGTCTGGTCGGC	NA	NA	NA	NA
WP_127446435.1|2149028_2149793_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009892409.1|2149796_2150177_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009892408.1|2150267_2150702_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009892406.1|2150776_2151379_+	hypothetical protein	NA	A0A2H4JID6	uncultured_Caudovirales_phage	50.0	3.1e-47
WP_009892405.1|2151382_2151949_+	hypothetical protein	NA	A0A1B1IRK9	uncultured_Mediterranean_phage	47.0	3.8e-31
WP_009892404.1|2151872_2153342_+	hypothetical protein	NA	A0A2H4J6H2	uncultured_Caudovirales_phage	46.7	8.2e-126
WP_009892399.1|2154253_2154526_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009892398.1|2154532_2154952_+	glycoside hydrolase family protein	NA	A0A1Q1PW74	Pseudoalteromonas_phage	45.5	1.4e-22
WP_043296291.1|2154948_2155443_+	DUF2514 family protein	NA	Q6J1Q4	Burkholderia_virus	56.7	2.6e-36
WP_043296293.1|2155594_2156791_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	45.6	3.6e-87
2162470:2162487	attR	GCCGACCAGACGCTGAAC	NA	NA	NA	NA
>prophage 7
NZ_CP004381	Burkholderia thailandensis E254 chromosome 1, complete sequence	3805980	2520713	2573360	3805980	terminase,transposase,capsid	Burkholderia_phage(58.49%)	73	NA	NA
WP_080755182.1|2520713_2521820_-	DNA cytosine methyltransferase	NA	Q6J1P4	Burkholderia_virus	57.1	1.1e-117
WP_043295268.1|2521870_2522869_-	RNA-directed DNA polymerase	NA	H7BVN7	unidentified_phage	33.9	3.2e-41
WP_043295266.1|2523212_2523569_-	four helix bundle protein	NA	NA	NA	NA	NA
WP_043296342.1|2523583_2524048_-	DUF1566 domain-containing protein	NA	NA	NA	NA	NA
WP_043296344.1|2524078_2524441_-	DUF1566 domain-containing protein	NA	NA	NA	NA	NA
WP_043295259.1|2524536_2525151_-	hypothetical protein	NA	A9YX18	Burkholderia_phage	100.0	1.3e-21
WP_043295257.1|2525147_2526914_-	AAA family ATPase	NA	H2BD46	Pseudomonas_phage	38.0	3.8e-77
WP_043296346.1|2526910_2527792_-	cell division protein FtsK	NA	J7I0T4	Pseudomonas_phage	32.5	4.9e-33
WP_043296349.1|2527822_2529022_-	hypothetical protein	NA	J7HXB6	Pseudomonas_phage	55.4	7.8e-66
WP_043296350.1|2529033_2529843_-	hypothetical protein	NA	J7HXJ4	Pseudomonas_phage	59.8	4.4e-89
WP_043296352.1|2529839_2530139_-	KTSC domain-containing protein	NA	A9YWW2	Burkholderia_phage	89.9	4.2e-45
WP_043296355.1|2530694_2530940_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043296357.1|2530936_2531287_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043296359.1|2531283_2531511_-	hypothetical protein	NA	A0A2H4JA69	uncultured_Caudovirales_phage	45.5	8.4e-06
WP_043296361.1|2531559_2531976_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043296363.1|2532009_2532390_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043296365.1|2533218_2533611_-	XRE family transcriptional regulator	NA	E5AGE6	Erwinia_phage	44.1	3.3e-05
WP_043296366.1|2534062_2534293_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043296368.1|2534459_2534834_+	hypothetical protein	NA	A9YWX9	Burkholderia_phage	91.9	4.0e-61
WP_043296609.1|2534836_2535055_+	hypothetical protein	NA	A9YWY0	Burkholderia_phage	87.5	1.1e-31
WP_127462313.1|2535081_2535600_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043296372.1|2535692_2536562_+	hypothetical protein	NA	A9YWY3	Burkholderia_phage	89.6	1.1e-146
WP_043296374.1|2536558_2537728_+	site-specific DNA-methyltransferase	NA	Q8W6P4	Burkholderia_virus	64.9	2.8e-137
WP_043296376.1|2537727_2538699_+	phosphoadenosine phosphosulfate reductase family protein	NA	Q8W6P3	Burkholderia_virus	76.4	8.0e-146
WP_043296611.1|2539370_2539805_+	hypothetical protein	NA	NA	NA	NA	NA
WP_102822915.1|2539801_2540050_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158338967.1|2540046_2540220_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043295224.1|2540216_2540687_+	RusA family crossover junction endodeoxyribonuclease	NA	A9YWY9	Burkholderia_phage	87.8	3.7e-72
WP_043295222.1|2540696_2541026_+	hypothetical protein	NA	A9YWZ0	Burkholderia_phage	71.1	1.9e-30
WP_052116546.1|2541022_2541682_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043296378.1|2541811_2542471_+	hypothetical protein	NA	A9YWZ4	Burkholderia_phage	75.6	1.2e-97
WP_077056326.1|2542440_2542992_+	hypothetical protein	NA	A0A0N9BAQ5	Vibrio_phage	38.6	4.1e-22
WP_043295219.1|2543026_2543506_+	DUF2280 domain-containing protein	NA	A9YWZ5	Burkholderia_phage	76.3	4.2e-55
WP_043295217.1|2543456_2545010_+|terminase	phage terminase large subunit	terminase	H9C0C7	Vibrio_phage	44.5	3.9e-110
WP_043296380.1|2545030_2546497_+	DUF1073 domain-containing protein	NA	A9YWZ7	Burkholderia_phage	95.8	1.3e-267
WP_043296381.1|2546493_2547249_+|capsid	minor capsid protein	capsid	A9YWZ8	Burkholderia_phage	97.2	2.7e-133
WP_043296383.1|2547329_2547851_+	hypothetical protein	NA	A9YX01	Burkholderia_phage	96.0	5.2e-91
WP_043296385.1|2547996_2549445_+	DUF2213 domain-containing protein	NA	A9YX03	Burkholderia_phage	93.8	2.5e-220
WP_043296387.1|2549454_2549961_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043296389.1|2550031_2551123_+	DUF2184 domain-containing protein	NA	A9YX23	Burkholderia_phage	98.7	7.6e-161
WP_043296391.1|2551124_2551592_+	hypothetical protein	NA	A9YX24	Burkholderia_phage	98.2	6.4e-24
WP_009927900.1|2551655_2552039_+	DUF4054 domain-containing protein	NA	A9YX25	Burkholderia_phage	100.0	9.4e-66
WP_043296393.1|2552067_2552547_+	hypothetical protein	NA	A9YX26	Burkholderia_phage	94.3	8.7e-77
WP_043296395.1|2552608_2552980_+	hypothetical protein	NA	A9YX28	Burkholderia_phage	88.6	5.7e-60
WP_043295200.1|2552984_2553575_+	hypothetical protein	NA	A9YX29	Burkholderia_phage	92.9	1.6e-101
WP_043295198.1|2553584_2555060_+	DUF3383 domain-containing protein	NA	A0A0P0I492	Acinetobacter_phage	48.1	1.8e-112
WP_043295196.1|2555075_2555516_+	DUF3277 family protein	NA	A0A0P0IKY2	Acinetobacter_phage	57.5	1.9e-41
WP_051392327.1|2555512_2556061_-	hypothetical protein	NA	G0ZNE5	Cronobacter_phage	36.8	4.7e-18
WP_043296612.1|2556138_2556696_+	hypothetical protein	NA	A0A0N7IRF3	Acinetobacter_phage	33.7	4.8e-18
WP_043296396.1|2556879_2559006_+	mannosyl-glycoprotein endo-beta-N-acetylglucosamidase	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	37.8	2.1e-42
WP_043296397.1|2559002_2559578_+	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	36.3	2.0e-19
WP_043296398.1|2559577_2559892_+	bacteriophage protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	43.4	1.6e-15
WP_127462315.1|2559954_2560719_+	hypothetical protein	NA	NA	NA	NA	NA
WP_102822916.1|2560747_2561116_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043296403.1|2561157_2562126_+	hypothetical protein	NA	A9YX04	Burkholderia_phage	94.5	3.2e-155
WP_043296405.1|2562122_2562500_-	hypothetical protein	NA	A9YX05	Burkholderia_phage	90.4	2.0e-60
WP_038782783.1|2562503_2563253_+	phage protein	NA	A9YX06	Burkholderia_phage	92.0	3.9e-124
WP_043296407.1|2563315_2563615_-	HigA family addiction module antidote protein	NA	M9MUN2	Rhodococcus_phage	58.3	8.8e-19
WP_043296409.1|2563632_2563911_-	excinuclease ABC subunit A	NA	A0A222YWE2	Escherichia_phage	46.4	7.2e-07
WP_038782788.1|2563972_2564326_+	hypothetical protein	NA	A9YX11	Burkholderia_phage	95.7	9.6e-57
WP_043296410.1|2564322_2565504_+	bacteriophage protein	NA	A9YX12	Burkholderia_phage	88.8	2.3e-187
WP_043296412.1|2565503_2566166_+	DUF2612 domain-containing protein	NA	A9YX13	Burkholderia_phage	90.0	2.9e-115
WP_011400919.1|2566215_2567436_-|transposase	ISL3 family transposase	transposase	A9YX10	Burkholderia_phage	99.0	3.0e-238
WP_043296613.1|2568255_2568960_+	hypothetical protein	NA	A9YX14	Burkholderia_phage	91.9	5.3e-107
WP_076854992.1|2568969_2569152_+	hypothetical protein	NA	A9YX15	Burkholderia_phage	80.0	5.7e-21
WP_158338970.1|2569096_2570200_-	acyltransferase family protein	NA	A9YX16	Burkholderia_phage	87.4	1.3e-176
WP_043296415.1|2570234_2570834_-	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_043296417.1|2570974_2571259_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043296421.1|2571437_2571620_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043296423.1|2571612_2572110_+	lysozyme	NA	Q3HQU9	Burkholderia_phage	92.1	1.1e-82
WP_043296425.1|2572106_2572652_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043296427.1|2572648_2573125_+	DUF2514 family protein	NA	Q6J1Q4	Burkholderia_virus	75.5	6.7e-53
WP_043296429.1|2573159_2573360_+	hypothetical protein	NA	Q3HQV3	Burkholderia_phage	80.0	6.9e-28
>prophage 8
NZ_CP004381	Burkholderia thailandensis E254 chromosome 1, complete sequence	3805980	2621546	2672577	3805980	integrase,transposase,plate,coat	Burkholderia_virus(50.0%)	34	2605146:2605164	2664716:2664734
2605146:2605164	attL	GAGCTCGACGCTGACCGGC	NA	NA	NA	NA
WP_009891805.1|2621546_2622986_-|integrase	integrase family protein	integrase	NA	NA	NA	NA
WP_043296443.1|2624029_2624935_+	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	74.7	8.3e-129
WP_009891801.1|2625067_2626354_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	71.8	2.3e-172
WP_009891799.1|2626670_2627006_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_025369440.1|2627309_2628788_-	PHB depolymerase family esterase	NA	NA	NA	NA	NA
WP_009910381.1|2629548_2629767_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009910382.1|2631259_2633110_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_009891792.1|2633138_2634566_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009891791.1|2634589_2634856_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_025369438.1|2635381_2638180_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	24.1	1.5e-27
WP_009891787.1|2638182_2639016_+	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_038713115.1|2639152_2639710_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_011402458.1|2639706_2640306_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_043296444.1|2640302_2642732_+	DUF2235 domain-containing protein	NA	NA	NA	NA	NA
WP_043296618.1|2642859_2643417_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_011402455.1|2643413_2644013_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_080750995.1|2644009_2646412_+	DUF2235 domain-containing protein	NA	NA	NA	NA	NA
WP_009891777.1|2646520_2649856_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_009891776.1|2650807_2651140_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011402452.1|2651157_2651463_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043296445.1|2651475_2654310_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	24.1	2.6e-27
WP_009909762.1|2654311_2655187_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043296446.1|2655183_2658030_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059738327.1|2658152_2659046_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004543837.1|2660970_2661279_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_080755192.1|2661596_2661767_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_009891744.1|2663753_2665067_+	divalent metal cation transporter	NA	NA	NA	NA	NA
2664716:2664734	attR	GAGCTCGACGCTGACCGGC	NA	NA	NA	NA
WP_009891742.1|2665816_2666080_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009891740.1|2666279_2666561_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_009909753.1|2667046_2667973_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_011402450.1|2668017_2669307_-	MFS transporter	NA	NA	NA	NA	NA
WP_009891734.1|2669722_2670616_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_025369429.1|2671418_2671964_+|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_009891732.1|2672016_2672577_+|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
>prophage 1
NZ_CP004382	Burkholderia thailandensis E254 chromosome 2, complete sequence	2870750	174438	286656	2870750	holin,terminase,tail,plate,capsid,lysis,protease,head,portal,transposase	Burkholderia_virus(55.56%)	113	NA	NA
WP_009891862.1|174438_175698_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.4	1.5e-43
WP_043297026.1|176011_176158_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004543837.1|176154_176463_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_043297028.1|177004_177547_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041223775.1|178072_179092_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	34.6	3.6e-19
WP_009897157.1|179093_179825_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_009897156.1|179917_180802_-	FkbM family methyltransferase	NA	Q58M88	Prochlorococcus_phage	26.8	6.7e-06
WP_025370294.1|180962_182465_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_009897154.1|182906_184763_-	chloride channel protein	NA	NA	NA	NA	NA
WP_009897153.1|184796_185210_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_009897152.1|185341_186520_-	HPP family protein	NA	NA	NA	NA	NA
WP_009897150.1|186865_187834_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_009900276.1|187948_189037_-	ionic transporter y4hA	NA	NA	NA	NA	NA
WP_043296735.1|189305_190631_+	phenylacetate--CoA ligase	NA	NA	NA	NA	NA
WP_009897143.1|190722_191394_+	NAAT family transporter	NA	NA	NA	NA	NA
WP_009907695.1|191661_192534_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_043296737.1|192934_193639_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_080755226.1|193802_194822_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_009897131.1|195591_196113_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_043296741.1|196109_196925_+	anti-sigma factor	NA	NA	NA	NA	NA
WP_043296743.1|196968_197784_+	YceI family protein	NA	NA	NA	NA	NA
WP_009897126.1|197823_198183_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009897125.1|198367_198877_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_009897122.1|198873_199878_+	DUF4880 domain-containing protein	NA	NA	NA	NA	NA
WP_043296744.1|200002_202588_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_127462218.1|202604_202871_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154660030.1|202914_203145_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009897119.1|203160_203853_+	isoprenylcysteine carboxylmethyltransferase family protein	NA	NA	NA	NA	NA
WP_009897117.1|203964_205224_-	monooxygenase	NA	NA	NA	NA	NA
WP_009907682.1|205701_205965_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009897113.1|206042_206336_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009897112.1|206666_206939_+	DUF4148 domain-containing protein	NA	NA	NA	NA	NA
WP_009897110.1|207030_208425_-	heavy metal sensor histidine kinase IrlS	NA	W8CYF6	Bacillus_phage	28.0	8.9e-21
WP_009897108.1|208421_209111_-	heavy metal response regulator transcription factor IrlR	NA	W8CYM9	Bacillus_phage	36.8	6.3e-36
WP_009897107.1|209117_212351_-	CusA/CzcA family heavy metal efflux RND transporter	NA	NA	NA	NA	NA
WP_009897106.1|212416_213871_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_025370289.1|213881_215258_-	TolC family protein	NA	NA	NA	NA	NA
WP_019255747.1|215528_215810_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162482703.1|216144_216378_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038707731.1|216762_217248_-	membrane protein	NA	NA	NA	NA	NA
WP_043037497.1|217507_217666_+	pyridoxal-phosphate dependent enzyme	NA	NA	NA	NA	NA
WP_009897098.1|217895_218381_+	YbaK/EbsC family protein	NA	NA	NA	NA	NA
WP_009897097.1|218518_218857_-	helix-turn-helix domain-containing protein	NA	A4JWW9	Burkholderia_virus	100.0	5.4e-57
WP_004532752.1|219237_220020_+	hypothetical protein	NA	A4JWW8	Burkholderia_virus	100.0	6.7e-143
WP_009897093.1|220335_220557_+	hypothetical protein	NA	A4JWW6	Burkholderia_virus	100.0	1.6e-38
WP_025404186.1|221047_222034_+	phosphoadenosine phosphosulfate reductase family protein	NA	Q8W6P3	Burkholderia_virus	77.0	3.4e-144
WP_080755228.1|221850_223458_+	DNA cytosine methyltransferase	NA	Q6V7R9	Burkholderia_virus	38.1	5.2e-65
WP_009897085.1|223457_225251_+	replication endonuclease	NA	A4JWW0	Burkholderia_virus	99.3	0.0e+00
WP_009971787.1|225266_225533_+	ogr/Delta-like zinc finger family protein	NA	A4JWV9	Burkholderia_virus	100.0	3.1e-44
WP_004532731.1|225529_225736_+	ogr/Delta-like zinc finger family protein	NA	A4JWV8	Burkholderia_virus	100.0	8.7e-34
WP_038778436.1|225825_226479_+	AAA family ATPase	NA	A4JWV7	Burkholderia_virus	100.0	4.2e-114
WP_009897078.1|226712_226835_+	CopG family transcriptional regulator	NA	A4JWV6	Burkholderia_virus	100.0	5.9e-14
WP_009897076.1|226937_227471_+	bacteriophage gp29 protein	NA	A4JWV5	Burkholderia_virus	99.4	2.4e-96
WP_043296749.1|227467_228205_+	VRR-NUC domain-containing protein	NA	A4JWV4	Burkholderia_virus	99.2	2.9e-132
WP_006027262.1|229924_230221_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A4JWV2	Burkholderia_virus	99.0	5.6e-50
WP_004202809.1|230223_230580_+	putative addiction module antidote protein	NA	A4JWV1	Burkholderia_virus	100.0	3.9e-42
WP_023359646.1|230623_231679_-|portal	phage portal protein	portal	A4JWV0	Burkholderia_virus	99.4	3.4e-206
WP_043297030.1|231675_233445_-|terminase	terminase ATPase subunit family protein	terminase	A4JWQ1	Burkholderia_virus	99.7	0.0e+00
WP_015985028.1|233588_234398_+|capsid	GPO family capsid scaffolding protein	capsid	A4JWQ0	Burkholderia_virus	100.0	1.3e-144
WP_038729266.1|234431_235445_+|capsid	phage major capsid protein, P2 family	capsid	K4NZP8	Burkholderia_phage	99.7	1.6e-189
WP_043296752.1|235441_236131_+|terminase	terminase endonuclease subunit	terminase	A4JWP8	Burkholderia_virus	99.1	1.9e-117
WP_009909356.1|236230_236710_+|head	head completion/stabilization protein	head	A4JWU5	Burkholderia_virus	100.0	5.8e-81
WP_043296753.1|236709_236961_+	hypothetical protein	NA	A4JWU4	Burkholderia_virus	98.8	8.4e-39
WP_043296755.1|236957_237164_+|tail	tail protein	tail	K4PAW7	Burkholderia_phage	98.5	6.9e-31
WP_004524439.1|237178_237523_+	membrane protein	NA	K4NZQ3	Burkholderia_phage	100.0	2.9e-50
WP_004524440.1|237524_237797_+|holin	phage holin family protein	holin	K4NX91	Burkholderia_phage	100.0	8.8e-42
WP_043296757.1|237793_238606_+	DUF3380 domain-containing protein	NA	A4JWZ0	Burkholderia_virus	96.7	1.5e-145
WP_043296759.1|238602_239043_+|lysis	LysB family phage lysis regulatory protein	lysis	K4NXJ2	Burkholderia_phage	95.2	4.0e-68
WP_043296761.1|239147_239564_+|tail	phage tail protein	tail	A4JWT7	Burkholderia_virus	99.3	1.6e-71
WP_043296764.1|239560_240028_+	phage virion morphogenesis protein	NA	K4NZQ8	Burkholderia_phage	99.4	3.4e-78
WP_009897040.1|240154_240685_+	hypothetical protein	NA	K4NX96	Burkholderia_phage	100.0	3.0e-94
WP_043296767.1|240850_241627_-	site-specific DNA-methyltransferase	NA	K4NZW3	Burkholderia_phage	98.8	1.2e-147
WP_043296769.1|241800_242481_+|plate	phage baseplate assembly protein V	plate	K4NXJ5	Burkholderia_phage	96.9	2.0e-119
WP_043296771.1|242477_242840_+|plate	baseplate assembly protein	plate	K4PAX6	Burkholderia_phage	93.3	4.0e-58
WP_043296773.1|242836_243742_+|plate	baseplate assembly protein	plate	K4NZR5	Burkholderia_phage	95.3	1.5e-157
WP_009897027.1|243734_244289_+|tail	phage tail protein I	tail	A4JWT0	Burkholderia_virus	100.0	3.8e-100
WP_043296775.1|244299_246663_+	phage Tail collar domain protein	NA	A4JWY0	Burkholderia_virus	98.3	0.0e+00
WP_043296777.1|246679_247351_+|tail	caudovirales tail fiber assembly protein	tail	A4JWS8	Burkholderia_virus	98.7	1.7e-115
WP_043296779.1|247406_248579_+|tail	phage tail sheath protein	tail	A4JWS7	Burkholderia_virus	99.0	8.3e-222
WP_009897021.1|248594_249104_+|tail	phage major tail tube protein	tail	K4NZR9	Burkholderia_phage	95.3	1.5e-90
WP_015985038.1|249161_249506_+|tail	phage tail assembly protein	tail	A4JWS5	Burkholderia_virus	100.0	7.9e-56
WP_004552648.1|249514_249628_+|tail	GpE family phage tail protein	tail	A0A089FGX3	Burkholderia_phage	100.0	5.4e-14
WP_004534375.1|249630_252591_+	hypothetical protein	NA	A4JWS3	Burkholderia_virus	100.0	0.0e+00
WP_009914999.1|252608_253034_+|tail	phage tail protein	tail	A4JWS2	Burkholderia_virus	100.0	3.3e-72
WP_043296782.1|253033_254134_+	phage late control D family protein	NA	A4JWS1	Burkholderia_virus	99.2	1.2e-201
WP_009897004.1|255106_255436_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_009897002.1|255449_255965_-	ProQ/FinO family protein	NA	NA	NA	NA	NA
WP_154660029.1|256169_256562_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009897000.1|256551_257316_+	2-keto-4-pentenoate hydratase	NA	NA	NA	NA	NA
WP_009896998.1|257630_258206_+	DUF2760 domain-containing protein	NA	NA	NA	NA	NA
WP_009896996.1|258202_260050_+	Hsp70 family protein	NA	NA	NA	NA	NA
WP_009896994.1|260053_262849_+	hsp70 family protein	NA	A0A2H4UU19	Bodo_saltans_virus	25.8	5.0e-07
WP_009896992.1|262964_264098_-	CapA family protein	NA	S4VS02	Pandoravirus	55.9	4.2e-114
WP_009896990.1|264206_264641_-	GYD domain-containing protein	NA	NA	NA	NA	NA
WP_009896988.1|264637_265342_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009896982.1|265472_265733_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043037490.1|265790_267224_-	RtcB family protein	NA	A2RQD0	Archaeal_BJ1_virus	44.8	5.0e-104
WP_009896978.1|267237_267657_-	archease	NA	NA	NA	NA	NA
WP_009896976.1|267808_269179_+	DUF3326 domain-containing protein	NA	NA	NA	NA	NA
WP_043296784.1|269419_271834_+	HAD-IC family P-type ATPase	NA	NA	NA	NA	NA
WP_009896973.1|271989_272613_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025370286.1|272664_275178_-	cation-translocating P-type ATPase	NA	M1I547	Acanthocystis_turfacea_Chlorella_virus	29.3	3.3e-58
WP_009896969.1|275236_275716_-	carboxypeptidase regulatory-like domain-containing protein	NA	NA	NA	NA	NA
WP_009907668.1|276571_277381_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_025370285.1|277461_278892_-	thiamine pyridinylase	NA	NA	NA	NA	NA
WP_009907667.1|278969_279770_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_009896959.1|279971_280712_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_009896957.1|280727_281717_-	thymidylate synthase	NA	NA	NA	NA	NA
WP_009896955.1|281718_282174_-	nucleoside 2-deoxyribosyltransferase	NA	NA	NA	NA	NA
WP_009896951.1|282170_282662_-	NUDIX hydrolase	NA	A0A0E3JJF3	Streptomyces_phage	42.1	1.7e-14
WP_043296786.1|283364_283706_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009896948.1|283955_284561_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_009896945.1|284667_286656_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	E5EQU5	Bathycoccus_sp._RCC1105_virus	42.9	1.1e-104
>prophage 2
NZ_CP004382	Burkholderia thailandensis E254 chromosome 2, complete sequence	2870750	1133937	1200592	2870750	holin,plate	Aeromonas_phage(25.0%)	47	NA	NA
WP_009907965.1|1133937_1134888_-|holin	choline ABC transporter substrate-binding protein	holin	NA	NA	NA	NA
WP_009907967.1|1135155_1136100_+	GlxA family transcriptional regulator	NA	NA	NA	NA	NA
WP_043037783.1|1136573_1138277_+	peptidase	NA	NA	NA	NA	NA
WP_009907968.1|1138395_1139622_+	M20/M25/M40 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_009907969.1|1139680_1140823_-	porin	NA	NA	NA	NA	NA
WP_025369918.1|1141050_1142088_-|holin	choline ABC transporter substrate-binding protein	holin	NA	NA	NA	NA
WP_009907971.1|1142084_1143638_-|holin	choline-sulfatase	holin	NA	NA	NA	NA
WP_009898036.1|1143800_1144673_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_009898038.1|1144816_1145692_+	formyltetrahydrofolate deformylase	NA	NA	NA	NA	NA
WP_009898039.1|1145778_1147434_-	APC family permease	NA	NA	NA	NA	NA
WP_009898041.1|1147613_1148477_-	glycine betaine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_043037781.1|1148586_1149726_-	hybrid-cluster NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_009898044.1|1149746_1150988_-	aromatic ring-hydroxylating dioxygenase subunit alpha	NA	NA	NA	NA	NA
WP_009898046.1|1151039_1151825_-	drug:proton antiporter	NA	NA	NA	NA	NA
WP_009907972.1|1151821_1153003_-	electron transfer flavoprotein subunit alpha/FixB family protein	NA	NA	NA	NA	NA
WP_009898050.1|1153007_1154933_-	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_009898052.1|1154935_1156999_-	NADH:flavin oxidoreductase	NA	NA	NA	NA	NA
WP_041223509.1|1157059_1157593_-	4-vinyl reductase	NA	NA	NA	NA	NA
WP_009898055.1|1157740_1158712_-	membrane dipeptidase	NA	NA	NA	NA	NA
WP_009898057.1|1158783_1160058_-	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	53.4	6.9e-105
WP_009898058.1|1160466_1161492_+	GlxA family transcriptional regulator	NA	NA	NA	NA	NA
WP_009898059.1|1161677_1162877_-	formaldehyde dehydrogenase, glutathione-independent	NA	A0A2K9L7I1	Tupanvirus	26.8	1.1e-11
WP_009900983.1|1163222_1164239_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_025404203.1|1164512_1165997_+	glycoside hydrolase 68 family protein	NA	NA	NA	NA	NA
WP_011401416.1|1166115_1167789_+	glycoside hydrolase family 32 protein	NA	F8WPR5	Bacillus_phage	31.0	3.0e-55
WP_043037916.1|1168240_1169509_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_025404178.1|1169703_1171266_-	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_009896566.1|1171318_1172284_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_009896564.1|1172416_1173988_-	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_041223615.1|1173984_1175253_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_009896560.1|1175532_1176432_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_009907980.1|1177004_1177280_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011401419.1|1177596_1178022_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009893756.1|1178044_1178404_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009893757.1|1178462_1181957_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_009893758.1|1181953_1183681_-	OmpA family protein	NA	NA	NA	NA	NA
WP_009893759.1|1183763_1185125_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_009893760.1|1185121_1185715_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009893761.1|1185720_1186110_-	DUF4150 domain-containing protein	NA	NA	NA	NA	NA
WP_009893763.1|1186149_1186866_-	DUF3540 domain-containing protein	NA	NA	NA	NA	NA
WP_009893765.1|1186868_1187939_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_009893766.1|1187938_1190155_-	DUF2169 domain-containing protein	NA	NA	NA	NA	NA
WP_025369925.1|1190158_1192447_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_011401423.1|1192615_1194907_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_009893771.1|1194897_1197741_-	type VI secretion system ATPase TssH	NA	A0A2I7REQ1	Vibrio_phage	27.0	1.2e-61
WP_009893772.1|1197743_1198733_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_043296853.1|1198729_1200592_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
>prophage 3
NZ_CP004382	Burkholderia thailandensis E254 chromosome 2, complete sequence	2870750	1338706	1344772	2870750	integrase	Burkholderia_virus(28.57%)	8	1333566:1333581	1353927:1353942
1333566:1333581	attL	ATTCGGACGAGGCGGA	NA	NA	NA	NA
WP_009893915.1|1338706_1339279_+|integrase	site-specific integrase	integrase	A0A1W6JTA0	Pseudomonas_phage	65.9	1.7e-55
WP_011401460.1|1339897_1340395_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011401461.1|1340823_1341240_-	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0A8JBA5	Ralstonia_phage	58.9	1.2e-26
WP_009893919.1|1341283_1341463_-	type II toxin-antitoxin system HicA family toxin	NA	A0A0D4DC32	Acinetobacter_phage	74.6	1.2e-18
WP_011401462.1|1341742_1342270_+	hypothetical protein	NA	A4JWV5	Burkholderia_virus	66.1	6.2e-60
WP_011401463.1|1342266_1343001_+	VRR-NUC domain-containing protein	NA	A4JWV4	Burkholderia_virus	50.9	3.0e-52
WP_009893924.1|1343010_1344126_+	DUF3396 domain-containing protein	NA	E5E3X7	Burkholderia_phage	80.4	8.6e-176
WP_009893925.1|1344196_1344772_-	recombinase family protein	NA	A0A219Y9V9	Aeromonas_phage	39.0	2.3e-23
1353927:1353942	attR	ATTCGGACGAGGCGGA	NA	NA	NA	NA
>prophage 4
NZ_CP004382	Burkholderia thailandensis E254 chromosome 2, complete sequence	2870750	1898000	1975709	2870750	holin,plate,transposase	Ralstonia_phage(33.33%)	58	NA	NA
WP_009894648.1|1898000_1900196_+|holin	phospholipase C, phosphocholine-specific	holin	NA	NA	NA	NA
WP_009894655.1|1901910_1902927_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_009894657.1|1902945_1903398_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_009894659.1|1903933_1904779_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_009907076.1|1904765_1905620_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_009894662.1|1905616_1906648_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_009894663.1|1907196_1908267_-|transposase	IS5 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	43.4	3.6e-62
WP_009894664.1|1908426_1908732_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_011400785.1|1909053_1911834_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	34.2	1.8e-89
WP_025370043.1|1911847_1914088_+	DUF3274 domain-containing protein	NA	A0A077K801	Ralstonia_phage	28.9	4.0e-23
WP_011400791.1|1914226_1915762_+	DUF2875 family protein	NA	NA	NA	NA	NA
WP_025370045.1|1915771_1916035_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_162482707.1|1916945_1918361_+	DUF3274 domain-containing protein	NA	NA	NA	NA	NA
WP_025404154.1|1918379_1920038_+	DUF2875 family protein	NA	NA	NA	NA	NA
WP_043295640.1|1920047_1920311_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_004523721.1|1920725_1921145_-	YjbQ family protein	NA	NA	NA	NA	NA
WP_009894689.1|1921164_1921491_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_004523719.1|1921962_1922655_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009894695.1|1923464_1923821_-	DUF4148 domain-containing protein	NA	NA	NA	NA	NA
WP_041223675.1|1924295_1925438_-	porin	NA	NA	NA	NA	NA
WP_009907082.1|1926108_1927032_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_009894700.1|1927593_1927917_-	hypothetical protein	NA	NA	NA	NA	NA
WP_127446348.1|1928105_1928417_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009894702.1|1928544_1928790_-	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_009894703.1|1928922_1930122_-	transcriptional regulator CynR	NA	NA	NA	NA	NA
WP_009894704.1|1930121_1931555_-	TolC family protein	NA	NA	NA	NA	NA
WP_009894706.1|1931548_1932448_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_009894707.1|1932449_1932674_-	DUF1656 domain-containing protein	NA	NA	NA	NA	NA
WP_038707668.1|1932670_1934737_-	FUSC family protein	NA	NA	NA	NA	NA
WP_025370055.1|1935745_1937287_-	membrane protein	NA	NA	NA	NA	NA
WP_154660021.1|1937634_1937991_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043296920.1|1938835_1940983_+	hypothetical protein	NA	K4F7R4	Cronobacter_phage	46.1	7.8e-08
WP_025370057.1|1941058_1942510_-	PhoPQ-regulated protein	NA	NA	NA	NA	NA
WP_009907087.1|1942760_1943159_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011400800.1|1943940_1944495_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_011400801.1|1944576_1945302_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_162465482.1|1945350_1945509_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009894721.1|1945461_1948158_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_009894722.1|1948177_1948723_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_009907089.1|1948753_1949443_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_009894727.1|1949445_1951122_+	OmpA family protein	NA	NA	NA	NA	NA
WP_009894728.1|1951465_1952005_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_009894729.1|1952038_1953538_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_009894730.1|1953738_1954221_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_011400803.1|1954348_1954891_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_009894732.1|1954896_1956246_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_009894733.1|1956242_1957544_+	type VI secretion system protein TssL	NA	NA	NA	NA	NA
WP_009894736.1|1957558_1961467_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_009894738.1|1961636_1962206_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043296922.1|1962306_1964997_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	26.0	1.9e-35
WP_004523693.1|1965071_1965341_+	PAAR motif protein	NA	NA	NA	NA	NA
WP_043296924.1|1965353_1968806_+	RHS repeat protein	NA	NA	NA	NA	NA
WP_038707671.1|1968698_1970057_-	hypothetical protein	NA	A0A292GJ55	Xanthomonas_phage	49.7	2.6e-110
WP_043296925.1|1970089_1971118_-	fimbrial protein	NA	NA	NA	NA	NA
WP_009894751.1|1971173_1972244_-	type VI secretion protein ImpA	NA	NA	NA	NA	NA
WP_009894753.1|1972262_1973312_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_009894755.1|1973308_1975189_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_009894757.1|1975190_1975709_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
