The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP004385	Burkholderia thailandensis MSMB59 chromosome 1, complete sequence	3916324	533549	590537	3916324	integrase,transposase,tRNA	Moraxella_phage(17.65%)	41	533986:534013	589565:589592
WP_009891862.1|533549_534809_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.4	1.5e-43
533986:534013	attL	CGGATCAGATGCACGATGCAGGTCTGGA	NA	NA	NA	NA
WP_009910539.1|535254_535698_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025992348.1|535815_537429_+	recombinase family protein	NA	E5DV73	Deep-sea_thermophilic_phage	24.5	6.2e-10
WP_025992349.1|537425_538328_+	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_025992350.1|538324_539227_+	chromosome partitioning protein ParB	NA	NA	NA	NA	NA
WP_155295642.1|539888_541061_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080556810.1|541646_543317_-	hypothetical protein	NA	A0A2L1IZ21	Streptomyces_phage	33.6	1.7e-26
WP_080750980.1|543413_546143_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155295643.1|546127_548125_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155295644.1|548121_549417_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009910605.1|549692_550421_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025992351.1|550722_551190_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009910607.1|551239_551683_-	hypothetical protein	NA	A0A1V0EBJ7	Caulobacter_phage	32.9	6.7e-07
WP_155295645.1|551811_553188_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080556807.1|553514_555023_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080556808.1|555019_555910_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_099975842.1|555953_557915_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_099975843.1|557928_558378_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080556806.1|558836_559241_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_085955523.1|560223_563307_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_009910465.1|563308_566200_+	site-specific DNA-methyltransferase	NA	G8I4P9	Mycobacterium_phage	24.0	6.3e-21
WP_009910466.1|566199_568278_+	AAA family ATPase	NA	A0A1V0SIN4	Klosneuvirus	22.1	1.7e-07
WP_050791339.1|568570_569470_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009910468.1|570012_571089_+	DUF262 domain-containing protein	NA	A0A0R6PKN1	Moraxella_phage	34.4	7.7e-49
WP_009910470.1|571089_571827_+	hypothetical protein	NA	A0A0R6PKK0	Moraxella_phage	30.3	2.8e-10
WP_009910471.1|571823_572891_+	DNA cytosine methyltransferase	NA	A0A0R6PG08	Moraxella_phage	55.0	1.4e-103
WP_009910472.1|572844_573291_-	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	40.4	2.0e-14
WP_009888727.1|573457_573865_+|transposase	transposase	transposase	A0A0P0ZBP6	Stx2-converting_phage	38.2	3.1e-14
WP_009889515.1|573861_574209_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	72.0	2.1e-40
WP_009889500.1|574238_575810_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	53.8	6.7e-150
WP_009910190.1|576463_578932_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	34.4	2.4e-114
WP_009906826.1|579120_580224_-	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	34.0	1.7e-46
WP_080511563.1|580386_582150_-	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_004198824.1|582442_582577_+	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_009906635.1|582650_583061_+	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_006024057.1|583140_583410_+	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	53.6	1.3e-16
WP_009910184.1|583418_585092_+	membrane protein insertase YidC	NA	NA	NA	NA	NA
WP_011402627.1|585232_585694_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_009910182.1|585990_587394_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE	tRNA	NA	NA	NA	NA
WP_155295674.1|588831_590031_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	42.2	3.5e-42
589565:589592	attR	TCCAGACCTGCATCGTGCATCTGATCCG	NA	NA	NA	NA
WP_025992318.1|590240_590537_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP004385	Burkholderia thailandensis MSMB59 chromosome 1, complete sequence	3916324	827431	874743	3916324	plate,transposase,protease	Pseudomonas_phage(20.0%)	44	NA	NA
WP_080556792.1|827431_827950_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	52.5	1.1e-21
WP_155295650.1|828340_829312_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043295008.1|829816_830986_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052122129.1|830982_832455_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_043295010.1|832821_833475_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155295651.1|833605_834604_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155295652.1|834735_836331_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059738270.1|836731_837382_-	abortive infection family protein	NA	NA	NA	NA	NA
WP_043295014.1|837388_837700_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043295015.1|837746_838052_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043295346.1|838404_839412_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043295348.1|839579_840542_-	hypothetical protein	NA	A0A0A8J8N7	Ralstonia_phage	46.7	1.0e-63
WP_043295017.1|841246_841588_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_043295018.1|841565_842204_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043295021.1|842205_842505_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155295653.1|842519_842906_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043295024.1|843008_843815_-	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_043295026.1|843879_844965_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043295028.1|844961_845867_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043295030.1|845940_846168_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043295032.1|846178_847174_-	endonuclease	NA	A6XMH8	Bacillus_virus	38.4	3.1e-52
WP_043295353.1|847247_848216_-	DUF932 domain-containing protein	NA	A0A0H4INH5	Stenotrophomonas_phage	41.7	2.4e-57
WP_080750985.1|848323_848665_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043295034.1|848926_849847_+	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_155295654.1|849864_850104_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043295036.1|850103_852494_+	SAM-dependent DNA methyltransferase	NA	NA	NA	NA	NA
WP_043295038.1|852493_853909_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_043295039.1|853895_856892_+	type I restriction endonuclease subunit R	NA	NA	NA	NA	NA
WP_043295041.1|857021_858110_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043295043.1|858106_858601_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043295045.1|858597_860475_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_052122132.1|861113_861458_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_043295047.1|861525_862890_-	DUF4102 domain-containing protein	NA	NA	NA	NA	NA
WP_107645272.1|863606_863831_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_009891862.1|864361_865621_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.4	1.5e-43
WP_009888580.1|865731_866517_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_009888581.1|866513_867860_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_038708129.1|867968_868583_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_011402551.1|868956_869646_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_009888592.1|869682_870201_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_009888594.1|870217_871708_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_009906860.1|871780_872284_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_080511549.1|872311_872824_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_080511672.1|872916_874743_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
>prophage 3
NZ_CP004385	Burkholderia thailandensis MSMB59 chromosome 1, complete sequence	3916324	1178022	1187253	3916324		Hokovirus(16.67%)	7	NA	NA
WP_009889255.1|1178022_1179975_+	molecular chaperone DnaK	NA	A0A1V0SH73	Hokovirus	49.5	1.2e-148
WP_009889258.1|1180238_1181369_+	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	38.0	1.8e-24
WP_038712436.1|1181400_1183410_+	bifunctional anthranilate synthase component I family protein/class IV aminotransferase	NA	S4VT78	Pandoravirus	35.2	1.7e-52
WP_009904054.1|1183585_1184401_-	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0N7HVJ8	Ostreococcus_lucimarinus_virus	32.9	3.3e-36
WP_009889263.1|1184465_1185149_-	deoxynucleoside kinase	NA	A0A249XZR7	Enterococcus_phage	26.0	3.3e-05
WP_009889265.1|1185145_1185673_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_009889266.1|1185708_1187253_-	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	31.2	3.3e-24
>prophage 4
NZ_CP004385	Burkholderia thailandensis MSMB59 chromosome 1, complete sequence	3916324	1431323	1440265	3916324	transposase	Staphylococcus_phage(28.57%)	10	NA	NA
WP_009889661.1|1431323_1432460_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	36.0	3.7e-49
WP_155295660.1|1433157_1433940_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107645277.1|1433867_1434497_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	69.6	1.5e-31
WP_009888727.1|1434493_1434901_-|transposase	transposase	transposase	A0A0P0ZBP6	Stx2-converting_phage	38.2	3.1e-14
WP_009891862.1|1435177_1436437_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.4	1.5e-43
WP_080713227.1|1437467_1437695_-	helicase	NA	NA	NA	NA	NA
WP_009889671.1|1437833_1438061_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_009889673.1|1438057_1438441_+	type II toxin-antitoxin system death-on-curing family toxin	NA	A0A1B3AYM0	Gordonia_phage	43.6	9.9e-07
WP_009889675.1|1438484_1439114_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	36.2	2.4e-26
WP_011402095.1|1439128_1440265_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	32.9	4.3e-42
>prophage 5
NZ_CP004385	Burkholderia thailandensis MSMB59 chromosome 1, complete sequence	3916324	1549527	1558175	3916324		Bacillus_phage(16.67%)	8	NA	NA
WP_009908912.1|1549527_1550928_+	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	38.7	1.1e-79
WP_080511617.1|1550959_1551883_+	D-glycero-beta-D-manno-heptose-7-phosphate kinase	NA	A0A2H4N7X4	Lake_Baikal_phage	27.9	1.3e-15
WP_009908914.1|1551940_1552933_+	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	30.9	9.1e-28
WP_009889858.1|1553004_1553322_+	competence protein ComE	NA	NA	NA	NA	NA
WP_009904404.1|1553656_1554559_+	cysteine synthase CysM	NA	A0A1X9I5F1	Streptococcus_phage	39.9	4.3e-53
WP_085952901.1|1554653_1555946_-	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_009889864.1|1556073_1556997_+	histone deacetylase family protein	NA	A0A2K9KZC4	Tupanvirus	36.2	3.2e-43
WP_025369235.1|1557332_1558175_-	alpha/beta hydrolase	NA	A7K906	Acanthocystis_turfacea_chlorella_virus	24.6	3.8e-11
>prophage 6
NZ_CP004385	Burkholderia thailandensis MSMB59 chromosome 1, complete sequence	3916324	1835484	1924487	3916324	plate,tRNA,integrase,tail,portal,protease,capsid,terminase,head	uncultured_Caudovirales_phage(23.26%)	98	1864855:1864874	1906123:1906142
WP_009890173.1|1835484_1837011_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.2	7.3e-85
WP_099005209.1|1837083_1838188_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	37.1	2.2e-06
WP_009909025.1|1838415_1840110_-	single-stranded-DNA-specific exonuclease RecJ	NA	A0A0K2FM92	Brevibacillus_phage	27.5	1.4e-28
WP_025369276.1|1840125_1841211_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009890181.1|1841540_1842794_+	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_009890182.1|1842813_1843536_+	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	38.2	3.1e-33
WP_009890183.1|1843540_1844329_+	TatD family hydrolase	NA	NA	NA	NA	NA
WP_009909028.1|1844382_1846920_+	ComEC/Rec2 family competence protein	NA	NA	NA	NA	NA
WP_009890187.1|1846956_1847784_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_009890189.1|1848026_1849688_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	52.0	1.4e-150
WP_009890191.1|1849684_1850539_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	41.3	1.0e-48
WP_009890193.1|1850643_1851927_+	phosphopyruvate hydratase	NA	W6LP63	Streptococcus_phage	62.1	9.3e-150
WP_009890195.1|1852018_1852450_+	cell division protein FtsB	NA	NA	NA	NA	NA
WP_009890196.1|1852611_1852956_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009904690.1|1853044_1853995_-	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
WP_009890200.1|1854033_1854558_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_080511492.1|1854703_1855555_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_085955518.1|1855829_1856732_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_085955519.1|1856933_1857773_+	PHP domain-containing protein	NA	NA	NA	NA	NA
WP_009890207.1|1857836_1858466_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_009890209.1|1858564_1859230_+|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_009890211.1|1859238_1860441_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_025369277.1|1860437_1861055_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_009909031.1|1861099_1862002_+	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
WP_009890216.1|1862112_1863255_+	outer membrane protein assembly factor BamC	NA	NA	NA	NA	NA
WP_009890218.1|1863261_1864038_+	MBL fold metallo-hydrolase	NA	U5PVD0	Bacillus_phage	26.6	1.9e-09
WP_080511493.1|1864218_1864473_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080556751.1|1864704_1865868_-	cupin domain-containing protein	NA	NA	NA	NA	NA
1864855:1864874	attL	GAGCGGTTGCGCGTCGCCGT	NA	NA	NA	NA
WP_009909034.1|1865960_1866506_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_009890224.1|1866485_1867784_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155295676.1|1867770_1870440_-	DNA mismatch repair protein MutS	NA	A0A1V0SDQ0	Indivirus	24.0	1.7e-28
WP_011402202.1|1870611_1871913_+|integrase	integrase family protein	integrase	C7BGE7	Burkholderia_phage	58.9	3.0e-148
WP_009890227.1|1871863_1872106_-	AlpA family phage regulatory protein	NA	C7BGF0	Burkholderia_phage	59.2	9.3e-19
WP_009909036.1|1872114_1872588_-	hypothetical protein	NA	B5TA88	Burkholderia_phage	71.4	2.3e-05
WP_004555250.1|1872596_1872926_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009909037.1|1873039_1874356_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004534278.1|1874355_1874805_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004534172.1|1874801_1875407_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004534202.1|1875403_1875739_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004550209.1|1875790_1876009_-	hypothetical protein	NA	NA	NA	NA	NA
WP_128972304.1|1876137_1876593_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009909040.1|1876540_1877026_-	helix-turn-helix transcriptional regulator	NA	A0A193GYL7	Enterobacter_phage	41.2	4.4e-12
WP_038707945.1|1877175_1877403_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009909041.1|1877491_1878019_+	hypothetical protein	NA	C7BGG0	Burkholderia_phage	46.5	9.7e-29
WP_080556752.1|1878032_1878365_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004538501.1|1878372_1878828_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025992235.1|1878829_1879288_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009909046.1|1879661_1880132_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009909047.1|1880251_1882744_+	virulence protein E	NA	A0A2D1GN57	Marinobacter_phage	41.8	1.9e-98
WP_009909048.1|1882961_1883549_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004538506.1|1883929_1884778_+	DUF4747 family protein	NA	NA	NA	NA	NA
WP_144241902.1|1884946_1885378_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009909051.1|1885527_1886097_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009909052.1|1886059_1888045_+|terminase	phage terminase large subunit family protein	terminase	A0A2D1GMT1	Marinobacter_phage	53.4	1.6e-180
WP_004533700.1|1888055_1888262_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025992236.1|1888258_1889752_+|portal	phage portal protein	portal	A0A2H4JFL5	uncultured_Caudovirales_phage	50.8	3.7e-134
WP_009909056.1|1889748_1890849_+|protease	Clp protease ClpP	protease	A0A2H4JDI2	uncultured_Caudovirales_phage	36.1	3.0e-48
WP_025992237.1|1890875_1891220_+|head	head decoration protein	head	NA	NA	NA	NA
WP_004550216.1|1891254_1892280_+|capsid	major capsid protein	capsid	A0A2H4J890	uncultured_Caudovirales_phage	59.1	1.7e-109
WP_009909060.1|1892283_1892574_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004539763.1|1892575_1893106_+|tail	phage tail protein	tail	A0A2H4JBV1	uncultured_Caudovirales_phage	28.0	9.2e-11
WP_004533675.1|1893095_1893629_+	hypothetical protein	NA	Q9JML9	Wolbachia_phage	39.5	6.2e-23
WP_004533661.1|1893631_1894312_+|plate	phage baseplate assembly protein V	plate	A0A1B2LRU5	Wolbachia_phage	34.4	1.2e-18
WP_004547866.1|1894376_1894583_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004533690.1|1894579_1894924_+	hypothetical protein	NA	A0A2H4JA09	uncultured_Caudovirales_phage	50.9	1.4e-23
WP_009909065.1|1894920_1895814_+|plate	baseplate J protein	plate	A0A1J0I2M3	Salmonella_phage	40.5	8.4e-49
WP_004547894.1|1895806_1896382_+|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	47.7	6.0e-32
WP_043295120.1|1896369_1897833_+	hypothetical protein	NA	A4JWL8	Burkholderia_virus	78.2	1.6e-214
WP_009909071.1|1897848_1898301_+|tail	tail assembly chaperone	tail	A4JWL9	Burkholderia_virus	77.7	4.8e-45
WP_012730181.1|1898366_1899536_+|tail	phage tail sheath family protein	tail	A0A2H4J869	uncultured_Caudovirales_phage	72.9	1.4e-160
WP_004533620.1|1899546_1900050_+|tail	phage major tail tube protein	tail	Q7M2A5	Pseudomonas_phage	50.0	1.2e-41
WP_004533642.1|1900119_1900422_+|tail	phage tail assembly protein	tail	V5YST8	Pseudomonas_phage	37.2	1.5e-05
WP_009909075.1|1900509_1902924_+|tail	phage tail tape measure protein	tail	A0A2H4JG00	uncultured_Caudovirales_phage	34.7	4.0e-69
WP_009909076.1|1902932_1903814_+|tail	phage tail protein	tail	A0A2H4J875	uncultured_Caudovirales_phage	37.4	5.0e-30
WP_004540041.1|1903788_1903995_+|tail	phage tail protein	tail	A0A2H4J9Z9	uncultured_Caudovirales_phage	61.2	4.0e-15
WP_009909079.1|1904004_1905057_+	phage late control protein	NA	A0A2H4JBF6	uncultured_Caudovirales_phage	44.8	7.0e-79
WP_004533694.1|1905132_1905327_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004539628.1|1905319_1905817_+	lysozyme	NA	A4JX20	Burkholderia_virus	78.2	2.2e-67
WP_009909080.1|1905816_1906362_+	lysozyme	NA	Q8W6S5	Burkholderia_virus	92.3	9.6e-80
1906123:1906142	attR	GAGCGGTTGCGCGTCGCCGT	NA	NA	NA	NA
WP_009890252.1|1906505_1907294_+	DNA adenine methylase	NA	Q8W6S4	Burkholderia_virus	97.3	1.0e-151
WP_009890254.1|1907334_1908045_-	hypothetical protein	NA	A4PE26	Ralstonia_virus	41.5	4.1e-38
WP_119027180.1|1908056_1908659_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011402208.1|1908543_1909017_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011402209.1|1909009_1909519_-	DUF4123 domain-containing protein	NA	A4PE24	Ralstonia_virus	40.1	3.0e-19
WP_009910666.1|1909515_1909941_-	PAAR domain-containing protein	NA	A4JWV5	Burkholderia_virus	47.0	8.4e-15
WP_043295122.1|1910450_1911008_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009910405.1|1912631_1912904_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009890278.1|1913168_1913972_-	inositol monophosphatase	NA	NA	NA	NA	NA
WP_009890279.1|1914274_1915195_+	RNA methyltransferase	NA	NA	NA	NA	NA
WP_009890280.1|1915396_1916179_+	serine O-acetyltransferase	NA	NA	NA	NA	NA
WP_009890284.1|1916521_1917322_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_009890286.1|1917345_1917837_-	peptidyl-prolyl cis-trans isomerase	NA	A0A2H4UTF4	Bodo_saltans_virus	29.8	8.2e-06
WP_009890287.1|1917917_1918493_-	peptidyl-prolyl cis-trans isomerase	NA	A0A1V0SCU1	Indivirus	40.0	2.4e-12
WP_009890289.1|1918548_1919214_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_009890291.1|1919501_1920899_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	33.8	2.4e-42
WP_009890293.1|1920946_1921885_+	DNA-3-methyladenine glycosylase 2 family protein	NA	NA	NA	NA	NA
WP_009890295.1|1921987_1922959_+	acetyl-CoA carboxylase carboxyltransferase subunit alpha	NA	NA	NA	NA	NA
WP_011402215.1|1923002_1924487_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
>prophage 7
NZ_CP004385	Burkholderia thailandensis MSMB59 chromosome 1, complete sequence	3916324	2375302	2423306	3916324	plate,transposase,holin,terminase,portal,protease,tail,capsid,head	Burkholderia_virus(61.22%)	60	NA	NA
WP_011401137.1|2375302_2376571_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	42.7	9.8e-43
WP_009891053.1|2377506_2378406_+	hypothetical protein	NA	A0JC16	Ralstonia_phage	37.7	1.2e-34
WP_009891055.1|2378487_2378673_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025369360.1|2378793_2379054_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043037066.1|2379140_2379350_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009909341.1|2379386_2379716_-	helix-turn-helix domain-containing protein	NA	R4JEU7	Burkholderia_phage	58.7	1.6e-29
WP_009909343.1|2379967_2380120_+	hypothetical protein	NA	R4JMC2	Burkholderia_phage	66.0	3.4e-11
WP_009909344.1|2380107_2380890_+	hypothetical protein	NA	A4JWW8	Burkholderia_virus	98.8	9.7e-142
WP_011205516.1|2381023_2381209_+	hypothetical protein	NA	A4JWW7	Burkholderia_virus	100.0	4.3e-24
WP_009897093.1|2381205_2381427_+	hypothetical protein	NA	A4JWW6	Burkholderia_virus	100.0	1.6e-38
WP_009909345.1|2381430_2381646_+	hypothetical protein	NA	A4JWW5	Burkholderia_virus	98.6	7.9e-30
WP_009909346.1|2381654_2381792_+	hypothetical protein	NA	A4JWW4	Burkholderia_virus	71.1	1.8e-11
WP_009909347.1|2381948_2382167_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025992260.1|2382338_2383847_+	DNA cytosine methyltransferase	NA	Q6V7R9	Burkholderia_virus	38.1	2.4e-64
WP_009909351.1|2383846_2385640_+	replication endonuclease	NA	A4JWW0	Burkholderia_virus	97.3	0.0e+00
WP_009909352.1|2385655_2385922_+	ogr/Delta-like zinc finger family protein	NA	A4JWV9	Burkholderia_virus	94.1	9.5e-41
WP_004532731.1|2385918_2386125_+	bacteriophage-acquired protein	NA	A4JWV8	Burkholderia_virus	100.0	8.7e-34
WP_011205518.1|2386211_2386868_+	AAA family ATPase	NA	A4JWV7	Burkholderia_virus	100.0	3.8e-115
WP_011205519.1|2387068_2387224_+	CopG family transcriptional regulator	NA	A4JWV6	Burkholderia_virus	98.0	1.6e-19
WP_004532793.1|2387326_2387860_+	bacteriophage gp29 protein	NA	A4JWV5	Burkholderia_virus	100.0	8.4e-97
WP_004532838.1|2387856_2388594_+	VRR-NUC domain-containing protein	NA	A4JWV4	Burkholderia_virus	99.6	1.0e-132
WP_076850489.1|2388602_2389724_+	DUF3396 domain-containing protein	NA	A4JWV3	Burkholderia_virus	99.7	3.7e-219
WP_011204767.1|2390288_2390612_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A4JWV2	Burkholderia_virus	98.1	1.1e-54
WP_004202809.1|2390614_2390971_+	putative addiction module antidote protein	NA	A4JWV1	Burkholderia_virus	100.0	3.9e-42
WP_009909353.1|2391014_2392070_-|portal	phage portal protein	portal	A4JWV0	Burkholderia_virus	99.4	5.7e-206
WP_009909354.1|2392066_2393836_-|terminase	terminase ATPase subunit family protein	terminase	K4NXI4	Burkholderia_phage	99.7	0.0e+00
WP_004532870.1|2393979_2394789_+|capsid	GPO family capsid scaffolding protein	capsid	A4JWU8	Burkholderia_virus	100.0	3.2e-148
WP_004532901.1|2394822_2395836_+|capsid	phage major capsid protein, P2 family	capsid	A4JWU7	Burkholderia_virus	100.0	5.5e-190
WP_004531049.1|2395832_2396522_+|terminase	bacteriophage terminase endonuclease subunit	terminase	K4NX86	Burkholderia_phage	100.0	2.5e-117
WP_009909356.1|2396621_2397101_+|head	head completion/stabilization protein	head	A4JWU5	Burkholderia_virus	100.0	5.8e-81
WP_004524437.1|2397100_2397352_+	hypothetical protein	NA	K4NXI9	Burkholderia_phage	100.0	7.6e-40
WP_004524438.1|2397348_2397555_+|tail	tail protein	tail	K4PAW7	Burkholderia_phage	100.0	2.4e-31
WP_004524439.1|2397569_2397914_+	membrane protein	NA	K4NZQ3	Burkholderia_phage	100.0	2.9e-50
WP_004524440.1|2397915_2398188_+|holin	phage holin family protein	holin	K4NX91	Burkholderia_phage	100.0	8.8e-42
WP_009909360.1|2398184_2398997_+	DUF3380 domain-containing protein	NA	A4JWU0	Burkholderia_virus	100.0	6.9e-151
WP_009909361.1|2398993_2399434_+	phage-encoded lipoprotein	NA	K4NXJ2	Burkholderia_phage	98.6	4.7e-69
WP_009909362.1|2399538_2399955_+|tail	phage tail protein	tail	A4JWT7	Burkholderia_virus	99.3	1.2e-71
WP_009909364.1|2399951_2400419_+	phage virion morphogenesis protein	NA	K4NZQ8	Burkholderia_phage	98.1	5.0e-77
WP_155295666.1|2400618_2401599_+	hypothetical protein	NA	Q06VL9	Trichoplusia_ni_ascovirus	29.1	5.1e-15
WP_155295667.1|2401663_2401987_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080556767.1|2402062_2402935_-	site-specific DNA-methyltransferase	NA	A4JWY5	Burkholderia_virus	96.4	1.2e-156
WP_009909368.1|2403009_2403690_+|plate	phage baseplate assembly protein V	plate	A4JWY4	Burkholderia_virus	95.1	9.3e-117
WP_004556607.1|2403686_2404049_+|plate	phage baseplate assembly protein	plate	K4PAX6	Burkholderia_phage	99.2	5.0e-61
WP_004524450.1|2404045_2404951_+|plate	phage baseplate assembly protein	plate	A4JWT1	Burkholderia_virus	100.0	3.6e-164
WP_009897027.1|2404943_2405498_+|tail	phage tail protein I	tail	A4JWT0	Burkholderia_virus	100.0	3.8e-100
WP_080556768.1|2405499_2407872_+|tail	phage tail protein	tail	K4NZW8	Burkholderia_phage	99.5	0.0e+00
WP_009909370.1|2407888_2408560_+|tail	phage tail fiber assembly protein	tail	A4JWS8	Burkholderia_virus	100.0	4.1e-117
WP_009909371.1|2408615_2409788_+|tail	phage tail sheath protein	tail	Q45YG5	Burkholderia_virus	99.7	8.9e-224
WP_014696837.1|2409803_2410313_+|tail	phage major tail tube protein	tail	K4NZR9	Burkholderia_phage	98.8	3.2e-93
WP_004531064.1|2410370_2410715_+|tail	phage tail assembly protein	tail	K4NXA3	Burkholderia_phage	100.0	1.0e-55
WP_004552648.1|2410723_2410837_+|tail	GpE family phage tail protein	tail	A0A089FGX3	Burkholderia_phage	100.0	5.4e-14
WP_080556769.1|2410833_2413800_+	hypothetical protein	NA	A4JWX4	Burkholderia_virus	99.0	0.0e+00
WP_009909375.1|2413817_2414243_+|tail	phage tail protein	tail	A4JWS2	Burkholderia_virus	98.6	1.7e-71
WP_009909377.1|2414242_2415343_+	phage late control D family protein	NA	K4PAY4	Burkholderia_phage	99.2	4.0e-202
WP_006027238.1|2415415_2415634_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009909378.1|2415714_2416035_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009909379.1|2418339_2420373_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_127446386.1|2420486_2421482_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009891062.1|2421543_2422569_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_009891064.1|2422955_2423306_+|protease	serine protease	protease	NA	NA	NA	NA
>prophage 8
NZ_CP004385	Burkholderia thailandensis MSMB59 chromosome 1, complete sequence	3916324	2799959	2867946	3916324	plate,transposase,tRNA,coat	uncultured_Caudovirales_phage(33.33%)	52	NA	NA
WP_009891699.1|2799959_2802584_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	39.2	7.1e-80
WP_009891700.1|2803025_2804246_+	CoA transferase	NA	NA	NA	NA	NA
WP_009909736.1|2804335_2805142_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009891706.1|2806162_2807872_+|tRNA	glutamine--tRNA ligase/YqeY domain fusion protein	tRNA	A0A222YZ70	Escherichia_phage	56.9	2.8e-186
WP_009891707.1|2808166_2808643_-	NUDIX hydrolase	NA	A0A2I6PFL2	Proteus_phage	41.3	2.0e-20
WP_009909742.1|2808661_2809048_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080556782.1|2809334_2811383_-	glycoside hydrolase family 3 protein	NA	NA	NA	NA	NA
WP_009905872.1|2811359_2811539_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009891712.1|2811535_2812396_+	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_080511657.1|2812441_2813578_-	cytochrome-c peroxidase	NA	NA	NA	NA	NA
WP_009891716.1|2814066_2815650_+	acid phosphatase	NA	NA	NA	NA	NA
WP_009891718.1|2815874_2817068_+	trans-2-enoyl-CoA reductase family protein	NA	NA	NA	NA	NA
WP_043295171.1|2817085_2817928_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_154660009.1|2818172_2818415_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009891722.1|2818625_2819258_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_025369426.1|2819258_2821331_-	response regulator	NA	A0A1V0SGR3	Hokovirus	25.9	5.0e-12
WP_009891727.1|2821741_2822707_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_080713235.1|2822722_2825071_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_009909750.1|2825178_2826018_-	molecular chaperone	NA	NA	NA	NA	NA
WP_009891731.1|2826035_2826560_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_009891732.1|2826642_2827203_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_025369429.1|2827255_2827801_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_009891734.1|2828603_2829497_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_080511534.1|2829661_2829847_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011402450.1|2829912_2831202_+	MFS transporter	NA	NA	NA	NA	NA
WP_009909753.1|2831246_2832173_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_009891738.1|2832464_2832701_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009891740.1|2832658_2832940_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_080511535.1|2833139_2833442_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009891744.1|2834152_2835466_-	divalent metal cation transporter	NA	NA	NA	NA	NA
WP_004543837.1|2837947_2838256_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_080556783.1|2839363_2839633_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080556784.1|2840180_2840549_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080751010.1|2841196_2844019_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009909762.1|2844039_2844915_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009909763.1|2844916_2847751_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	24.1	2.0e-27
WP_009909765.1|2847763_2848069_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009891776.1|2848086_2848419_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080511661.1|2848552_2848765_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009909766.1|2848901_2849393_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009891777.1|2849370_2852706_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_080750995.1|2852814_2855217_-	DUF2235 domain-containing protein	NA	NA	NA	NA	NA
WP_011402455.1|2855213_2855813_-	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_025369435.1|2855809_2856367_-	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_038712723.1|2856494_2858903_-	DUF2235 domain-containing protein	NA	NA	NA	NA	NA
WP_011402458.1|2858899_2859499_-	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_038713115.1|2859495_2860053_-	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_009891787.1|2860189_2861023_-	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_009909781.1|2861025_2863824_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	24.1	1.2e-27
WP_009891791.1|2864349_2864616_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_009891792.1|2864639_2866067_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009910382.1|2866095_2867946_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
>prophage 9
NZ_CP004385	Burkholderia thailandensis MSMB59 chromosome 1, complete sequence	3916324	2959944	3015011	3916324	terminase,integrase,head	Burkholderia_phage(56.6%)	77	2959826:2959845	3015163:3015182
2959826:2959845	attL	TCGTGGTGCCGGGGACCGGA	NA	NA	NA	NA
WP_043295185.1|2959944_2960421_-	DUF2514 family protein	NA	Q6J1Q4	Burkholderia_virus	78.2	8.4e-56
WP_038792826.1|2960417_2960963_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043295188.1|2960959_2961457_-	lysozyme	NA	Q3HQU9	Burkholderia_phage	92.1	1.4e-82
WP_006495243.1|2961449_2961632_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043295190.1|2961802_2962075_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080750996.1|2962071_2962833_+	SGNH/GDSL hydrolase family protein	NA	A0A1P8L663	Pectobacterium_phage	28.7	2.7e-11
WP_080750997.1|2962836_2963988_+	acyltransferase	NA	A0A166XZF2	Gordonia_phage	27.3	1.2e-12
WP_043295379.1|2964184_2964889_-	hypothetical protein	NA	A9YX14	Burkholderia_phage	82.5	1.0e-94
WP_009927676.1|2965678_2966341_-	DUF2612 domain-containing protein	NA	A9YX13	Burkholderia_phage	100.0	1.1e-125
WP_043295193.1|2966340_2967522_-	bacteriophage protein	NA	A9YX12	Burkholderia_phage	94.4	2.2e-198
WP_041221269.1|2967518_2967872_-	hypothetical protein	NA	A9YX11	Burkholderia_phage	100.0	2.7e-59
WP_041221271.1|2967956_2968952_-	hypothetical protein	NA	A9YX09	Burkholderia_phage	99.7	1.9e-182
WP_041221272.1|2969089_2969830_-	phage protein	NA	A9YX06	Burkholderia_phage	100.0	3.7e-135
WP_009927683.1|2969833_2970211_+	hypothetical protein	NA	A9YX05	Burkholderia_phage	99.2	3.2e-66
WP_009927684.1|2970207_2971176_-	hypothetical protein	NA	A9YX04	Burkholderia_phage	100.0	1.0e-164
WP_009927685.1|2971172_2971490_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041221276.1|2971489_2972065_-	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	36.0	5.8e-19
WP_041221278.1|2972061_2974083_-	mannosyl-glycoprotein endo-beta-N-acetylglucosamidase	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	31.0	1.5e-40
WP_043295381.1|2974266_2974830_-	hypothetical protein	NA	A0A0N7IRF3	Acinetobacter_phage	34.8	2.8e-18
WP_051392327.1|2974907_2975456_+	hypothetical protein	NA	G0ZNE5	Cronobacter_phage	36.8	4.7e-18
WP_043295196.1|2975452_2975893_-	DUF3277 family protein	NA	A0A0P0IKY2	Acinetobacter_phage	57.5	1.9e-41
WP_043295198.1|2975908_2977384_-	DUF3383 domain-containing protein	NA	A0A0P0I492	Acinetobacter_phage	48.1	1.8e-112
WP_043295200.1|2977393_2977984_-	hypothetical protein	NA	A9YX29	Burkholderia_phage	92.9	1.6e-101
WP_043295202.1|2977988_2978360_-	hypothetical protein	NA	A9YX28	Burkholderia_phage	93.5	4.7e-62
WP_043295204.1|2978419_2978899_-	hypothetical protein	NA	A9YX26	Burkholderia_phage	85.5	8.7e-69
WP_043295205.1|2978927_2979311_-	DUF4054 domain-containing protein	NA	A9YX25	Burkholderia_phage	96.9	3.3e-63
WP_009927901.1|2979374_2979842_-	hypothetical protein	NA	A9YX24	Burkholderia_phage	100.0	2.2e-32
WP_043295207.1|2979843_2980935_-	DUF2184 domain-containing protein	NA	A9YX23	Burkholderia_phage	98.7	9.9e-161
WP_043295209.1|2981003_2981510_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043295211.1|2981519_2982986_-	DUF2213 domain-containing protein	NA	A9YX03	Burkholderia_phage	88.5	2.7e-209
WP_038782760.1|2983131_2983653_-	hypothetical protein	NA	A9YX01	Burkholderia_phage	94.2	2.8e-89
WP_043295213.1|2983733_2984492_-|head	head morphogenesis protein	head	A9YWZ8	Burkholderia_phage	94.0	7.0e-129
WP_043295215.1|2984756_2986223_-	DUF1073 domain-containing protein	NA	A9YWZ7	Burkholderia_phage	94.8	2.2e-264
WP_043295217.1|2986243_2987797_-|terminase	phage terminase large subunit	terminase	H9C0C7	Vibrio_phage	44.5	3.9e-110
WP_043295219.1|2987747_2988227_-	DUF2280 domain-containing protein	NA	A9YWZ5	Burkholderia_phage	76.3	4.2e-55
WP_077056326.1|2988261_2988813_-	hypothetical protein	NA	A0A0N9BAQ5	Vibrio_phage	38.6	4.1e-22
WP_043295221.1|2988782_2989442_-	hypothetical protein	NA	A9YWZ4	Burkholderia_phage	75.1	2.7e-97
WP_052122141.1|2989571_2990231_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043295222.1|2990227_2990557_-	hypothetical protein	NA	A9YWZ0	Burkholderia_phage	71.1	1.9e-30
WP_043295224.1|2990566_2991037_-	RusA family crossover junction endodeoxyribonuclease	NA	A9YWY9	Burkholderia_phage	87.8	3.7e-72
WP_155295668.1|2991033_2991207_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043295226.1|2991203_2992193_-	DUF1376 domain-containing protein	NA	NA	NA	NA	NA
WP_043295228.1|2992230_2992449_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043295230.1|2992611_2993082_-	hypothetical protein	NA	Q6JIG5	Burkholderia_virus	77.1	4.1e-63
WP_043295232.1|2993081_2993939_-	DNA adenine methylase	NA	A0A0K1LM14	Caulobacter_phage	53.1	2.8e-78
WP_043295234.1|2993938_2994808_-	hypothetical protein	NA	A9YWY3	Burkholderia_phage	92.7	9.7e-151
WP_038782739.1|2994804_2995095_-	hypothetical protein	NA	A9YWY2	Burkholderia_phage	100.0	6.9e-45
WP_043295236.1|2995091_2995319_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038783824.1|2995312_2995531_-	hypothetical protein	NA	A9YWY0	Burkholderia_phage	98.6	2.6e-36
WP_038782735.1|2995533_2995908_-	hypothetical protein	NA	A9YWX9	Burkholderia_phage	99.2	3.4e-68
WP_069246083.1|2996021_2996297_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080751011.1|2996193_2996802_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_155295669.1|2996968_2997322_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155295670.1|2997308_2998277_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080750999.1|2998390_2999110_+	KilA-N domain-containing protein	NA	A0A141GEX9	Brucella_phage	41.7	2.2e-15
WP_043295243.1|2999557_2999932_+	DUF1566 domain-containing protein	NA	NA	NA	NA	NA
WP_043295391.1|2999965_3000388_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043295244.1|3000564_3000882_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043295246.1|3000881_3001064_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052122145.1|3001388_3001826_+	DUF1566 domain-containing protein	NA	NA	NA	NA	NA
WP_043295248.1|3001822_3002119_+	KTSC domain-containing protein	NA	A9YWW2	Burkholderia_phage	70.7	2.4e-32
WP_043295250.1|3002115_3002925_+	hypothetical protein	NA	J7HXJ4	Pseudomonas_phage	59.4	7.5e-89
WP_080751000.1|3002917_3003412_+	hypothetical protein	NA	W6PUJ9	Citrobacter_phage	41.1	9.4e-18
WP_043295253.1|3003432_3004632_+	hypothetical protein	NA	J7HXB6	Pseudomonas_phage	55.0	1.7e-65
WP_043295255.1|3004662_3005544_+	cell division protein FtsK	NA	J7I0T4	Pseudomonas_phage	32.9	5.8e-34
WP_043295257.1|3005540_3007307_+	AAA family ATPase	NA	H2BD46	Pseudomonas_phage	38.0	3.8e-77
WP_043295259.1|3007303_3007918_+	hypothetical protein	NA	A9YX18	Burkholderia_phage	100.0	1.3e-21
WP_043295261.1|3008013_3008376_+	DUF1566 domain-containing protein	NA	NA	NA	NA	NA
WP_043295263.1|3008406_3008871_+	DUF1566 domain-containing protein	NA	NA	NA	NA	NA
WP_043295266.1|3008885_3009242_+	four helix bundle protein	NA	NA	NA	NA	NA
WP_043295268.1|3009585_3010584_+	RNA-directed DNA polymerase	NA	H7BVN7	unidentified_phage	33.9	3.2e-41
WP_080751012.1|3010633_3011311_+	DNA cytosine methyltransferase	NA	A0A0H5AU88	Pseudomonas_phage	55.6	1.5e-61
WP_043295270.1|3012523_3012964_+	hypothetical protein	NA	A0A2H4PD52	Mycobacterium_phage	46.8	6.2e-21
WP_155295671.1|3012944_3013433_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043295274.1|3013429_3013762_+	hypothetical protein	NA	A9YWU9	Burkholderia_phage	55.1	1.7e-10
WP_043295276.1|3013761_3013983_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_043295278.1|3013979_3015011_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B1P9F9	Acinetobacter_phage	35.2	3.8e-45
3015163:3015182	attR	TCGTGGTGCCGGGGACCGGA	NA	NA	NA	NA
>prophage 10
NZ_CP004385	Burkholderia thailandensis MSMB59 chromosome 1, complete sequence	3916324	3469029	3479911	3916324	protease	Agrobacterium_phage(16.67%)	8	NA	NA
WP_009892610.1|3469029_3471330_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	41.9	5.1e-167
WP_009892611.1|3471326_3471641_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A218MMY6	uncultured_virus	44.6	2.6e-13
WP_004196460.1|3472171_3472375_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	81.8	6.8e-23
WP_009892614.1|3474243_3475503_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	63.0	6.8e-12
WP_009892615.1|3475767_3476346_+	pseudouridine synthase	NA	NA	NA	NA	NA
WP_080511442.1|3476606_3476822_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011401863.1|3477017_3477533_+	DUF192 domain-containing protein	NA	A0A1B1IUW8	uncultured_Mediterranean_phage	41.2	1.5e-13
WP_009892620.1|3477796_3479911_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	26.8	1.2e-56
>prophage 11
NZ_CP004385	Burkholderia thailandensis MSMB59 chromosome 1, complete sequence	3916324	3570672	3647892	3916324	plate,transposase,integrase,protease,tail,head	Burkholderia_virus(54.39%)	87	3634278:3634293	3654072:3654087
WP_011401833.1|3570672_3572160_-|protease	DegQ family serine endoprotease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	32.1	2.0e-26
WP_009892756.1|3572378_3573695_-	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	29.6	2.4e-20
WP_009892758.1|3573698_3574361_-	response regulator	NA	NA	NA	NA	NA
WP_080751013.1|3574631_3576083_+	D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase	NA	NA	NA	NA	NA
WP_009892762.1|3576393_3577305_+	sterol desaturase family protein	NA	NA	NA	NA	NA
WP_009892763.1|3577395_3578535_+	acylhydrolase	NA	NA	NA	NA	NA
WP_009892764.1|3578875_3579901_-	threonylcarbamoyl-AMP synthase	NA	A0A291ATS8	Pandoravirus	39.1	5.7e-41
WP_009892765.1|3579912_3581109_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_009892766.1|3581187_3581706_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
WP_009892767.1|3581741_3582632_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0M4JBD3	Mollivirus	38.1	2.5e-53
WP_004190157.1|3582819_3583884_-	fructose-bisphosphate aldolase class II	NA	NA	NA	NA	NA
WP_043295309.1|3584167_3585604_-	pyruvate kinase	NA	NA	NA	NA	NA
WP_009903111.1|3585933_3587127_-	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_009892778.1|3587403_3587727_-	AzlD domain-containing protein	NA	NA	NA	NA	NA
WP_009892779.1|3587723_3588485_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_009892780.1|3588707_3589631_+	branched-chain amino acid transaminase	NA	NA	NA	NA	NA
WP_004197553.1|3589696_3589894_+	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_011401829.1|3590021_3591062_+	lipopolysaccharide heptosyltransferase II	NA	NA	NA	NA	NA
WP_004189144.1|3591193_3591640_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_009892784.1|3591659_3592694_+	hydrolase	NA	NA	NA	NA	NA
WP_009892785.1|3592686_3593304_+	DUF2946 family protein	NA	NA	NA	NA	NA
WP_080556710.1|3593557_3595282_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_009892788.1|3595414_3595909_+	cyclic pyranopterin monophosphate synthase MoaC	NA	NA	NA	NA	NA
WP_009892790.1|3596089_3596455_-	TonB family protein	NA	NA	NA	NA	NA
WP_009908511.1|3596695_3597166_-	DUF2501 domain-containing protein	NA	NA	NA	NA	NA
WP_009908510.1|3597801_3598905_+	acyltransferase	NA	A9YX16	Burkholderia_phage	46.7	2.4e-85
WP_099975807.1|3599041_3599746_-|tail	phage tail protein	tail	A9YX14	Burkholderia_phage	78.5	1.2e-90
WP_038798108.1|3601056_3601638_-|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	90.2	6.2e-93
WP_009910798.1|3601630_3602782_-|plate	baseplate J/gp47 family protein	plate	Q6QI99	Burkholderia_phage	93.5	1.4e-197
WP_009910797.1|3602778_3603132_-|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	99.1	2.0e-62
WP_009910796.1|3603185_3603788_-|plate	phage baseplate assembly protein V	plate	A4JWL4	Burkholderia_virus	97.0	1.9e-100
WP_009910793.1|3603784_3604993_-	hypothetical protein	NA	A4JWL3	Burkholderia_virus	98.8	2.7e-215
WP_009910792.1|3604980_3605190_-	membrane protein	NA	Q6QIA3	Burkholderia_phage	94.2	3.1e-31
WP_025992381.1|3605189_3606080_-|tail	phage tail protein	tail	Q6QIA4	Burkholderia_phage	99.2	9.7e-106
WP_009910789.1|3606081_3608694_-|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	96.4	0.0e+00
WP_009910787.1|3608723_3608966_+	hypothetical protein	NA	A4JWK9	Burkholderia_virus	95.0	1.7e-33
WP_050791341.1|3608968_3609172_-	hypothetical protein	NA	Q6QIA7	Burkholderia_phage	95.5	3.7e-29
WP_025992380.1|3609098_3609428_-|tail	phage tail assembly protein	tail	A4JWK7	Burkholderia_virus	93.6	3.8e-47
WP_009910782.1|3609549_3610074_-|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	97.1	7.2e-93
WP_009910781.1|3610076_3611510_-|tail	tail protein	tail	A4JWK5	Burkholderia_virus	97.1	5.7e-265
WP_009910780.1|3611513_3611759_-	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	98.8	5.3e-38
WP_009910779.1|3611755_3612220_-	hypothetical protein	NA	A4JWK3	Burkholderia_virus	96.8	5.3e-79
WP_009910777.1|3612219_3612672_-	DUF1320 domain-containing protein	NA	A4JWK2	Burkholderia_virus	99.3	6.1e-80
WP_009910776.1|3612673_3613006_-	DUF2190 family protein	NA	A4JWK1	Burkholderia_virus	100.0	1.5e-51
WP_038708155.1|3613080_3614004_-	hypothetical protein	NA	A4JWK0	Burkholderia_virus	98.7	2.2e-169
WP_009910773.1|3614049_3615165_-	peptidase	NA	A4JWJ9	Burkholderia_virus	91.9	5.2e-197
WP_009910771.1|3615379_3615907_-	phage virion morphogenesis protein	NA	A4JWJ7	Burkholderia_virus	100.0	2.8e-92
WP_009910770.1|3615903_3616740_-|head	phage head morphogenesis protein	head	A4JWJ6	Burkholderia_virus	100.0	2.7e-166
WP_009910769.1|3616732_3618208_-	DUF935 domain-containing protein	NA	A4JWJ5	Burkholderia_virus	99.6	2.1e-283
WP_009910768.1|3618204_3619707_-	hypothetical protein	NA	A4JWJ4	Burkholderia_virus	100.0	1.8e-293
WP_009910765.1|3619703_3620249_-	DUF3486 family protein	NA	A4JWJ3	Burkholderia_virus	100.0	3.0e-89
WP_006485389.1|3620250_3620583_-	hypothetical protein	NA	Q6QIC3	Burkholderia_phage	100.0	8.7e-60
WP_025992379.1|3620579_3620918_-	hypothetical protein	NA	A4JWP6	Burkholderia_virus	99.1	1.4e-52
WP_038708154.1|3620914_3621514_-	hypothetical protein	NA	A4JWP5	Burkholderia_virus	90.5	4.1e-92
WP_009910760.1|3621510_3622122_-	transglycosylase SLT domain-containing protein	NA	Q6QIC7	Burkholderia_phage	97.5	4.5e-110
WP_006485400.1|3622124_3622472_-	membrane protein	NA	Q6QIC8	Burkholderia_phage	100.0	8.0e-56
WP_009910759.1|3622538_3622763_-	hypothetical protein	NA	A4JWP2	Burkholderia_virus	100.0	1.9e-34
WP_009910758.1|3622830_3623367_-	hypothetical protein	NA	A4JWP1	Burkholderia_virus	98.3	3.7e-92
WP_009910756.1|3623347_3623536_-	hypothetical protein	NA	A4JWP0	Burkholderia_virus	100.0	5.0e-28
WP_009910755.1|3623609_3624389_-	hypothetical protein	NA	A4JWN9	Burkholderia_virus	100.0	5.3e-140
WP_099975851.1|3624385_3624826_-	transcriptional regulator	NA	A4JWN8	Burkholderia_virus	99.3	4.7e-69
WP_009910751.1|3624937_3625120_+	DNA-binding protein	NA	A4JWN7	Burkholderia_virus	100.0	4.8e-28
WP_025992377.1|3625165_3625402_-	hypothetical protein	NA	Q6QID5	Burkholderia_phage	98.7	6.2e-36
WP_025992376.1|3625522_3626002_+	hypothetical protein	NA	A4JWN5	Burkholderia_virus	100.0	1.7e-88
WP_009910747.1|3625998_3626304_+	helix-turn-helix domain-containing protein	NA	A4JWN4	Burkholderia_virus	100.0	4.9e-49
WP_009910745.1|3626316_3627234_+	DUF3102 domain-containing protein	NA	A4JWN3	Burkholderia_virus	100.0	2.3e-163
WP_025992375.1|3627251_3629051_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A4JWN2	Burkholderia_virus	99.7	0.0e+00
WP_009910741.1|3629050_3630262_+	AAA family ATPase	NA	A4JWN1	Burkholderia_virus	98.8	1.4e-219
WP_009910739.1|3630263_3630593_+	hypothetical protein	NA	Q6QIE2	Burkholderia_phage	89.8	3.6e-50
WP_009910738.1|3630589_3630799_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009910737.1|3630922_3631540_+	DUF3164 family protein	NA	A4JWM8	Burkholderia_virus	99.5	6.3e-112
WP_009910736.1|3631603_3631876_+	HU family DNA-binding protein	NA	A4JWM7	Burkholderia_virus	96.7	8.2e-40
WP_025992374.1|3631969_3632311_+	DUF2528 family protein	NA	Q6QIE6	Burkholderia_phage	95.6	4.2e-57
WP_025992373.1|3632294_3632735_+	regulatory protein GemA	NA	Q6QIE7	Burkholderia_phage	95.2	3.1e-73
WP_006485401.1|3632731_3633103_+	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	100.0	8.5e-64
WP_009892793.1|3633569_3635357_-	polymerase	NA	NA	NA	NA	NA
3634278:3634293	attL	GCCGAGACCGAGCAAG	NA	NA	NA	NA
WP_043037212.1|3635597_3636116_-	pilin	NA	NA	NA	NA	NA
WP_009892795.1|3636335_3637049_-	TerC family protein	NA	A0A2R2YAT9	Pseudomonas_phage	45.2	8.2e-39
WP_009892797.1|3637200_3638082_-	succinate--CoA ligase subunit alpha	NA	NA	NA	NA	NA
WP_009892798.1|3638228_3639395_-	ADP-forming succinate--CoA ligase subunit beta	NA	NA	NA	NA	NA
WP_009910729.1|3639474_3640086_-	DUF2889 domain-containing protein	NA	NA	NA	NA	NA
WP_025992372.1|3640349_3641327_-	recombination regulator RecX	NA	NA	NA	NA	NA
WP_009892802.1|3641326_3642397_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	65.5	2.5e-116
WP_025369554.1|3642602_3643346_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_009892804.1|3643375_3644929_+	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	27.2	3.6e-15
WP_009892806.1|3645151_3646810_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_099975840.1|3647232_3647892_-|integrase	tyrosine-type recombinase/integrase	integrase	F1BUS9	Erwinia_phage	55.5	2.1e-57
3654072:3654087	attR	GCCGAGACCGAGCAAG	NA	NA	NA	NA
>prophage 1
NZ_CP004386	Burkholderia thailandensis MSMB59 chromosome 2, complete sequence	2823176	1684340	1743652	2823176	transposase,plate	Xanthomonas_phage(25.0%)	46	NA	NA
WP_009894757.1|1684340_1684859_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_009894755.1|1684860_1686741_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_009894753.1|1686737_1687787_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_009894751.1|1687805_1688876_+	type VI secretion protein ImpA	NA	NA	NA	NA	NA
WP_009894750.1|1688931_1689960_+	fimbrial protein	NA	NA	NA	NA	NA
WP_038707671.1|1689992_1691351_+	hypothetical protein	NA	A0A292GJ55	Xanthomonas_phage	49.7	2.6e-110
WP_025992055.1|1691243_1694696_-	RHS repeat protein	NA	NA	NA	NA	NA
WP_004523693.1|1694708_1694978_-	PAAR motif protein	NA	NA	NA	NA	NA
WP_080751021.1|1695052_1697638_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	26.0	1.8e-35
WP_009894738.1|1697705_1698275_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009894736.1|1698444_1702353_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_009894733.1|1702367_1703669_-	type VI secretion system protein TssL	NA	NA	NA	NA	NA
WP_009894732.1|1703665_1705015_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_011400803.1|1705020_1705563_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_009894730.1|1705690_1706173_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_009894729.1|1706373_1707873_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_009894728.1|1707906_1708446_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_009894727.1|1708789_1710466_-	OmpA family protein	NA	NA	NA	NA	NA
WP_080751036.1|1710468_1711125_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_025988574.1|1711188_1711761_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_080511335.1|1711753_1714387_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_025370058.1|1714609_1715350_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_011400800.1|1715416_1715971_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_009907087.1|1716752_1717151_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080556626.1|1717365_1718853_+	PhoPQ-regulated protein	NA	NA	NA	NA	NA
WP_043295637.1|1718928_1721244_-	hypothetical protein	NA	K4F7R4	Cronobacter_phage	46.1	8.4e-08
WP_154660021.1|1722088_1722445_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099005207.1|1722742_1723500_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_009907084.1|1723607_1725149_+	membrane protein	NA	NA	NA	NA	NA
WP_038707668.1|1726157_1728224_+	FUSC family protein	NA	NA	NA	NA	NA
WP_009894707.1|1728220_1728445_+	DUF1656 domain-containing protein	NA	NA	NA	NA	NA
WP_009894706.1|1728446_1729346_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_009894704.1|1729339_1730773_+	TolC family protein	NA	NA	NA	NA	NA
WP_009894703.1|1730772_1731972_+	transcriptional regulator CynR	NA	NA	NA	NA	NA
WP_009894702.1|1732104_1732350_+	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_127446348.1|1732477_1732789_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009894700.1|1732977_1733301_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009907082.1|1733862_1734786_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_009894697.1|1735417_1736560_+	porin	NA	NA	NA	NA	NA
WP_009894695.1|1737036_1737393_+	DUF4148 domain-containing protein	NA	NA	NA	NA	NA
WP_004523719.1|1738202_1738895_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009894689.1|1739367_1739694_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_004523721.1|1739713_1740133_+	YjbQ family protein	NA	NA	NA	NA	NA
WP_043295640.1|1740547_1740811_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_043295642.1|1740820_1742356_-	DUF2875 domain-containing protein	NA	NA	NA	NA	NA
WP_155295690.1|1742441_1743652_-|transposase	IS3-like element ISButh2 family transposase	transposase	A0A1B0Z042	Pseudomonas_phage	62.7	3.5e-98
>prophage 2
NZ_CP004386	Burkholderia thailandensis MSMB59 chromosome 2, complete sequence	2823176	2437768	2508319	2823176	holin,plate	Vibrio_phage(25.0%)	53	NA	NA
WP_009893784.1|2437768_2438536_-|holin	phosphocholine cytidylyltransferase family protein	holin	NA	NA	NA	NA
WP_009907987.1|2438574_2439576_-	HpnL family protein	NA	NA	NA	NA	NA
WP_009907986.1|2439572_2440346_-	2OG-Fe(II) oxygenase	NA	NA	NA	NA	NA
WP_009907985.1|2440342_2441038_-	CDP-alcohol phosphatidyltransferase family protein	NA	NA	NA	NA	NA
WP_009893778.1|2441400_2442915_+	acetyl-CoA hydrolase/transferase family protein	NA	NA	NA	NA	NA
WP_009907984.1|2444535_2445480_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009901015.1|2445513_2446065_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_015602570.1|2446061_2447573_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_009901013.1|2447716_2448244_+	type VI secretion protein	NA	NA	NA	NA	NA
WP_009901012.1|2448322_2448754_+	GPW/gp25 family protein	NA	NA	NA	NA	NA
WP_009901011.1|2448767_2450630_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_009893772.1|2450626_2451616_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_009893771.1|2451618_2454462_+	type VI secretion system ATPase TssH	NA	A0A2I7REQ1	Vibrio_phage	27.0	1.2e-61
WP_011401423.1|2454452_2456744_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_009893768.1|2456912_2459201_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_009893766.1|2459204_2461421_+	DUF2169 domain-containing protein	NA	NA	NA	NA	NA
WP_009893765.1|2461420_2462491_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_009893763.1|2462493_2463210_+	DUF3540 domain-containing protein	NA	NA	NA	NA	NA
WP_009893761.1|2463249_2463639_+	DUF4150 domain-containing protein	NA	NA	NA	NA	NA
WP_009893760.1|2463644_2464238_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009893759.1|2464234_2465596_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_011401420.1|2465621_2467406_+	OmpA family protein	NA	NA	NA	NA	NA
WP_009893757.1|2467402_2470897_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_009893756.1|2470955_2471315_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025992137.1|2471337_2471769_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011401418.1|2471989_2472361_+	hypothetical protein	NA	NA	NA	NA	NA
WP_102815683.1|2472537_2472654_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041223615.1|2474116_2475385_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_009896564.1|2475381_2476953_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_009896566.1|2477085_2478051_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_025404178.1|2478103_2479666_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_025404204.1|2479860_2481129_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_011401416.1|2481580_2483254_-	glycoside hydrolase family 32 protein	NA	F8WPR5	Bacillus_phage	31.0	3.0e-55
WP_080511309.1|2483372_2484944_-	glycoside hydrolase 68 family protein	NA	NA	NA	NA	NA
WP_009907975.1|2485130_2486147_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_009898059.1|2486492_2487692_+	formaldehyde dehydrogenase, glutathione-independent	NA	A0A2K9L7I1	Tupanvirus	26.8	1.1e-11
WP_009898058.1|2487877_2488903_-	GlxA family transcriptional regulator	NA	NA	NA	NA	NA
WP_080511307.1|2489060_2489300_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009898057.1|2489311_2490586_+	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	53.4	6.9e-105
WP_009907974.1|2490657_2491629_+	membrane dipeptidase	NA	NA	NA	NA	NA
WP_009898053.1|2491776_2492310_+	4-vinyl reductase	NA	NA	NA	NA	NA
WP_009907973.1|2492370_2494434_+	NADH:flavin oxidoreductase	NA	NA	NA	NA	NA
WP_009898050.1|2494436_2496362_+	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_009907972.1|2496366_2497548_+	electron transfer flavoprotein subunit alpha/FixB family protein	NA	NA	NA	NA	NA
WP_009898046.1|2497544_2498330_+	drug:proton antiporter	NA	NA	NA	NA	NA
WP_009898044.1|2498381_2499623_+	aromatic ring-hydroxylating dioxygenase subunit alpha	NA	NA	NA	NA	NA
WP_009898043.1|2499643_2500783_+	hybrid-cluster NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_009898041.1|2500892_2501756_+	glycine betaine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_009898039.1|2501935_2503591_+	APC family permease	NA	NA	NA	NA	NA
WP_009898038.1|2503677_2504553_-	formyltetrahydrofolate deformylase	NA	NA	NA	NA	NA
WP_011401414.1|2504696_2505596_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_009907971.1|2505731_2507285_+|holin	choline-sulfatase	holin	NA	NA	NA	NA
WP_050791319.1|2507320_2508319_+|holin	choline ABC transporter substrate-binding protein	holin	NA	NA	NA	NA
