The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP009286	Paenibacillus stellifer strain DSM 14472 chromosome, complete genome	5658798	61595	130209	5658798	capsid,terminase,tRNA,plate,integrase,holin,portal,protease	Paenibacillus_phage(13.16%)	84	91263:91280	128575:128592
WP_038692856.1|61595_63026_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_038692857.1|63078_63618_+	hypoxanthine phosphoribosyltransferase	NA	A0A2K9L634	Tupanvirus	26.2	1.1e-11
WP_038692858.1|63730_65785_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	H8ZJI5	Ostreococcus_tauri_virus	42.2	1.2e-111
WP_179944912.1|65886_66231_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_038692859.1|66405_66960_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_038692860.1|67011_67731_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_038692861.1|67997_68936_+	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_038692862.1|68977_70594_+	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_038692863.1|70583_71459_+	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
WP_038692864.1|71455_72223_+	type III pantothenate kinase	NA	NA	NA	NA	NA
WP_038692865.1|72266_73148_+	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
WP_038692866.1|73161_74097_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_038692867.1|74337_75276_+	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	63.5	4.3e-104
WP_169744514.1|75593_77441_+	chorismate-binding protein	NA	S4VNU7	Pandoravirus	35.5	1.2e-38
WP_038692868.1|77437_78019_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	58.4	5.8e-67
WP_038692869.1|78015_78900_+	aminotransferase class IV	NA	NA	NA	NA	NA
WP_038692870.1|78896_79739_+	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	31.1	6.7e-24
WP_038692871.1|79770_80142_+	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_038692872.1|80141_80690_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_038692873.1|80641_80854_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_038692874.1|80867_81890_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_038692875.1|82085_82565_+	transcription elongation factor GreA	NA	NA	NA	NA	NA
WP_038692876.1|82814_84326_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	42.2	2.9e-94
WP_038692877.1|84435_85053_-	TetR family transcriptional regulator C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_038692878.1|85150_85690_+	hypothetical protein	NA	NA	NA	NA	NA
91263:91280	attL	AAGATGGCAATAATATAT	NA	NA	NA	NA
WP_038692879.1|91341_92598_-|integrase	site-specific integrase	integrase	A0A0C5AN64	Paenibacillus_phage	36.7	1.6e-53
WP_038692880.1|92633_92984_-	helix-turn-helix domain-containing protein	NA	Q0H244	Geobacillus_phage	27.8	6.9e-07
WP_038692881.1|93144_93360_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_038692882.1|93423_93633_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_038692884.1|93850_94597_+	phage antirepressor KilAC domain-containing protein	NA	R9VWW9	Paenibacillus_phage	69.8	7.6e-96
WP_169744515.1|95718_96702_+	ATP-binding protein	NA	A0A1W6JPS4	Staphylococcus_phage	31.4	2.1e-16
WP_038692886.1|96907_97246_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052098088.1|97360_98026_+	hypothetical protein	NA	D0R7I8	Paenibacillus_phage	58.0	5.5e-53
WP_038692887.1|98327_99182_+	hypothetical protein	NA	A0A076G7L7	Bacillus_phage	38.2	4.2e-05
WP_052098089.1|99261_99726_+	hypothetical protein	NA	A0A0C5AET2	Bacteriophage	70.8	9.3e-60
WP_038692888.1|99783_100293_+	hypothetical protein	NA	A0A1X9HW94	Ruegeria_phage	44.6	1.4e-32
WP_052098090.1|100650_101076_+	hypothetical protein	NA	A0A1B1P7W5	Bacillus_phage	33.6	7.1e-14
WP_038692890.1|101072_101594_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038692891.1|101590_101773_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038692892.1|101769_101949_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038692893.1|101945_102332_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052098091.1|102390_102729_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038692894.1|102793_103000_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038692895.1|102996_103365_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052098092.1|103380_103770_+	hypothetical protein	NA	A0A0A7AR03	Bacillus_phage	45.7	1.3e-27
WP_038692896.1|103851_104055_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038692897.1|104057_104273_+	hypothetical protein	NA	NA	NA	NA	NA
WP_084064545.1|104468_104759_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_169744516.1|104728_105358_+	hypothetical protein	NA	A0A0K2CNQ1	Brevibacillus_phage	33.9	3.5e-17
WP_169744517.1|105734_106118_+	hypothetical protein	NA	U5PUJ8	Bacillus_phage	47.4	1.3e-06
WP_052098093.1|106107_106482_+	HNH endonuclease	NA	A0A2D1GNP5	Pseudomonas_phage	52.7	1.4e-34
WP_038692901.1|106577_107168_+|terminase	P27 family phage terminase small subunit	terminase	A0A2I7SBY3	Paenibacillus_phage	54.0	2.9e-50
WP_169744632.1|107202_108924_+|terminase	terminase large subunit	terminase	A0A0A7RVS5	Clostridium_phage	56.9	4.8e-186
WP_169744518.1|108920_109082_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052098095.1|109081_110368_+|portal	phage portal protein	portal	D0R0D3	Streptococcus_phage	41.7	1.0e-79
WP_038692902.1|110327_111044_+|protease	Clp protease ClpP	protease	R9TLM7	Paenibacillus_phage	57.1	4.2e-59
WP_038692903.1|111044_112331_+|capsid	phage major capsid protein	capsid	A0A1B1IQC5	uncultured_Mediterranean_phage	33.0	1.0e-39
WP_038692904.1|112379_112580_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038692905.1|112563_113109_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038692906.1|113120_113591_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038692907.1|113593_113941_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038692908.1|113927_114407_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038692909.1|114412_115435_+	DUF3383 family protein	NA	A0A2H4J8B9	uncultured_Caudovirales_phage	37.9	2.0e-54
WP_038692910.1|115448_115847_+	DUF3277 family protein	NA	A0A1L2K2P1	Aeribacillus_phage	50.0	4.0e-27
WP_038692911.1|115876_116173_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038692912.1|116391_118641_+	hypothetical protein	NA	A0A2H4IZQ5	uncultured_Caudovirales_phage	45.7	1.7e-05
WP_179944913.1|118640_119219_+	hypothetical protein	NA	A8ATH7	Listeria_phage	33.7	5.5e-09
WP_038692913.1|119227_119560_+	hypothetical protein	NA	E5DV60	Deep-sea_thermophilic_phage	54.3	3.8e-23
WP_038692914.1|119549_120347_+	hypothetical protein	NA	E5DV61	Deep-sea_thermophilic_phage	42.5	6.3e-56
WP_052098096.1|120343_120733_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038692915.1|120720_121086_+	DUF2634 domain-containing protein	NA	NA	NA	NA	NA
WP_038692916.1|121075_122251_+|plate	baseplate J/gp47 family protein	plate	E5DV64	Deep-sea_thermophilic_phage	48.7	7.3e-93
WP_038692917.1|122243_122885_+	hypothetical protein	NA	A0A1L2JZ80	Aeribacillus_phage	52.8	8.4e-59
WP_038692918.1|122895_124329_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038692919.1|124343_124832_+	hypothetical protein	NA	NA	NA	NA	NA
WP_084064547.1|124831_124960_+	XkdX family protein	NA	NA	NA	NA	NA
WP_084065347.1|125026_125548_+|holin	phage holin family protein	holin	M9Q253	Clostridium_phage	36.9	8.4e-17
WP_038692920.1|125560_126400_+	M15 family metallopeptidase	NA	A0A127AWA8	Bacillus_phage	60.0	1.2e-36
WP_038692921.1|126403_126682_+|holin	holin	holin	A0A0D4DCQ8	Staphylococcus_phage	38.5	5.1e-05
WP_038692922.1|126734_127259_-	Ltp family lipoprotein	NA	A0A097BY93	Leuconostoc_phage	66.7	1.4e-08
WP_156995971.1|127341_127566_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038692923.1|127822_128041_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_038692924.1|128192_128432_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_038692925.1|128751_130209_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	41.3	1.8e-101
128575:128592	attR	AAGATGGCAATAATATAT	NA	NA	NA	NA
>prophage 2
NZ_CP009286	Paenibacillus stellifer strain DSM 14472 chromosome, complete genome	5658798	408637	417794	5658798		Caulobacter_phage(42.86%)	10	NA	NA
WP_038693147.1|408637_409672_+	agmatine deiminase family protein	NA	M1HCB6	Acanthocystis_turfacea_Chlorella_virus	38.5	9.3e-68
WP_038693148.1|409741_410617_+	N-carbamoylputrescine amidase	NA	M1GUG4	Paramecium_bursaria_Chlorella_virus	48.5	2.5e-74
WP_156995977.1|410964_411756_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_038693150.1|411879_412527_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_038699962.1|412542_413265_+	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.3	1.3e-23
WP_038693151.1|413520_414114_+	TerD family protein	NA	K4JRX3	Caulobacter_phage	36.2	2.1e-24
WP_038693152.1|414152_414728_+	TerD family protein	NA	K4JRX3	Caulobacter_phage	37.9	2.6e-27
WP_038693153.1|414899_415481_+	TerD family protein	NA	K4JRX3	Caulobacter_phage	38.0	1.8e-28
WP_084064589.1|415598_417020_+	TerD family protein	NA	NA	NA	NA	NA
WP_038693154.1|417047_417794_+	TerC family protein	NA	S5MAL1	Bacillus_phage	52.5	7.0e-57
>prophage 3
NZ_CP009286	Paenibacillus stellifer strain DSM 14472 chromosome, complete genome	5658798	791190	802420	5658798		Mollivirus(25.0%)	10	NA	NA
WP_038693566.1|791190_792486_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	26.3	3.7e-21
WP_038693568.1|792514_793414_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0M4JBD3	Mollivirus	34.9	2.6e-42
WP_038693570.1|793572_793818_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	A0A0E3FJ99	Synechococcus_phage	36.4	1.4e-06
WP_038693572.1|793822_794512_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_038693574.1|794489_796736_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	44.4	1.0e-167
WP_038693576.1|796720_798217_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	33.3	4.0e-51
WP_038693578.1|798403_798844_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038693580.1|798858_799902_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	44.9	3.8e-69
WP_038700089.1|799901_800516_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	35.4	2.9e-24
WP_038693582.1|800872_802420_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	51.6	1.3e-76
>prophage 4
NZ_CP009286	Paenibacillus stellifer strain DSM 14472 chromosome, complete genome	5658798	831685	877000	5658798	transposase,protease,integrase	Lactococcus_phage(20.0%)	27	829937:829952	845846:845861
829937:829952	attL	ACTTGCAAGCGGATGT	NA	NA	NA	NA
WP_038693619.1|831685_832171_+|transposase	IS200/IS605 family transposase	transposase	A0A1P8BMC0	Lactococcus_phage	35.4	1.9e-18
WP_084064666.1|832257_832752_-|integrase	tyrosine-type recombinase/integrase	integrase	S5MNZ2	Brevibacillus_phage	55.6	6.7e-32
WP_038693621.1|833103_834972_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052099126.1|835073_835721_+	OmpA family protein	NA	NA	NA	NA	NA
WP_169744532.1|835701_836943_+	hypothetical protein	NA	NA	NA	NA	NA
WP_084064669.1|836954_839708_+	DEAD/DEAH box helicase	NA	A0A160DHD3	Gordonia_phage	28.3	1.1e-33
WP_038693626.1|839816_840866_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038700097.1|840847_842362_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038693628.1|843147_847593_+	chromosome segregation ATPase	NA	NA	NA	NA	NA
845846:845861	attR	ACATCCGCTTGCAAGT	NA	NA	NA	NA
WP_038693630.1|847940_848132_+	helix-turn-helix domain-containing protein	NA	A0A1B1IUF9	uncultured_Mediterranean_phage	42.6	5.2e-09
WP_038700101.1|848186_848792_+	DUF1819 family protein	NA	NA	NA	NA	NA
WP_038693631.1|848802_849360_+	DUF1788 domain-containing protein	NA	NA	NA	NA	NA
WP_038693632.1|849373_852895_+	BREX system P-loop protein BrxC	NA	NA	NA	NA	NA
WP_038693634.1|852909_856263_+	BREX-1 system adenine-specific DNA-methyltransferase PglX	NA	NA	NA	NA	NA
WP_038693636.1|856274_858866_+	BREX-1 system phosphatase PglZ type A	NA	NA	NA	NA	NA
WP_038693638.1|858878_860954_+|protease	protease Lon-related BREX system protein BrxL	protease	NA	NA	NA	NA
WP_038693639.1|861007_862000_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169744533.1|862011_863457_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038693642.1|864127_865684_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_038693644.1|865870_867223_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_084064672.1|867254_869222_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_038693101.1|869582_870764_+|transposase	IS110 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	31.2	2.6e-37
WP_038693646.1|871134_871611_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_038693648.1|871625_872195_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038693649.1|872216_873623_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038693651.1|874236_874992_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038693653.1|875965_877000_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP009286	Paenibacillus stellifer strain DSM 14472 chromosome, complete genome	5658798	1615512	1675215	5658798	transposase,integrase	Bacillus_phage(33.33%)	40	1625552:1625611	1675175:1676007
WP_038694187.1|1615512_1616706_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_038694468.1|1616940_1617330_-	large conductance mechanosensitive channel protein MscL	NA	NA	NA	NA	NA
WP_038694469.1|1617812_1618703_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038694470.1|1620848_1621727_+	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_038694472.1|1622027_1623044_+	lactate dehydrogenase	NA	M1HKI4	Acanthocystis_turfacea_Chlorella_virus	34.9	7.6e-46
WP_038694473.1|1623197_1624241_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_052098258.1|1624585_1625554_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
1625552:1625611	attL	TAGGGTGTGTATGCAAACCTAAGCAAGCCATATCATAATGGAGGCCAGGGACAAAAAAGC	NA	NA	NA	NA
WP_156996009.1|1625569_1626330_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	70.2	1.6e-45
WP_038694475.1|1626401_1627283_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_038694476.1|1628980_1630477_+	glycoside hydrolase family 32 protein	NA	F8WPR5	Bacillus_phage	34.3	1.1e-64
WP_169744635.1|1630483_1631371_+	ROK family protein	NA	NA	NA	NA	NA
WP_156996011.1|1631522_1635287_+	GH32 C-terminal domain-containing protein	NA	F8WPR5	Bacillus_phage	31.9	4.2e-57
WP_038694478.1|1635749_1637120_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_038694480.1|1637116_1638061_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_038694482.1|1638115_1638952_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_052098260.1|1639106_1640465_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_038694483.1|1640810_1642556_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_038694484.1|1642533_1644111_+	response regulator	NA	NA	NA	NA	NA
WP_038694485.1|1644239_1646366_+	DUF1080 domain-containing protein	NA	NA	NA	NA	NA
WP_038694486.1|1646541_1647348_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038694487.1|1647599_1648073_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_038694488.1|1648232_1649435_+	tetracycline resistance MFS efflux pump	NA	NA	NA	NA	NA
WP_038694489.1|1649694_1651224_+	nitrogenase	NA	NA	NA	NA	NA
WP_038694491.1|1651255_1652620_+	hydrogenase	NA	NA	NA	NA	NA
WP_038694492.1|1653102_1653990_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038694494.1|1654083_1655256_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_038694495.1|1655414_1656707_-	DNA recombination protein RmuC	NA	NA	NA	NA	NA
WP_038694496.1|1657094_1657745_+	suppressor of fused domain protein	NA	NA	NA	NA	NA
WP_038694497.1|1658968_1659604_+	DUF4433 domain-containing protein	NA	NA	NA	NA	NA
WP_038694498.1|1659616_1660648_+	macro domain-containing protein	NA	A0A173GFD0	Erwinia_phage	40.8	2.5e-20
WP_038694499.1|1660701_1661628_-|integrase	site-specific integrase	integrase	S5M872	Bacillus_phage	24.5	1.7e-07
WP_038694500.1|1661640_1662735_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_038694501.1|1662739_1664269_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_156995813.1|1664461_1664728_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038694502.1|1665328_1666282_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_038694503.1|1666320_1669284_+	PD-(D/E)XK nuclease family protein	NA	NA	NA	NA	NA
WP_038694504.1|1669276_1672594_+	UvrD-helicase domain-containing protein	NA	G3MA40	Bacillus_virus	30.9	4.6e-07
WP_038694505.1|1672627_1674082_+	SAM-dependent DNA methyltransferase	NA	A0A2H4UVB0	Bodo_saltans_virus	28.1	9.5e-26
WP_038694506.1|1674078_1674426_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_156996009.1|1674455_1675215_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	70.2	1.6e-45
1675175:1676007	attR	GCTTTTTTGTCCCTGGCCTCCATTATGATATGGCTTGCTTAGGTTTGCATACACACCCTAAATTACATTGATTTATCGAACTTTATAACAGGGACTACAAGAGGAAAATTAACAAAATCAGCACTAAATAGAATTGAGATCTTATTACCAAGTTTTAAGGAACAAGAGTATATCGCTAATATATTAGATAAGGCTCAATACTTGGTTGATAAACGCAAACAAGCTATAGCTAAACTTAATGAATTGGTTCAAGCTGTGTTTATGGATATGTTTGGGAATCCGGTGACGAACCCTATGGGATGGGAAGTACAAAAATTAAAGAGTTTATCGACAAAGATCTTAAGTGGCAATACTCCGAAAGGTGGAAGTCAAGTATATGTCGATAAGGGTATTATTTTTTTTAGAAGCCAGAATATCTGGAAAAATAGAATTGAGCTAGATGATGTTGCTTATATCGATGAACAGACACATTGGAAGATGAGTCAGACCAGTGTAAAAAACAGGGACATATTAATAACAAAAACTGGTCGTATTAATACAGAGAATAGCAGTCTGGGGCGAGCGGCCCTATTTTTAGGTGAGGATGATAGCGCAAATATAAATGGACATGTATATTTAGTAAGGCTGAAAAAAGGATTTATACATGAATTTGTTCTTTATATCCTGATTACGGATGAGTATAGGGATTATATAAGGGAAGTGTGTGTTGGAGGAATAGACAAAAGGCAAATTAACAAGGAGCATTTGGAGGAGTTTCCCATTATAATGCCTCCGATTGATCTCCAGCAACGCTTCGCCGACTACGTGCGCCAAATCGATAAGCTGAAGTCCAA	NA	NA	NA	NA
>prophage 6
NZ_CP009286	Paenibacillus stellifer strain DSM 14472 chromosome, complete genome	5658798	2041623	2093164	5658798	tail,head,capsid,terminase,coat,plate,integrase,holin,portal,protease	Bacillus_phage(19.35%)	67	2041589:2041608	2077838:2077857
2041589:2041608	attL	TTGTCCGTTTCTTGTCCGTT	NA	NA	NA	NA
WP_038694733.1|2041623_2042772_-|integrase	site-specific integrase	integrase	S5MBZ0	Brevibacillus_phage	71.5	3.4e-159
WP_052098303.1|2042784_2043675_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_038694734.1|2043754_2044126_-	helix-turn-helix transcriptional regulator	NA	A0A0S2SXM8	Bacillus_phage	50.7	1.5e-12
WP_038700477.1|2044308_2044557_+	transcriptional regulator	NA	A0A0S2SXX9	Bacillus_phage	46.8	1.1e-14
WP_038694735.1|2044915_2045191_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038694736.1|2045260_2045503_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_084064889.1|2045547_2045715_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_156995830.1|2045872_2046175_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038694738.1|2046331_2046736_+	hypothetical protein	NA	A0A0K2CYI4	Paenibacillus_phage	54.0	6.1e-31
WP_038694739.1|2046891_2047278_+	hypothetical protein	NA	R9TQ19	Paenibacillus_phage	54.8	9.2e-37
WP_052098305.1|2047407_2048520_+	hypothetical protein	NA	A0A0K2CY85	Paenibacillus_phage	48.1	3.7e-22
WP_052098306.1|2048807_2049221_+	hypothetical protein	NA	A0A2H4J073	uncultured_Caudovirales_phage	50.0	3.7e-15
WP_084064895.1|2049229_2050768_+	PcfJ domain-containing protein	NA	NA	NA	NA	NA
WP_052098307.1|2050764_2051760_+	DUF3102 domain-containing protein	NA	NA	NA	NA	NA
WP_038694742.1|2052129_2052960_+	hypothetical protein	NA	A0A2P1JTY9	Anoxybacillus_phage	51.7	1.3e-51
WP_038694743.1|2052943_2053255_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038694744.1|2053439_2053811_+	hypothetical protein	NA	A0A1C9EI42	Rhodococcus_phage	42.1	2.4e-18
WP_038694745.1|2053807_2053996_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038694746.1|2054101_2054548_+	hypothetical protein	NA	D2XR57	Bacillus_phage	41.4	6.5e-18
WP_038694748.1|2055001_2055190_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038694750.1|2055182_2055542_+	HNH endonuclease	NA	A0A2D1GNP5	Pseudomonas_phage	49.6	3.2e-31
WP_052098308.1|2055665_2056160_+|terminase	phage terminase small subunit P27 family	terminase	NA	NA	NA	NA
WP_052098309.1|2056143_2057970_+|terminase	terminase large subunit	terminase	A6M948	Geobacillus_virus	38.9	1.1e-103
WP_084065406.1|2058007_2059264_+|portal	phage portal protein	portal	Q6DMU2	Streptococcus_phage	38.6	4.9e-71
WP_038694752.1|2059264_2060071_+|protease	Clp protease ClpP	protease	A6M950	Geobacillus_virus	59.4	1.5e-73
WP_038694754.1|2060067_2061324_+|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	19.8	7.2e-06
WP_038694756.1|2061381_2061810_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038694758.1|2061822_2062356_+|head,tail	phage head-tail connector protein	head,tail	NA	NA	NA	NA
WP_038694760.1|2062369_2062858_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038694762.1|2062854_2063199_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038694764.1|2063185_2063662_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038694766.1|2063667_2064690_+	DUF3383 family protein	NA	A0A1L2JZ70	Aeribacillus_phage	41.1	2.2e-61
WP_038694768.1|2064703_2065105_+	DUF3277 family protein	NA	A0A1L2K2P1	Aeribacillus_phage	48.8	2.9e-25
WP_038694770.1|2065129_2065429_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038694772.1|2065652_2068181_+|tail	phage tail tape measure protein	tail	A0A0A8WJ94	Clostridium_phage	33.1	2.4e-40
WP_038694774.1|2068180_2068753_+	hypothetical protein	NA	A8ATH7	Listeria_phage	33.7	1.4e-09
WP_156995831.1|2068765_2068930_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038694776.1|2068933_2069269_+	hypothetical protein	NA	E5DV60	Deep-sea_thermophilic_phage	53.3	2.1e-21
WP_038694778.1|2069258_2070056_+	hypothetical protein	NA	E5DV61	Deep-sea_thermophilic_phage	42.5	9.8e-57
WP_052098310.1|2070052_2070442_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038694780.1|2070429_2070795_+	DUF2634 domain-containing protein	NA	D6PSZ8	Lactobacillus_phage	29.4	4.2e-07
WP_038694782.1|2070784_2071960_+|plate	baseplate J/gp47 family protein	plate	E5DV64	Deep-sea_thermophilic_phage	47.4	4.9e-89
WP_038694784.1|2071952_2072594_+	hypothetical protein	NA	A0A1L2JZ80	Aeribacillus_phage	51.9	9.3e-58
WP_038694786.1|2072606_2074145_+	hypothetical protein	NA	A0A1L2K2Q1	Aeribacillus_phage	30.2	3.5e-10
WP_052098311.1|2074159_2074495_+	hypothetical protein	NA	NA	NA	NA	NA
WP_084064901.1|2074494_2074623_+	XkdX family protein	NA	NA	NA	NA	NA
WP_084065408.1|2074776_2075139_+|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_052098312.1|2075138_2075918_+	M15 family metallopeptidase	NA	A0A127AWA8	Bacillus_phage	57.7	4.6e-43
WP_038694790.1|2075920_2076139_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038694792.1|2076191_2076614_-	hypothetical protein	NA	A0A0K2CZD8	Paenibacillus_phage	48.3	7.5e-24
WP_038694794.1|2076807_2077230_-	type II toxin-antitoxin system HicB family antitoxin	NA	A0A090DBV2	Clostridium_phage	51.9	5.4e-30
WP_038694797.1|2077268_2077457_-	type II toxin-antitoxin system HicA family toxin	NA	A0A1L2JY37	Aeribacillus_phage	59.7	8.8e-17
WP_169744555.1|2077635_2077821_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169744556.1|2078191_2078386_+	hypothetical protein	NA	NA	NA	NA	NA
2077838:2077857	attR	TTGTCCGTTTCTTGTCCGTT	NA	NA	NA	NA
WP_038700497.1|2079517_2079934_+	VOC family protein	NA	NA	NA	NA	NA
WP_038694801.1|2080269_2082027_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.7	2.8e-56
WP_038700500.1|2082040_2083882_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	31.8	4.4e-60
WP_038694803.1|2084033_2085068_-	HD-GYP domain-containing protein	NA	NA	NA	NA	NA
WP_038694805.1|2085138_2085864_-	molybdopterin converting factor subunit 1	NA	NA	NA	NA	NA
WP_038694807.1|2086001_2087447_+	bifunctional metallophosphatase/5'-nucleotidase	NA	NA	NA	NA	NA
WP_038694809.1|2087531_2088356_+	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_169744638.1|2088538_2089579_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_156995832.1|2089539_2089716_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038694814.1|2089828_2090965_+	radical SAM/CxCxxxxC motif protein YfkAB	NA	NA	NA	NA	NA
WP_156995833.1|2090980_2092345_+	DUF21 domain-containing protein	NA	NA	NA	NA	NA
WP_156996023.1|2092684_2092894_+|coat	spore coat associated protein CotJA	coat	NA	NA	NA	NA
WP_038694816.1|2092897_2093164_+|coat	spore coat protein CotJB	coat	NA	NA	NA	NA
>prophage 7
NZ_CP009286	Paenibacillus stellifer strain DSM 14472 chromosome, complete genome	5658798	2385918	2396605	5658798		Bacillus_phage(50.0%)	6	NA	NA
WP_038695219.1|2385918_2388606_+	adenosylcobalamin-dependent ribonucleoside-diphosphate reductase	NA	A0A0K2CP92	Brevibacillus_phage	47.2	9.0e-171
WP_179944926.1|2388946_2390986_+	serine hydrolase	NA	A0A023ZXL4	Mycobacterium_phage	24.2	1.5e-08
WP_038695221.1|2391220_2392981_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.1	4.4e-49
WP_038695223.1|2392980_2394732_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	24.8	9.1e-31
WP_038695225.1|2394857_2395934_-	HAMP domain-containing histidine kinase	NA	Q8QKV7	Ectocarpus_siliculosus_virus	27.3	1.9e-15
WP_038695227.1|2395933_2396605_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	47.0	1.1e-48
>prophage 8
NZ_CP009286	Paenibacillus stellifer strain DSM 14472 chromosome, complete genome	5658798	3121685	3129766	5658798		Streptococcus_virus(33.33%)	9	NA	NA
WP_038696291.1|3121685_3122738_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	28.6	1.6e-19
WP_038696293.1|3122819_3123605_-	GTP cyclohydrolase II	NA	NA	NA	NA	NA
WP_038696295.1|3123808_3124135_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_052098498.1|3124233_3124521_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038696297.1|3124659_3125385_-	7-carboxy-7-deazaguanine synthase QueE	NA	A0A1U9WRB6	Streptococcus_virus	47.2	1.3e-60
WP_038696300.1|3125381_3125861_-	6-carboxytetrahydropterin synthase	NA	A0A1U9WRB3	Streptococcus_virus	45.3	5.9e-25
WP_038696307.1|3125862_3126525_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	55.8	4.0e-64
WP_038696308.1|3126588_3127089_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	E7DN65	Pneumococcus_phage	68.6	1.9e-50
WP_084065093.1|3127420_3129766_-	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	35.1	2.2e-104
>prophage 9
NZ_CP009286	Paenibacillus stellifer strain DSM 14472 chromosome, complete genome	5658798	3672972	3681967	5658798		Staphylococcus_phage(57.14%)	11	NA	NA
WP_038697126.1|3672972_3674166_-	D-alanyl-D-alanine carboxypeptidase	NA	A0A1P8VVG5	Erythrobacter_phage	34.9	9.6e-08
WP_038697127.1|3674327_3674633_+	hypothetical protein	NA	NA	NA	NA	NA
WP_084065136.1|3674745_3675156_+	copper amine oxidase N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_038697129.1|3675094_3675601_-	GerW family sporulation protein	NA	NA	NA	NA	NA
WP_038697131.1|3675730_3676453_-	DUF2953 domain-containing protein	NA	NA	NA	NA	NA
WP_038697134.1|3676744_3677350_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	33.5	9.2e-15
WP_038697136.1|3677318_3678110_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	33.3	3.7e-08
WP_038701135.1|3678285_3678750_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	60.0	3.2e-44
WP_038697138.1|3678798_3680049_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	52.3	2.2e-119
WP_038697140.1|3680076_3680754_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	42.8	3.3e-37
WP_038697142.1|3680854_3681967_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	35.6	1.4e-53
>prophage 10
NZ_CP009286	Paenibacillus stellifer strain DSM 14472 chromosome, complete genome	5658798	4314768	4388382	5658798	transposase,protease	Bacillus_phage(33.33%)	57	NA	NA
WP_038698037.1|4314768_4316478_-|protease	ATP-dependent protease LonB	protease	A0A1V0SHJ7	Hokovirus	29.4	2.9e-05
WP_038698039.1|4316631_4317768_-	flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase	NA	NA	NA	NA	NA
WP_038698041.1|4317990_4319247_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	64.8	1.1e-147
WP_038698043.1|4319258_4319849_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	57.4	6.8e-55
WP_038698045.1|4320060_4321380_-	trigger factor	NA	NA	NA	NA	NA
WP_179944940.1|4321501_4322419_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038693101.1|4323318_4324500_-|transposase	IS110 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	31.2	2.6e-37
WP_038698047.1|4324890_4325784_-	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_084065203.1|4325784_4326738_-	phosphate ABC transporter permease subunit PstC	NA	NA	NA	NA	NA
WP_038698049.1|4326938_4327799_-	phosphate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_038698051.1|4327836_4329264_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156995919.1|4329478_4330210_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	36.5	3.0e-28
WP_038698053.1|4330206_4331259_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_038698055.1|4331316_4331988_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_038698059.1|4334477_4335548_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038698061.1|4335620_4336655_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_156996078.1|4336794_4337298_-	hypothetical protein	NA	NA	NA	NA	NA
WP_084065205.1|4339380_4340601_-	Ger(x)C family spore germination protein	NA	NA	NA	NA	NA
WP_052098710.1|4340597_4342067_-	spore germination protein	NA	NA	NA	NA	NA
WP_038698065.1|4342063_4343179_-	endospore germination permease	NA	NA	NA	NA	NA
WP_038698069.1|4343616_4343937_-	S-layer homology domain-containing protein	NA	NA	NA	NA	NA
WP_038698071.1|4343933_4344266_-	chaperone CsaA	NA	NA	NA	NA	NA
WP_038698074.1|4344673_4345456_-	nitroreductase family protein	NA	NA	NA	NA	NA
WP_038698076.1|4345672_4346857_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	34.9	9.5e-16
WP_052099302.1|4347315_4347561_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038698078.1|4347518_4348163_+	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_169744611.1|4348363_4348552_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038698080.1|4348548_4348905_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038698082.1|4349053_4350898_+	asparagine synthase (glutamine-hydrolyzing)	NA	F2Y1H0	Organic_Lake_phycodnavirus	27.5	1.1e-31
WP_052098712.1|4351027_4351855_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_038698084.1|4352027_4352864_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	48.3	3.4e-68
WP_038698086.1|4353282_4353744_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_038698090.1|4353776_4354442_-	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
WP_038698092.1|4354443_4355202_-	ribonuclease PH	NA	NA	NA	NA	NA
WP_038698094.1|4355609_4356794_-	GerMN domain-containing protein	NA	NA	NA	NA	NA
WP_038698096.1|4357059_4357659_+	phosphatidylglycerophosphatase A	NA	G3MBC5	Bacillus_virus	53.0	4.0e-39
WP_052098714.1|4357940_4365695_-	Ig-like domain-containing protein	NA	A0A140XG62	Salmonella_phage	28.7	2.9e-28
WP_084065208.1|4365691_4366363_-	carbohydrate binding domain-containing protein	NA	NA	NA	NA	NA
WP_038698102.1|4366670_4367045_-	DUF1801 domain-containing protein	NA	NA	NA	NA	NA
WP_052098716.1|4367063_4368089_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_038698104.1|4368089_4368824_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_038698106.1|4369016_4370714_-	alpha-glucosidase	NA	NA	NA	NA	NA
WP_052098717.1|4371036_4371477_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_038698108.1|4371687_4372542_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_038698110.1|4372650_4373796_-	homocysteine methyltransferase	NA	NA	NA	NA	NA
WP_052099305.1|4373792_4374533_-	HesA/MoeB/ThiF family protein	NA	NA	NA	NA	NA
WP_038698114.1|4374628_4375189_-	DUF269 domain-containing protein	NA	NA	NA	NA	NA
WP_038698116.1|4375172_4375571_-	nitrogen fixation protein NifX	NA	NA	NA	NA	NA
WP_038698118.1|4375545_4376874_-	nitrogenase iron-molybdenum cofactor biosynthesis protein NifN	NA	NA	NA	NA	NA
WP_052098719.1|4376863_4378225_-	nitrogenase iron-molybdenum cofactor biosynthesis protein NifE	NA	NA	NA	NA	NA
WP_038698120.1|4378460_4380020_-	nitrogenase molybdenum-iron protein subunit beta	NA	NA	NA	NA	NA
WP_038698122.1|4380016_4381474_-	nitrogenase molybdenum-iron protein alpha chain	NA	NA	NA	NA	NA
WP_038698124.1|4381643_4382522_-	nitrogenase iron protein	NA	NA	NA	NA	NA
WP_038698126.1|4382528_4383905_-	nitrogenase cofactor biosynthesis protein NifB	NA	NA	NA	NA	NA
WP_038698128.1|4384686_4385526_+	TerC family protein	NA	A0A068EP98	Bacillus_phage	43.3	7.7e-28
WP_038698130.1|4385859_4386936_-	23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN	NA	NA	NA	NA	NA
WP_038693101.1|4387200_4388382_-|transposase	IS110 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	31.2	2.6e-37
>prophage 11
NZ_CP009286	Paenibacillus stellifer strain DSM 14472 chromosome, complete genome	5658798	5578166	5585528	5658798	tRNA	Stenotrophomonas_phage(16.67%)	7	NA	NA
WP_084065339.1|5578166_5578679_-	NADAR family protein	NA	A0A2D2W261	Stenotrophomonas_phage	50.4	8.0e-36
WP_038699732.1|5578623_5579517_-	NUDIX domain-containing protein	NA	G3MA14	Bacillus_virus	35.0	5.6e-37
WP_038699734.1|5579547_5580558_-	AAA family ATPase	NA	A0A218KBV7	Bacillus_phage	30.9	1.3e-29
WP_038699736.1|5580554_5581232_-	nicotinamide mononucleotide transporter	NA	A0A2R4ALR8	Aeromonas_phage	34.5	4.3e-29
WP_038699738.1|5581655_5582945_+|tRNA	histidine--tRNA ligase	tRNA	A0A2I2L577	Orpheovirus	31.3	1.9e-41
WP_038699740.1|5583007_5584381_-	amino acid permease	NA	NA	NA	NA	NA
WP_038699742.1|5584820_5585528_+	lantibiotic protection ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	48.4	9.0e-54
