The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP016829	Corynebacterium pseudotuberculosis strain MB20 chromosome, complete genome	2370901	690923	765329	2370901	integrase,bacteriocin,protease	Tupanvirus(18.18%)	56	716839:716866	722754:722781
WP_032802571.1|690923_691223_+|protease	ATP-dependent Clp protease adapter ClpS	protease	NA	NA	NA	NA
WP_013242516.1|691317_691854_+	DUF2017 domain-containing protein	NA	NA	NA	NA	NA
WP_014367517.1|691940_692759_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_014523555.1|693800_694568_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_032802570.1|694606_695341_+	ribonuclease PH	NA	NA	NA	NA	NA
WP_014367514.1|695337_695961_+	RdgB/HAM1 family non-canonical purine NTP pyrophosphatase	NA	NA	NA	NA	NA
WP_014367513.1|696029_696389_-	DUF3817 domain-containing protein	NA	NA	NA	NA	NA
WP_014367512.1|696476_696923_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014524035.1|698680_699439_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014367509.1|699620_700652_-	DUF418 domain-containing protein	NA	NA	NA	NA	NA
WP_014367508.1|700695_701322_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_014523552.1|701318_702245_-	two-component sensor histidine kinase	NA	NA	NA	NA	NA
WP_014523551.1|702599_702905_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013242501.1|712361_712751_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_013242500.1|712763_713417_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_013242499.1|713454_713934_-	thioredoxin-dependent thiol peroxidase	NA	NA	NA	NA	NA
WP_013242498.1|714022_714298_+	DUF3618 domain-containing protein	NA	NA	NA	NA	NA
WP_013242496.1|714773_715388_-	isochorismatase family protein	NA	A0A2K9L2K0	Tupanvirus	32.6	7.6e-17
WP_014367502.1|715527_716526_-	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
716839:716866	attL	GTGCGCCATCAGGGACTTGAACCCCGAA	NA	NA	NA	NA
WP_014367498.1|717569_718127_-	recombinase family protein	NA	M9Q1K0	Clostridium_phage	46.2	4.0e-33
WP_052399380.1|719583_720021_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032802512.1|720017_721022_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_080713377.1|721473_721986_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_050494099.1|721928_722606_-	hypothetical protein	NA	A0A1X9SFC1	Mycobacterium_phage	34.0	5.1e-22
WP_014523549.1|723224_724415_+	L,D-transpeptidase	NA	NA	NA	NA	NA
722754:722781	attR	GTGCGCCATCAGGGACTTGAACCCCGAA	NA	NA	NA	NA
WP_014367495.1|724468_725296_-	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_014523548.1|725475_726135_-	oligoribonuclease	NA	M4M9I5	Vibrio_phage	35.0	8.4e-22
WP_014523547.1|726200_727004_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_014733040.1|727130_728126_-	oxidoreductase	NA	NA	NA	NA	NA
WP_014367490.1|728401_730228_+	S8 family peptidase	NA	A0A1B0T6A2	Bacillus_phage	31.8	6.8e-29
WP_014367489.1|730568_730769_-	YbdD/YjiX family protein	NA	NA	NA	NA	NA
WP_014367486.1|733665_735711_+	bifunctional copper resistance protein CopD/cytochrome c oxidase assembly protein	NA	NA	NA	NA	NA
WP_014367485.1|735801_736725_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	26.1	4.2e-19
WP_014367484.1|736721_737480_+	permease	NA	NA	NA	NA	NA
WP_043014356.1|737501_738791_-	YcaO-like family protein	NA	NA	NA	NA	NA
WP_014367482.1|739034_739205_-|bacteriocin	thiazolylpeptide-type bacteriocin	bacteriocin	NA	NA	NA	NA
WP_043014375.1|739243_740209_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014367480.1|740222_741236_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014367479.1|741235_743839_-	lantibiotic dehydratase	NA	NA	NA	NA	NA
WP_014523541.1|743835_745314_-	nitroreductase	NA	NA	NA	NA	NA
WP_014367477.1|745340_746879_-	YcaO-like family protein	NA	NA	NA	NA	NA
WP_014367476.1|746875_748630_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014367473.1|749158_749719_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_014522869.1|749908_751579_+	energy-dependent translational throttle protein EttA	NA	A0A2K9L0W2	Tupanvirus	27.9	1.3e-47
WP_013242474.1|751786_752215_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_014367472.1|753741_754134_-	globin	NA	NA	NA	NA	NA
WP_014523536.1|754252_754831_-	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_014367469.1|755252_757868_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	29.7	5.9e-42
WP_014367467.1|758201_758822_+	DSBA oxidoreductase	NA	NA	NA	NA	NA
WP_013242465.1|758888_759362_+	ribose-5-phosphate isomerase	NA	NA	NA	NA	NA
WP_014367466.1|759479_760490_+	pirin family protein	NA	NA	NA	NA	NA
WP_014523535.1|760576_761353_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014300878.1|761489_761732_-	hypothetical protein	NA	A0A1W6JRB8	Corynebacterium_phage	48.4	3.9e-09
WP_014524025.1|762521_763874_+	trigger factor	NA	NA	NA	NA	NA
WP_013242460.1|764084_764684_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	48.3	1.3e-42
WP_013242459.1|764699_765329_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	43.5	1.4e-37
>prophage 2
NZ_CP016829	Corynebacterium pseudotuberculosis strain MB20 chromosome, complete genome	2370901	1422702	1431163	2370901	holin	Pandoravirus(33.33%)	11	NA	NA
WP_014300955.1|1422702_1423284_+	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	31.4	3.0e-15
WP_088428658.1|1423328_1425284_+	ATP-dependent metallopeptidase FtsH/Yme1/Tma family protein	NA	E5EQU5	Bathycoccus_sp._RCC1105_virus	50.3	7.6e-111
WP_014367628.1|1425276_1425840_+	GTP cyclohydrolase I FolE	NA	A0A1W7AF02	Streptococcus_virus	57.8	2.6e-48
WP_014523608.1|1425841_1426624_+	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	32.2	6.5e-21
WP_014655799.1|1426610_1426952_+	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_014367625.1|1426953_1427409_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	S4W084	Pandoravirus	33.8	1.1e-09
WP_013242641.1|1427405_1427852_+	DUF3180 domain-containing protein	NA	NA	NA	NA	NA
WP_014367624.1|1427862_1428378_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014367623.1|1428374_1428761_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014367622.1|1428768_1429437_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014367621.1|1429414_1431163_-|holin	choline dehydrogenase	holin	A0A1V0SI18	Klosneuvirus	31.5	4.9e-61
