The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP007781	Burkholderia cenocepacia strain DWS 37E-2 chromosome 1, complete sequence	3241886	1254373	1286457	3241886	integrase,plate,protease	Pseudomonas_phage(20.0%)	29	1247877:1247895	1299954:1299972
1247877:1247895	attL	CGTGATCGCGCTGCCGATC	NA	NA	NA	NA
WP_040143153.1|1254373_1254895_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	52.0	9.6e-21
WP_040143155.1|1255164_1256382_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	44.1	4.2e-91
WP_040143157.1|1256689_1257376_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004556769.1|1261145_1261472_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040143159.1|1261482_1261830_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040143161.1|1261822_1262035_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040143162.1|1262027_1262330_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040143164.1|1262826_1263351_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009964270.1|1263347_1263539_-	AlpA family phage regulatory protein	NA	A0A2L0V109	Agrobacterium_phage	47.2	1.4e-06
WP_144245421.1|1264040_1266938_-	DEAD/DEAH box helicase	NA	A0A2H4UVG1	Bodo_saltans_virus	24.9	1.7e-10
WP_040143168.1|1267264_1267840_+	recombinase family protein	NA	A0A219Y912	Aeromonas_phage	40.7	1.0e-23
WP_080294557.1|1267944_1268442_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040143169.1|1269135_1270131_-	NAD(P)H-quinone oxidoreductase	NA	NA	NA	NA	NA
WP_040143172.1|1270127_1270505_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_040143174.1|1270517_1271954_-	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_040143175.1|1272330_1273266_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_040143177.1|1273647_1273851_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040143179.1|1273963_1274764_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_040143182.1|1276044_1276350_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040143183.1|1276435_1277218_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_040143187.1|1277214_1278561_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_040143189.1|1278664_1279276_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_040143192.1|1279651_1280287_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_040143193.1|1280336_1280852_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_040143195.1|1280867_1282358_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_040143197.1|1282428_1282932_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_040143199.1|1282994_1283480_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_040143201.1|1283557_1285393_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_040143203.1|1285356_1286457_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
1299954:1299972	attR	CGTGATCGCGCTGCCGATC	NA	NA	NA	NA
>prophage 2
NZ_CP007781	Burkholderia cenocepacia strain DWS 37E-2 chromosome 1, complete sequence	3241886	1571380	1580672	3241886		Hokovirus(16.67%)	7	NA	NA
WP_040143476.1|1571380_1573333_+	molecular chaperone DnaK	NA	A0A1V0SH73	Hokovirus	49.9	7.0e-149
WP_040143477.1|1573586_1574723_+	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	39.5	7.0e-24
WP_040143478.1|1574730_1576689_+	bifunctional anthranilate synthase component I family protein/class IV aminotransferase	NA	S4VT78	Pandoravirus	36.2	1.4e-59
WP_040143479.1|1577015_1577831_-	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0N7HVJ8	Ostreococcus_lucimarinus_virus	33.7	1.1e-36
WP_040143480.1|1577875_1578562_-	deoxynucleoside kinase	NA	A0A0M3UL55	Enterococcus_phage	26.6	1.6e-07
WP_040143481.1|1578558_1579101_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_040144881.1|1579136_1580672_-	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	31.2	3.2e-24
>prophage 3
NZ_CP007781	Burkholderia cenocepacia strain DWS 37E-2 chromosome 1, complete sequence	3241886	1846069	1854372	3241886		Bacillus_phage(16.67%)	8	NA	NA
WP_040143698.1|1846069_1847470_+	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	38.3	8.8e-77
WP_080294569.1|1847477_1848428_+	D-glycero-beta-D-manno-heptose-7-phosphate kinase	NA	A0A2H4N7X4	Lake_Baikal_phage	27.8	1.0e-15
WP_040144904.1|1848492_1849485_+	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	31.2	6.9e-28
WP_040143699.1|1849558_1849903_+	competence protein ComE	NA	NA	NA	NA	NA
WP_040143700.1|1850121_1851024_+	cysteine synthase CysM	NA	A0A1X9I5F1	Streptococcus_phage	40.2	9.7e-53
WP_040143701.1|1851114_1852338_-	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_040143702.1|1852508_1853432_+	histone deacetylase family protein	NA	A0A2K9KZC4	Tupanvirus	35.2	4.6e-42
WP_040143703.1|1853454_1854372_-	alpha/beta hydrolase	NA	A7XCB7	Tanapox_virus	27.0	2.6e-21
>prophage 4
NZ_CP007781	Burkholderia cenocepacia strain DWS 37E-2 chromosome 1, complete sequence	3241886	2739702	2795176	3241886	tail,protease,holin,integrase,plate,portal,head,capsid	uncultured_Caudovirales_phage(32.14%)	61	2750864:2750887	2795327:2795350
WP_006489345.1|2739702_2740974_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	58.3	6.0e-133
WP_006496351.1|2741138_2741792_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	55.4	6.3e-54
WP_040144381.1|2741932_2743279_-	trigger factor	NA	NA	NA	NA	NA
WP_040144382.1|2743670_2744816_+	glycerate kinase	NA	NA	NA	NA	NA
WP_040144383.1|2744878_2745328_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_040144384.1|2745372_2745597_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040144968.1|2745569_2746568_-	2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
WP_040144385.1|2747153_2747384_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040144386.1|2747554_2747842_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158374046.1|2748703_2749819_+	acyltransferase	NA	NA	NA	NA	NA
2750864:2750887	attL	TGATGGTGCGTGAGGCCGGACTCG	NA	NA	NA	NA
WP_040144388.1|2751343_2751844_+	DUF4365 domain-containing protein	NA	NA	NA	NA	NA
WP_040144389.1|2751840_2752965_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040144390.1|2753191_2754973_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144245448.1|2755024_2755588_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040144391.1|2755813_2756743_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_040144392.1|2756756_2757461_-	DUF159 family protein	NA	A0A1S5NTJ1	Burkholderia_phage	73.3	1.9e-104
WP_040144393.1|2757513_2758005_+	hypothetical protein	NA	C7BGE3	Burkholderia_phage	62.0	2.6e-52
WP_158374048.1|2758263_2758437_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080294618.1|2758871_2760026_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080294585.1|2760087_2760585_-	pilus assembly protein	NA	NA	NA	NA	NA
WP_040144396.1|2760832_2761621_-	DNA adenine methylase	NA	Q8W6S4	Burkholderia_virus	89.7	1.8e-143
WP_040144397.1|2761791_2762286_-	DUF2514 family protein	NA	C7BGD9	Burkholderia_phage	61.5	4.6e-41
WP_040144398.1|2762282_2762777_-	glycoside hydrolase family 104 protein	NA	Q6J1Q5	Burkholderia_virus	87.2	9.0e-77
WP_040144399.1|2762779_2763064_-|holin	holin	holin	C7BGD7	Burkholderia_phage	95.7	1.0e-40
WP_040144400.1|2763138_2764191_-	phage late control D protein	NA	A0A2H4JBF6	uncultured_Caudovirales_phage	48.1	7.3e-84
WP_040144401.1|2764201_2764408_-|tail	phage tail protein	tail	A0A2H4J9Z9	uncultured_Caudovirales_phage	58.2	3.4e-14
WP_040144402.1|2764382_2765264_-|tail	phage tail protein	tail	A0A2H4J875	uncultured_Caudovirales_phage	38.3	8.3e-33
WP_040144403.1|2765273_2767691_-|tail	phage tail tape measure protein	tail	A0A2H4JG00	uncultured_Caudovirales_phage	34.1	2.2e-59
WP_040144404.1|2767747_2768077_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_040144405.1|2768170_2768674_-|tail	phage major tail tube protein	tail	Q7M2A5	Pseudomonas_phage	49.4	1.7e-43
WP_040144406.1|2768684_2769854_-|tail	phage tail sheath family protein	tail	A0A2H4J869	uncultured_Caudovirales_phage	71.9	4.2e-157
WP_040144407.1|2769929_2770382_-|tail	phage tail protein	tail	A4JWL9	Burkholderia_virus	39.0	8.9e-07
WP_040144408.1|2771498_2772068_-|tail	phage tail protein I	tail	A4JWL7	Burkholderia_virus	48.6	4.4e-35
WP_040144409.1|2772057_2772951_-|plate	baseplate J protein	plate	D5LGZ3	Escherichia_phage	36.2	2.8e-44
WP_040144410.1|2772947_2773283_-|plate	phage baseplate protein	plate	A0A2H4JA09	uncultured_Caudovirales_phage	50.9	1.3e-23
WP_040144411.1|2773282_2773483_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144245449.1|2773551_2774280_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040144413.1|2774392_2775073_-|plate	phage baseplate assembly protein V	plate	E5FFH5	Burkholderia_phage	33.0	1.2e-18
WP_040144414.1|2775065_2775596_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040144415.1|2775588_2776116_-|tail	phage tail protein	tail	K7R9K2	Vibrio_phage	31.0	4.8e-20
WP_040144416.1|2776121_2776412_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040144417.1|2776413_2777409_-|capsid	major capsid protein	capsid	A0A2H4J890	uncultured_Caudovirales_phage	59.7	2.9e-114
WP_040144418.1|2777485_2777830_-|head	head decoration protein	head	NA	NA	NA	NA
WP_040144419.1|2777854_2778958_-|protease	Clp protease ClpP	protease	A0A2H4JDI2	uncultured_Caudovirales_phage	39.3	2.2e-51
WP_040144420.1|2778959_2780447_-|portal	phage portal protein	portal	A0A2H4JFL5	uncultured_Caudovirales_phage	51.5	1.2e-132
WP_011657129.1|2780443_2780650_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040144421.1|2783266_2783461_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052111050.1|2783867_2784242_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040144973.1|2784517_2785105_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040144422.1|2785326_2787834_-	virulence protein E	NA	A0A2D1GN57	Marinobacter_phage	41.5	1.9e-98
WP_144245450.1|2787976_2788450_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040144974.1|2788451_2788892_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040144424.1|2788930_2789314_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040144425.1|2789315_2789846_-	hypothetical protein	NA	C7BGG0	Burkholderia_phage	47.1	3.6e-31
WP_040144426.1|2790233_2790665_+	transcriptional regulator	NA	A0A0P0J076	Acinetobacter_phage	64.4	1.0e-15
WP_040144427.1|2791119_2791338_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052111058.1|2791387_2791750_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080294587.1|2791746_2792346_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040144428.1|2792345_2793626_+	pyridoxal phosphate biosynthetic protein PdxJ	NA	A0A2I7QW51	Vibrio_phage	25.2	4.3e-06
WP_089464998.1|2793884_2794157_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040144430.1|2794153_2795176_-|integrase	site-specific integrase	integrase	A0A1B1P9F9	Acinetobacter_phage	44.9	8.6e-66
2795327:2795350	attR	TGATGGTGCGTGAGGCCGGACTCG	NA	NA	NA	NA
