The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP009576	Listeria ivanovii subsp. londoniensis strain WSLC 30151 chromosome, complete genome	3045035	125484	164893	3045035	terminase,portal,holin,capsid,integrase,protease	Listeria_phage(92.31%)	56	126543:126586	165534:165577
WP_003718156.1|125484_126429_+	glyoxylate reductase	NA	A0A2R8FDS8	Brazilian_cedratvirus	37.1	4.0e-33
126543:126586	attL	ACTCTTAATCAGCGGGTCGTGGGTTCGAACCCCTCACAACCCAT	NA	NA	NA	NA
WP_038406391.1|126690_127848_-|integrase	site-specific integrase	integrase	A0A0B5CTW8	Listeria_phage	55.7	8.7e-123
WP_038406393.1|127927_128494_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038406394.1|128518_129046_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A1S7FYX8	Listeria_phage	69.7	2.6e-66
WP_038406396.1|129061_129397_-	helix-turn-helix transcriptional regulator	NA	A0A1S7FZ25	Listeria_phage	58.7	2.5e-30
WP_038406397.1|129670_129847_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_158423288.1|129864_130578_+	phage regulatory protein	NA	A0A0P0IDD0	Lactobacillus_phage	47.8	3.5e-29
WP_038406398.1|130567_130768_+	helix-turn-helix domain-containing protein	NA	A0A1S7FYV9	Listeria_phage	71.9	1.9e-17
WP_038406399.1|130760_131036_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038406400.1|131032_131311_+	hypothetical protein	NA	A0A1S7FYW4	Listeria_phage	79.3	1.9e-28
WP_077916388.1|131332_131662_+	DUF3310 domain-containing protein	NA	A6M9A0	Geobacillus_virus	53.8	7.9e-13
WP_038406402.1|131654_131885_+	hypothetical protein	NA	A0A1S7FYX1	Listeria_phage	56.6	1.4e-11
WP_038406403.1|131872_132064_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038406404.1|132060_132678_+	hypothetical protein	NA	A0A1S7FZ47	Listeria_phage	38.5	1.4e-10
WP_038406405.1|132679_133861_+	DUF2800 domain-containing protein	NA	A0A1S7FYX0	Listeria_phage	77.6	8.2e-177
WP_038406406.1|133878_134466_+	DUF2815 family protein	NA	A0A1S7FZ05	Listeria_phage	63.7	2.6e-54
WP_077916432.1|134759_136397_+	DNA polymerase	NA	A0A1S7FZ18	Listeria_phage	82.0	1.1e-269
WP_038406408.1|136597_137056_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038406409.1|137052_137289_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038406411.1|137285_137840_+	hypothetical protein	NA	B6D7K8	Listeria_phage	30.9	7.8e-13
WP_038406412.1|137826_138060_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038406414.1|138335_138566_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038406416.1|138562_138865_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038406418.1|139124_141563_+	phage-like protein	NA	A0A1S7FZ15	Listeria_phage	83.0	0.0e+00
WP_038406419.1|141875_142157_+	type VI secretion protein	NA	A0A1S7FZ22	Listeria_phage	67.8	1.7e-27
WP_038408097.1|142165_143545_+	DEAD/DEAH box helicase	NA	A0A1S7FYY5	Listeria_phage	81.0	1.7e-218
WP_077916433.1|143528_143894_+	nucleoside triphosphate pyrophosphohydrolase family protein	NA	A0A1S7FYY8	Listeria_phage	57.8	5.7e-28
WP_038406421.1|143893_144076_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038406422.1|144072_144615_+	hypothetical protein	NA	A0A1S7FZ07	Listeria_phage	75.9	7.1e-67
WP_119878138.1|144746_145055_+	HNH endonuclease	NA	A0A1S7FZ53	Listeria_phage	87.3	4.6e-47
WP_038406423.1|145178_145532_+|terminase	terminase	terminase	A0A1S7FYW6	Listeria_phage	79.5	8.4e-45
WP_038406424.1|145518_147165_+|terminase	terminase large subunit	terminase	A0A1S7FZ68	Listeria_phage	87.6	3.7e-292
WP_038406425.1|147176_148385_+|portal	phage portal protein	portal	A0A1S7FYX7	Listeria_phage	84.7	1.1e-192
WP_038406426.1|148381_149218_+|protease	Clp protease ClpP	protease	A0A1S7FZ23	Listeria_phage	70.9	2.7e-102
WP_038406427.1|149251_150397_+|capsid	phage major capsid protein	capsid	A0A1S7FZ31	Listeria_phage	87.4	1.2e-188
WP_003768828.1|150534_150831_+	hypothetical protein	NA	A0A1S7FYY9	Listeria_phage	69.5	1.2e-31
WP_096867865.1|150940_151147_+	hypothetical protein	NA	A0A1S7FZ08	Listeria_phage	79.1	1.6e-24
WP_038406430.1|151148_151550_+	hypothetical protein	NA	A0A1S7FYZ7	Listeria_phage	65.6	2.8e-44
WP_038406431.1|151536_151962_+	hypothetical protein	NA	A0A1S7FZ20	Listeria_phage	82.9	7.2e-59
WP_038406432.1|151978_152566_+	hypothetical protein	NA	A0A1S7FZ79	Listeria_phage	72.8	6.0e-80
WP_077916389.1|152576_152831_+	plasmid partitioning protein	NA	NA	NA	NA	NA
WP_038406433.1|152886_153258_+	hypothetical protein	NA	A0A1S7FZ84	Listeria_phage	68.3	5.4e-42
WP_038406434.1|153437_157832_+	hypothetical protein	NA	A0A1S7FYZ4	Listeria_phage	68.8	0.0e+00
WP_038406436.1|157828_158740_+	hypothetical protein	NA	A0A1S7FZ36	Listeria_phage	76.3	4.1e-136
WP_038406437.1|158739_159768_+	aspartate-semialdehyde dehydrogenase	NA	A0A1S7FZ49	Listeria_phage	76.3	1.8e-151
WP_038406438.1|159769_160540_+	hypothetical protein	NA	A0A1S7FZ03	Listeria_phage	68.8	1.7e-106
WP_144242632.1|160536_160875_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077916390.1|160874_161012_+	XkdX family protein	NA	A0A059T6D9	Listeria_phage	75.6	2.8e-12
WP_038406440.1|161049_161271_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038406441.1|161272_161683_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038406443.1|161689_161947_+|holin	phage holin	holin	A8ATB7	Listeria_phage	68.2	4.6e-24
WP_038406444.1|161949_162810_+	N-acetylmuramoyl-L-alanine amidase family protein	NA	Q0PRU8	Listeria_phage	87.5	2.1e-150
WP_052010516.1|163133_163517_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052010519.1|163509_164229_+	type II toxin-antitoxin system MqsA family antitoxin	NA	NA	NA	NA	NA
WP_038406445.1|164212_164605_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038406447.1|164686_164893_-	hypothetical protein	NA	A0A059T7Z0	Listeria_phage	86.2	3.9e-18
165534:165577	attR	ACTCTTAATCAGCGGGTCGTGGGTTCGAACCCCTCACAACCCAT	NA	NA	NA	NA
>prophage 2
NZ_CP009576	Listeria ivanovii subsp. londoniensis strain WSLC 30151 chromosome, complete genome	3045035	198266	208997	3045035	holin,tail	Listeria_phage(36.36%)	17	NA	NA
WP_003718205.1|198266_198719_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A059T7S0	Listeria_phage	49.3	4.3e-33
WP_003718206.1|198724_199060_-	helix-turn-helix transcriptional regulator	NA	A0A2H4JAR9	uncultured_Caudovirales_phage	52.5	1.8e-20
WP_038408106.1|199284_199713_+	hypothetical protein	NA	A8ATZ8	Listeria_phage	44.9	1.5e-11
WP_038406483.1|199725_200145_+	hypothetical protein	NA	A8ASQ1	Listeria_phage	38.6	6.5e-20
WP_077916392.1|200423_200795_+	DUF5072 family protein	NA	NA	NA	NA	NA
WP_038406485.1|200807_201320_+|tail	phage major tail protein, TP901-1 family	tail	A0A097PBF4	Streptococcus_pyogenes_phage	63.4	3.4e-47
WP_038406486.1|201367_201670_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052010522.1|201675_202113_+	hypothetical protein	NA	A0A097PAX1	Streptococcus_pyogenes_phage	42.0	9.5e-22
WP_038406488.1|202102_203968_+	membrane protein	NA	A0A097PAU2	Streptococcus_pyogenes_phage	47.3	7.2e-18
WP_038406489.1|203967_204786_+|tail	phage tail family protein	tail	A0A2H4J4B7	uncultured_Caudovirales_phage	33.2	7.0e-42
WP_038406490.1|204795_205932_+	minor structural protein	NA	A8ATA9	Listeria_phage	27.1	2.2e-46
WP_038406491.1|205921_206221_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038406492.1|206235_206811_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038406493.1|206825_207305_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038406494.1|207301_207838_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003745164.1|207856_208279_+|holin	holin family protein	holin	Q2I8E7	Bacillus_phage	45.6	7.3e-27
WP_038406495.1|208259_208997_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A0N9SGH1	Paenibacillus_phage	46.3	1.5e-35
>prophage 3
NZ_CP009576	Listeria ivanovii subsp. londoniensis strain WSLC 30151 chromosome, complete genome	3045035	756497	789787	3045035	terminase,portal,holin,capsid,plate,integrase,tail,head,protease	Listeria_phage(54.29%)	44	750425:750439	762281:762295
750425:750439	attL	GTAGAAATCGAAAAA	NA	NA	NA	NA
WP_038406787.1|756497_757643_-|integrase	site-specific integrase	integrase	A0A1S5S7K9	Streptococcus_phage	39.9	1.5e-63
WP_038406788.1|757771_758098_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052010549.1|758113_758581_-	hypothetical protein	NA	D7RWF1	Brochothrix_phage	48.9	1.3e-05
WP_038406789.1|758632_759085_-	ImmA/IrrE family metallo-endopeptidase	NA	R4IBK9	Listeria_phage	90.7	2.2e-77
WP_033922848.1|759101_759425_-	helix-turn-helix transcriptional regulator	NA	R4IDX0	Listeria_phage	73.8	5.3e-38
WP_033922846.1|759692_759884_+	helix-turn-helix transcriptional regulator	NA	A0A059T5F8	Listeria_phage	85.5	1.2e-21
WP_009917612.1|759902_760091_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038406791.1|760115_760301_+	hypothetical protein	NA	A8ATD3	Listeria_phage	83.6	2.1e-23
WP_038406792.1|761056_761488_+	hypothetical protein	NA	R4IDY1	Listeria_phage	69.8	1.8e-49
WP_038406793.1|761484_761775_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023553777.1|761947_762160_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038406794.1|762181_762472_+	hypothetical protein	NA	NA	NA	NA	NA
762281:762295	attR	GTAGAAATCGAAAAA	NA	NA	NA	NA
WP_052010626.1|762601_762883_+	hypothetical protein	NA	R4IBK0	Listeria_phage	100.0	7.4e-36
WP_038406795.1|762883_763306_+	hypothetical protein	NA	Q8W5W4	Listeria_phage	98.6	4.3e-72
WP_038406796.1|763472_763673_+	hypothetical protein	NA	A8ATE8	Listeria_phage	54.7	5.9e-11
WP_038406797.1|763669_764281_+	MBL fold metallo-hydrolase	NA	B6D7K1	Listeria_phage	49.5	3.7e-48
WP_038406798.1|764297_764531_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038406799.1|764527_765298_+	DUF1351 domain-containing protein	NA	B6D7K2	Listeria_phage	28.2	6.0e-19
WP_038406800.1|765299_765935_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038406801.1|766000_767692_+	DNA polymerase	NA	A8ATS1	Listeria_phage	42.5	7.5e-123
WP_038406802.1|767694_769500_+	DNA primase	NA	A8ATS2	Listeria_phage	41.0	1.8e-127
WP_077916437.1|770377_771064_+	DUF3310 domain-containing protein	NA	A8ATF5	Listeria_phage	45.8	4.5e-42
WP_038406803.1|771068_771494_+	DUF722 domain-containing protein	NA	A8ATF6	Listeria_phage	98.6	8.8e-73
WP_038406804.1|771587_772331_+	DUF559 domain-containing protein	NA	NA	NA	NA	NA
WP_038406805.1|772851_773226_+	HNH endonuclease	NA	A0A2I7SC48	Paenibacillus_phage	54.1	3.2e-18
WP_038406806.1|773266_773641_+|terminase	P27 family phage terminase small subunit	terminase	A0A0U4JV93	Exiguobacterium_phage	56.0	1.1e-23
WP_038406807.1|773637_775389_+|terminase	terminase large subunit	terminase	A6XMJ4	Bacillus_virus	75.2	4.2e-262
WP_038406808.1|775402_776584_+|portal	phage portal protein	portal	Q0H263	Geobacillus_phage	59.1	4.4e-130
WP_038406809.1|776580_777165_+|head,protease	HK97 family phage prohead protease	head,protease	Q0H262	Geobacillus_phage	53.2	1.9e-46
WP_038406810.1|777155_778343_+|capsid	phage major capsid protein	capsid	A0A2H4J3W9	uncultured_Caudovirales_phage	58.8	8.4e-89
WP_038406811.1|778347_778527_+	hypothetical protein	NA	A0A0U4IS36	Exiguobacterium_phage	48.2	1.3e-09
WP_038406812.1|778526_778817_+	hypothetical protein	NA	A6XMJ8	Bacillus_virus	62.4	6.3e-22
WP_038406813.1|778800_779106_+|head	phage head closure protein	head	Q0H236	Geobacillus_phage	48.0	8.7e-22
WP_038406814.1|779112_779466_+	hypothetical protein	NA	A0A0U4II15	Exiguobacterium_phage	43.6	7.7e-22
WP_038406815.1|779462_779786_+	hypothetical protein	NA	A0A0U4JNN6	Exiguobacterium_phage	45.7	4.9e-15
WP_010991264.1|779786_780365_+|tail	phage tail protein	tail	A0A0U4JWV5	Exiguobacterium_phage	63.8	6.0e-64
WP_038406816.1|780407_780764_+	hypothetical protein	NA	D2XR24	Bacillus_phage	56.8	1.4e-31
WP_038406817.1|780987_784269_+|tail	phage tail protein	tail	D2XR25	Bacillus_phage	44.0	9.5e-74
WP_038406818.1|784265_785006_+	hypothetical protein	NA	Q8W5Z6	Listeria_phage	25.2	6.4e-10
WP_038406819.1|784987_787129_+	hypothetical protein	NA	R4IDV9	Listeria_phage	54.9	1.7e-212
WP_038406820.1|787125_788229_+|plate	BppU family phage baseplate upper protein	plate	Q8W5Z4	Listeria_phage	81.0	1.8e-61
WP_038406821.1|788263_788647_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038406822.1|788666_788924_+|holin	phage holin	holin	A8ATB7	Listeria_phage	68.2	2.7e-24
WP_038406823.1|788926_789787_+	N-acetylmuramoyl-L-alanine amidase family protein	NA	Q0PRU8	Listeria_phage	87.1	4.8e-150
>prophage 4
NZ_CP009576	Listeria ivanovii subsp. londoniensis strain WSLC 30151 chromosome, complete genome	3045035	2012985	2021296	3045035		Synechococcus_phage(50.0%)	8	NA	NA
WP_003720078.1|2012985_2013579_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	39.5	4.1e-28
WP_003720079.1|2013575_2014625_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	43.3	2.0e-65
WP_038407520.1|2014640_2016068_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	34.2	2.4e-53
WP_038407521.1|2016052_2018272_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	40.9	2.3e-156
WP_003720082.1|2018264_2018948_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_003720083.1|2018951_2019197_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_003720084.1|2019208_2019922_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3HWF9	Synechococcus_phage	37.8	2.0e-40
WP_003720085.1|2020003_2021296_-	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	33.0	4.2e-17
>prophage 5
NZ_CP009576	Listeria ivanovii subsp. londoniensis strain WSLC 30151 chromosome, complete genome	3045035	2695608	2703463	3045035		Streptococcus_phage(50.0%)	7	NA	NA
WP_038407850.1|2695608_2696580_-	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	39.4	8.8e-52
WP_038407851.1|2696587_2697556_-	YvcK family protein	NA	A1IMD5	Streptococcus_phage	42.7	9.7e-67
WP_003720786.1|2697557_2698433_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.8	7.0e-08
WP_038407852.1|2698541_2700272_-	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	53.2	1.9e-169
WP_052010617.1|2700317_2701388_-	galactose mutarotase	NA	NA	NA	NA	NA
WP_038407853.1|2701406_2702390_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	37.5	1.3e-50
WP_038407854.1|2702503_2703463_-	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	54.1	8.9e-89
>prophage 6
NZ_CP009576	Listeria ivanovii subsp. londoniensis strain WSLC 30151 chromosome, complete genome	3045035	2893605	2918435	3045035	integrase,transposase	Streptococcus_phage(28.57%)	20	2896519:2896534	2918102:2918117
WP_038408267.1|2893605_2895060_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
2896519:2896534	attL	ACGTCTTTTCTTGTGT	NA	NA	NA	NA
WP_038407973.1|2897724_2898297_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_038407974.1|2898384_2899320_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_038407975.1|2899742_2901542_+	collagen binding domain-containing protein	NA	NA	NA	NA	NA
WP_038407976.1|2901768_2904684_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	36.6	5.5e-174
WP_003728468.1|2904687_2905242_-	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	53.4	7.0e-38
WP_003728467.1|2905521_2905881_+	Cd(II)-sensing metalloregulatory transcriptional repressor CadC	NA	E4ZFI8	Streptococcus_phage	50.0	3.1e-26
WP_003728466.1|2905880_2908016_+	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	64.5	1.6e-247
WP_077916280.1|2908394_2908583_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_158423286.1|2908610_2908811_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038407977.1|2908951_2909554_+	recombinase family protein	NA	A0A1V0E035	Clostridioides_phage	35.7	1.1e-17
WP_038407979.1|2909560_2909773_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038407980.1|2910229_2910514_+	DUF3130 domain-containing protein	NA	NA	NA	NA	NA
WP_038407982.1|2910514_2910883_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038407983.1|2910879_2912304_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038407985.1|2912897_2913158_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077916282.1|2913498_2914812_+	Y-family DNA polymerase	NA	O64031	Bacillus_phage	44.0	1.7e-90
WP_009932612.1|2914872_2915973_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1W6JPB2	Staphylococcus_phage	27.7	9.5e-10
WP_038407987.1|2915972_2918057_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_014601542.1|2918066_2918435_+|transposase	transposase	transposase	NA	NA	NA	NA
2918102:2918117	attR	ACACAAGAAAAGACGT	NA	NA	NA	NA
>prophage 7
NZ_CP009576	Listeria ivanovii subsp. londoniensis strain WSLC 30151 chromosome, complete genome	3045035	3013093	3023306	3045035		Tupanvirus(33.33%)	7	NA	NA
WP_038408056.1|3013093_3015247_-	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	33.3	2.2e-42
WP_038408057.1|3015293_3017069_-	DNA helicase RecQ	NA	A0A2K9L3P7	Tupanvirus	36.9	5.3e-79
WP_038408058.1|3017390_3018857_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	40.0	1.4e-96
WP_003721089.1|3019140_3019671_-	ADP-ribose-binding protein	NA	A0A0K1L687	Scale_drop_disease_virus	47.9	2.2e-28
WP_038408059.1|3019728_3021339_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	31.2	1.5e-51
WP_077916431.1|3021517_3021835_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038408060.1|3021851_3023306_+	glycoside hydrolase family 1 protein	NA	A0A0B5JD41	Pandoravirus	29.8	4.7e-49
