The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP007646	Ligilactobacillus salivarius strain JCM1046 chromosome, complete genome	1836297	6461	17133	1836297	transposase	Bacillus_virus(16.67%)	9	NA	NA
WP_044004249.1|6461_9014_+	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	36.9	6.9e-112
WP_003703382.1|9232_9523_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_003708930.1|9563_10115_+	single-stranded DNA-binding protein	NA	A8ATZ7	Listeria_phage	53.8	1.1e-43
WP_003701427.1|10136_10373_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_044004256.1|10562_11852_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	30.0	4.8e-45
WP_044004258.1|11937_12801_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	26.8	3.2e-21
WP_044004260.1|12948_13962_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_044005558.1|14189_14972_+	M23 family metallopeptidase	NA	A0A7K9	Microcystis_virus	37.5	2.6e-06
WP_044004262.1|15210_17133_+	asparagine synthase (glutamine-hydrolyzing)	NA	R4TIC1	Phaeocystis_globosa_virus	27.3	3.9e-27
>prophage 2
NZ_CP007646	Ligilactobacillus salivarius strain JCM1046 chromosome, complete genome	1836297	27908	103289	1836297	transposase,protease	Bacillus_phage(27.27%)	58	NA	NA
WP_044004280.1|27908_29198_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	29.7	9.0e-44
WP_034982753.1|29439_30786_+	threonine/serine exporter family protein	NA	NA	NA	NA	NA
WP_003707363.1|30800_31361_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003702035.1|31559_32474_+	EamA family transporter	NA	NA	NA	NA	NA
WP_034982754.1|32642_34445_-	oligoendopeptidase F	NA	A0A1X9I5X5	Streptococcus_phage	43.0	6.3e-136
WP_044004286.1|34798_35716_+	cysteine synthase family protein	NA	C3U2M1	Lactococcus_phage	40.9	9.2e-59
WP_034982756.1|35731_36874_+	PLP-dependent transferase	NA	A0A0B5JD48	Pandoravirus	26.4	1.3e-17
WP_044004288.1|37029_38139_+	iron-containing alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_044004290.1|38223_38658_+	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_034982758.1|38772_39069_+	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
WP_003701461.1|39174_39375_+	type II toxin-antitoxin system YafQ family toxin	NA	NA	NA	NA	NA
WP_044004295.1|39464_40856_-	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_003705682.1|41053_41503_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_044004299.1|41514_43248_+	ABC transporter ATP-binding protein	NA	F2Y352	Organic_Lake_phycodnavirus	28.5	6.0e-19
WP_034982761.1|43240_45022_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.2	2.3e-50
WP_044004301.1|45141_45441_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148305433.1|45522_45873_+	hypothetical protein	NA	NA	NA	NA	NA
WP_034982765.1|45889_47674_+	DUF87 domain-containing protein	NA	NA	NA	NA	NA
WP_044004305.1|49296_49926_-	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_003701471.1|50047_50875_+	sugar-phosphatase	NA	NA	NA	NA	NA
WP_003701473.1|51047_51758_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	40.8	1.1e-43
WP_172412479.1|51768_53652_+	cell wall metabolism sensor histidine kinase WalK	NA	W8CYF6	Bacillus_phage	35.4	1.1e-37
WP_044004313.1|53641_54979_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044004315.1|54990_55791_+	two-component system regulatory protein YycI	NA	NA	NA	NA	NA
WP_003702729.1|55862_56213_+	MmcQ/YjbR family DNA-binding protein	NA	NA	NA	NA	NA
WP_034982774.1|56285_57089_+	MBL fold metallo-hydrolase	NA	A0A2I7SDH3	Paenibacillus_phage	34.9	7.3e-36
WP_044004318.1|57187_58492_+	trypsin-like peptidase domain-containing protein	NA	A0A1B1IT49	uncultured_Mediterranean_phage	30.8	4.3e-17
WP_044004321.1|58856_59336_+	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_044004323.1|59589_60981_-	MFS transporter	NA	NA	NA	NA	NA
WP_172400030.1|61135_62263_-	endonuclease	NA	NA	NA	NA	NA
WP_034982777.1|62408_63638_+	accessory Sec system protein translocase subunit SecY2	NA	NA	NA	NA	NA
WP_044004325.1|63661_65263_+	accessory Sec system protein Asp1	NA	NA	NA	NA	NA
WP_034982779.1|65255_66812_+	accessory Sec system protein Asp2	NA	NA	NA	NA	NA
WP_080739298.1|66801_67725_+	accessory Sec system protein Asp3	NA	NA	NA	NA	NA
WP_034982780.1|67737_70089_+	accessory Sec system translocase SecA2	NA	NA	NA	NA	NA
WP_170102506.1|70108_70273_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080739299.1|73537_73876_+	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_148305434.1|73983_74745_-|transposase	IS3 family transposase	transposase	A0A0C5AC89	Paenibacillus_phage	45.9	4.1e-52
WP_044004331.1|74935_75568_-	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	40.5	7.8e-33
WP_034982086.1|75738_77238_+	accessory Sec system glycosyltransferase GtfA	NA	NA	NA	NA	NA
WP_044004336.1|77376_78285_+	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	40.4	1.7e-09
WP_034982237.1|78320_79646_+	accessory Sec system glycosylation chaperone GtfB	NA	NA	NA	NA	NA
WP_080739364.1|79838_80747_+	nucleotide sugar synthetase	NA	NA	NA	NA	NA
WP_044004339.1|82900_83905_+	nucleotide sugar synthetase	NA	NA	NA	NA	NA
WP_034982096.1|83922_84831_+	glycosyltransferase family 2 protein	NA	K7Z8A5	Megavirus	33.0	2.8e-07
WP_080739300.1|84827_85847_+	sugar transferase	NA	NA	NA	NA	NA
WP_044004342.1|85875_86748_+	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	36.0	4.1e-08
WP_034998092.1|88334_88853_+|transposase	transposase	transposase	A0A1B1P776	Bacillus_phage	36.5	1.0e-14
WP_034982102.1|92365_93688_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_034982104.1|93736_95218_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2I4R674	Erysipelothrix_phage	26.7	1.5e-31
WP_034982106.1|95583_96168_+	peptidylprolyl isomerase	NA	A0A076FI46	Aureococcus_anophage	43.5	2.2e-26
WP_034982108.1|96318_97038_+	gamma-glutamyl-gamma-aminobutyrate hydrolase family protein	NA	A0A2I7RZT1	Vibrio_phage	26.2	6.0e-05
WP_034982110.1|97090_98449_-	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_003703180.1|98650_98881_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044004346.1|99006_101115_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	K4FB40	Cronobacter_phage	38.9	5.1e-121
WP_034982115.1|101326_101803_+	universal stress protein	NA	NA	NA	NA	NA
WP_148305435.1|101871_102816_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	37.8	1.2e-40
WP_034983678.1|102770_103289_-|transposase	transposase	transposase	A0A1B1P776	Bacillus_phage	35.8	2.3e-14
>prophage 3
NZ_CP007646	Ligilactobacillus salivarius strain JCM1046 chromosome, complete genome	1836297	712753	721526	1836297		Synechococcus_phage(33.33%)	9	NA	NA
WP_011475856.1|712753_713236_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	41.1	1.6e-22
WP_003700035.1|713232_714267_+	PDZ domain-containing protein	NA	NA	NA	NA	NA
WP_014568323.1|714579_715293_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	M4R1E8	Synechococcus_phage	37.8	6.3e-39
WP_003703354.1|715311_715560_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_044004813.1|715559_716234_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_044004815.1|716235_718461_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	40.0	1.0e-143
WP_044004817.1|718436_719888_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	35.4	3.3e-63
WP_034982877.1|719888_720926_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	42.3	2.6e-62
WP_003700046.1|720938_721526_+	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	36.9	1.1e-25
>prophage 4
NZ_CP007646	Ligilactobacillus salivarius strain JCM1046 chromosome, complete genome	1836297	726449	788629	1836297	transposase,integrase,tRNA	Streptococcus_phage(23.81%)	54	751145:751164	797346:797365
WP_080739321.1|726449_727868_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	38.5	1.4e-42
WP_158423221.1|728025_728178_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052399043.1|728236_728983_+	DUF805 domain-containing protein	NA	D6PSS5	Lactobacillus_phage	29.1	2.5e-06
WP_044004823.1|729079_729448_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044004825.1|729882_731616_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052399044.1|732315_732675_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_044004827.1|732945_733383_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052399045.1|734609_735053_+	hypothetical protein	NA	U3PCM7	Lactobacillus_phage	29.9	2.1e-08
WP_052399046.1|735062_735734_+|integrase	site-specific integrase	integrase	S5MBZ0	Brevibacillus_phage	33.3	1.1e-29
WP_003700053.1|736234_737728_-	cardiolipin synthase	NA	NA	NA	NA	NA
WP_003700054.1|737840_738728_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003700056.1|738980_739190_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011475862.1|740351_742043_+|tRNA	arginine--tRNA ligase	tRNA	A0A2I2L3K1	Orpheovirus	32.9	6.6e-79
WP_003700061.1|742154_742844_+	helix-hairpin-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003706127.1|742887_743364_+	ComE operon protein 2	NA	A7KUY9	Bacillus_phage	55.0	1.5e-33
WP_003700067.1|745648_746671_+	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_003700069.1|746689_747736_-	type 2 isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_003700070.1|747751_748819_-	phosphomevalonate kinase	NA	NA	NA	NA	NA
WP_034983138.1|748843_749812_-	diphosphomevalonate decarboxylase	NA	NA	NA	NA	NA
WP_034983140.1|749824_750769_-	mevalonate kinase	NA	NA	NA	NA	NA
WP_044004834.1|751016_753806_+	DEAD/DEAH box helicase family protein	NA	A0A1X9I5C8	Streptococcus_phage	28.3	1.2e-85
751145:751164	attL	TACCTTAATAAATCCAGGAA	NA	NA	NA	NA
WP_044005594.1|753938_754433_+	DUF5590 domain-containing protein	NA	NA	NA	NA	NA
WP_034983144.1|754450_755632_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_003700078.1|755644_756946_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9L2U8	Tupanvirus	29.6	7.4e-54
WP_003706143.1|757053_757761_+	DnaD domain protein	NA	A0A0N7AE27	Bacillus_phage	37.8	1.4e-11
WP_034983146.1|757775_758417_+	endonuclease III	NA	NA	NA	NA	NA
WP_003706147.1|758472_758991_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_003710005.1|759014_759887_+	YitT family protein	NA	NA	NA	NA	NA
WP_011475868.1|759957_760965_+	sugar transferase	NA	NA	NA	NA	NA
WP_011475869.1|760961_761753_+	glycosyl transferase	NA	A0A2K9L4Z6	Tupanvirus	35.2	6.4e-08
WP_011475870.1|761739_762687_+	glycosyltransferase	NA	R9S8I6	Prochlorococcus_phage	34.0	3.8e-07
WP_011475871.1|762702_762888_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003703786.1|762890_763076_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003703800.1|763178_763991_-	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_003694124.1|764241_764427_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_003706153.1|764445_764889_+	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	37.7	7.2e-17
WP_011475873.1|764990_765134_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011475874.1|765214_766045_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_034983150.1|766049_766946_-	YitT family protein	NA	M1Q1P6	Streptococcus_phage	37.3	5.1e-54
WP_011475876.1|767121_767910_+	4-hydroxy-tetrahydrodipicolinate reductase	NA	NA	NA	NA	NA
WP_014568347.1|767906_769121_+|tRNA	CCA tRNA nucleotidyltransferase	tRNA	H7BUW3	unidentified_phage	34.8	6.7e-49
WP_011475878.1|769117_771025_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	31.3	4.7e-57
WP_003700096.1|771042_771999_+	thymidylate synthase	NA	A0A0N9SH48	Staphylococcus_phage	61.5	2.0e-117
WP_014568348.1|772016_772520_+	dihydrofolate reductase	NA	G3MBI7	Bacillus_virus	44.6	2.2e-30
WP_014568349.1|772696_773557_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	42.4	1.4e-56
WP_003700099.1|773558_774020_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_034983153.1|774023_774980_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_034983154.1|775771_776701_+	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_003700105.1|776705_777305_+	YpmS family protein	NA	NA	NA	NA	NA
WP_003703777.1|777316_777544_+	YozE family protein	NA	NA	NA	NA	NA
WP_003700107.1|777602_778460_+	ribosome biogenesis GTPase YlqF	NA	NA	NA	NA	NA
WP_158423222.1|779705_779942_-|transposase	transposase	transposase	A0A1X9I619	Streptococcus_phage	50.7	1.5e-13
WP_051454400.1|779931_780630_-|transposase	transposase	transposase	A0A1X9I619	Streptococcus_phage	50.0	2.1e-55
WP_044004856.1|787339_788629_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	29.5	4.0e-44
797346:797365	attR	TTCCTGGATTTATTAAGGTA	NA	NA	NA	NA
>prophage 5
NZ_CP007646	Ligilactobacillus salivarius strain JCM1046 chromosome, complete genome	1836297	814944	823683	1836297		Brevibacillus_phage(16.67%)	9	NA	NA
WP_044004866.1|814944_817419_+	ATP-dependent RecD-like DNA helicase	NA	A0A0K2FLP8	Brevibacillus_phage	27.9	9.4e-58
WP_052399049.1|818979_819582_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051454353.1|819633_820782_-	NINE protein	NA	A0A0A8WJ41	Clostridium_phage	30.7	2.9e-17
WP_034982467.1|820783_820981_-	hypothetical protein	NA	Q9T1Z0	Lactococcus_phage	64.5	1.1e-14
WP_034982525.1|820986_821550_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044004868.1|821596_822127_-	PH domain-containing protein	NA	A0A0F6N4L7	Staphylococcus_phage	45.5	1.4e-27
WP_143455587.1|822152_822764_-	hypothetical protein	NA	NA	NA	NA	NA
WP_034982470.1|822818_823244_-	ImmA/IrrE family metallo-endopeptidase	NA	Q9T201	Bacillus_phage	36.7	1.7e-07
WP_034982471.1|823257_823683_-	helix-turn-helix domain-containing protein	NA	A0A2P1JU09	Anoxybacillus_phage	43.3	4.4e-24
>prophage 6
NZ_CP007646	Ligilactobacillus salivarius strain JCM1046 chromosome, complete genome	1836297	1184125	1243377	1836297	transposase,holin,bacteriocin,tRNA,protease	Bacillus_phage(27.27%)	59	NA	NA
WP_003700632.1|1184125_1184479_-|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_003700633.1|1184482_1184821_-	PspC domain-containing protein	NA	NA	NA	NA	NA
WP_034982336.1|1184833_1186219_-	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	32.5	5.1e-29
WP_003706545.1|1186218_1186920_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	37.6	1.1e-35
WP_034982335.1|1186935_1188063_-	PDZ domain-containing protein	NA	NA	NA	NA	NA
WP_044005048.1|1188212_1188731_+|transposase	transposase	transposase	A0A1B1P776	Bacillus_phage	35.8	6.6e-14
WP_080739335.1|1188733_1188994_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044005049.1|1189013_1189631_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	40.6	3.8e-32
WP_099450942.1|1189737_1190869_-	peptide chain release factor 2	NA	NA	NA	NA	NA
WP_003700639.1|1190943_1193307_-	preprotein translocase subunit SecA	NA	NA	NA	NA	NA
WP_034983102.1|1193430_1194609_-	MFS transporter	NA	NA	NA	NA	NA
WP_003700641.1|1194732_1195287_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_003700642.1|1195466_1196153_-	ComF family protein	NA	NA	NA	NA	NA
WP_034983089.1|1196149_1197487_-	DEAD/DEAH box helicase family protein	NA	A0A1X9I5S6	Streptococcus_phage	41.1	1.7e-77
WP_003700645.1|1197566_1198658_-	undecaprenyl/decaprenyl-phosphate alpha-N-acetylglucosaminyl 1-phosphate transferase	NA	NA	NA	NA	NA
WP_003700646.1|1198808_1200638_-	APC family permease	NA	NA	NA	NA	NA
WP_034983088.1|1200821_1203224_-	cation-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	22.9	4.9e-19
WP_003700648.1|1203419_1205042_-	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	56.4	1.6e-159
WP_003706535.1|1205071_1205356_-	co-chaperone GroES	NA	A0A221S422	uncultured_virus	47.8	7.3e-15
WP_034983087.1|1205551_1206181_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003710514.1|1206284_1206926_-	redox-sensing transcriptional repressor Rex	NA	NA	NA	NA	NA
WP_034983086.1|1207099_1209049_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	29.4	3.7e-49
WP_003706528.1|1210168_1210675_-	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_011476225.1|1210679_1211411_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_034983085.1|1211562_1212543_+	asparaginase	NA	NA	NA	NA	NA
WP_044005051.1|1212716_1214006_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	30.0	6.2e-45
WP_003700659.1|1214874_1215756_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	62.0	6.5e-78
WP_003700660.1|1215755_1216100_-	DNA replication initiation control protein YabA	NA	NA	NA	NA	NA
WP_003700662.1|1216114_1217107_-	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	30.9	2.6e-35
WP_003700663.1|1217141_1217768_-	dTMP kinase	NA	M1PSC7	Streptococcus_phage	51.0	6.9e-50
WP_011476227.1|1217887_1218127_-	YaaL family protein	NA	NA	NA	NA	NA
WP_003700665.1|1218140_1218740_-	recombination protein RecR	NA	NA	NA	NA	NA
WP_080739336.1|1218766_1219081_-	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_034983631.1|1219098_1220838_-	DNA polymerase III subunit gamma/tau	NA	A0A1U9WR94	Streptococcus_virus	38.9	6.6e-58
WP_044005603.1|1221044_1221512_-	nucleoside deaminase	NA	NA	NA	NA	NA
WP_003700669.1|1221558_1222170_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003700670.1|1222372_1222603_+	glutaredoxin-like protein NrdH	NA	X2KRY7	Enterococcus_phage	40.3	2.7e-12
WP_003700671.1|1222599_1222983_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	R4JF54	Bacillus_phage	38.7	5.8e-15
WP_003700672.1|1222963_1225135_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	63.9	3.5e-266
WP_003700673.1|1225152_1226133_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A096XT60	Enterococcus_phage	66.5	4.3e-123
WP_011476230.1|1226206_1228780_-	bifunctional lysylphosphatidylglycerol flippase/synthetase MprF	NA	NA	NA	NA	NA
WP_003700675.1|1228865_1229327_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003702605.1|1229421_1229790_-	50S ribosomal protein L7/L12	NA	NA	NA	NA	NA
WP_003700677.1|1229861_1230365_-	50S ribosomal protein L10	NA	NA	NA	NA	NA
WP_003700678.1|1230609_1231302_-	50S ribosomal protein L1	NA	NA	NA	NA	NA
WP_003700679.1|1231404_1231830_-	50S ribosomal protein L11	NA	NA	NA	NA	NA
WP_003702631.1|1231952_1232513_-	transcription termination/antitermination protein NusG	NA	F5B3X4	Synechococcus_phage	28.4	7.4e-11
WP_003700681.1|1232627_1232795_-	preprotein translocase subunit SecE	NA	NA	NA	NA	NA
WP_003700682.1|1232814_1232967_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_044005052.1|1233563_1234310_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_003700685.1|1234309_1234717_-	Mini-ribonuclease 3	NA	NA	NA	NA	NA
WP_003702615.1|1234709_1236122_-|tRNA	cysteine--tRNA ligase	tRNA	A0A2K9V966	Bandra_megavirus	29.9	4.3e-55
WP_003700687.1|1236273_1237761_-|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_044005053.1|1237891_1239004_-	PIN/TRAM domain-containing protein	NA	NA	NA	NA	NA
WP_044005055.1|1239029_1240403_-	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_003700690.1|1240420_1240957_-	dUTP diphosphatase	NA	J9PV85	Bacillus_phage	51.4	1.0e-41
WP_003702618.1|1241112_1241391_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_044005058.1|1241479_1242814_+	C1 family peptidase	NA	R4TV59	Phaeocystis_globosa_virus	34.0	5.2e-71
WP_003702606.1|1243017_1243377_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
>prophage 7
NZ_CP007646	Ligilactobacillus salivarius strain JCM1046 chromosome, complete genome	1836297	1289667	1341470	1836297	transposase	Streptococcus_phage(38.46%)	42	NA	NA
WP_044005086.1|1289667_1290957_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	30.5	2.8e-45
WP_044005088.1|1291104_1292928_-	glycoside hydrolase family 13 protein	NA	NA	NA	NA	NA
WP_044005090.1|1292908_1295332_-	glycogen/starch/alpha-glucan phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	42.5	1.2e-12
WP_044005092.1|1295360_1296791_-	glycogen synthase GlgA	NA	NA	NA	NA	NA
WP_044005094.1|1296790_1297963_-	glucose-1-phosphate adenylyltransferase subunit GlgD	NA	NA	NA	NA	NA
WP_044005096.1|1297952_1299095_-	glucose-1-phosphate adenylyltransferase	NA	H9NC64	Sphingomonas_phage	26.7	9.5e-13
WP_044005098.1|1299195_1301145_-	1,4-alpha-glucan branching protein GlgB	NA	NA	NA	NA	NA
WP_044005100.1|1301349_1303113_-	alpha-glycosidase	NA	NA	NA	NA	NA
WP_044005102.1|1303152_1304262_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044005104.1|1304351_1305686_-	NADP-specific glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_044005106.1|1305872_1307246_-	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_044005108.1|1307424_1307907_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003703026.1|1307924_1308239_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044005110.1|1308919_1310209_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	30.0	3.6e-45
WP_003705188.1|1310347_1311715_-	magnesium transporter	NA	NA	NA	NA	NA
WP_044005112.1|1311732_1312620_-	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	26.5	1.9e-05
WP_003703056.1|1312609_1313416_-	NAD kinase	NA	NA	NA	NA	NA
WP_044005115.1|1313436_1314081_-	GTP pyrophosphokinase family protein	NA	NA	NA	NA	NA
WP_044005117.1|1314181_1316257_-	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	30.6	1.2e-34
WP_044005119.1|1316331_1316868_+	sugar O-acetyltransferase	NA	NA	NA	NA	NA
WP_044005120.1|1316959_1318249_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	30.0	3.6e-45
WP_044005122.1|1318428_1319763_-	purine permease	NA	Q9KX94	Enterobacteria_phage	26.7	1.9e-28
WP_044005124.1|1319765_1320344_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_044005126.1|1320552_1321209_-	glycoside hydrolase family 73 protein	NA	A0A0K2CP65	Brevibacillus_phage	46.8	4.6e-28
WP_044005128.1|1321241_1321838_-	ECF transporter S component	NA	NA	NA	NA	NA
WP_044005130.1|1322257_1323883_-	NAD-dependent malic enzyme	NA	NA	NA	NA	NA
WP_044005132.1|1324025_1324907_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004563791.1|1324972_1325407_-	winged helix DNA-binding protein	NA	NA	NA	NA	NA
WP_044005134.1|1325743_1326277_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_044005136.1|1326304_1326748_-	universal stress protein	NA	NA	NA	NA	NA
WP_004564271.1|1326870_1327308_-	CopY/TcrY family copper transport repressor	NA	NA	NA	NA	NA
WP_044005139.1|1328758_1329964_+	DUF1002 domain-containing protein	NA	NA	NA	NA	NA
WP_044005141.1|1329975_1330584_+	DedA family protein	NA	NA	NA	NA	NA
WP_044005143.1|1330648_1331845_-	acetate kinase	NA	NA	NA	NA	NA
WP_044005145.1|1331926_1332496_-	acetyltransferase	NA	NA	NA	NA	NA
WP_044005147.1|1332603_1334025_-	anion permease	NA	NA	NA	NA	NA
WP_044005149.1|1334117_1335503_-	flavocytochrome c	NA	A0A2P0ZL82	Lactobacillus_phage	32.9	1.7e-56
WP_044005151.1|1335522_1336905_-	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_003703609.1|1337199_1337493_+	YbaN family protein	NA	NA	NA	NA	NA
WP_143456852.1|1337561_1338506_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	37.8	1.2e-40
WP_044005007.1|1338460_1338979_-|transposase	transposase	transposase	A0A1B1P776	Bacillus_phage	35.8	6.6e-14
WP_080739338.1|1340558_1341470_-|transposase	transposase	transposase	A0A1S5SBP9	Streptococcus_phage	27.4	7.1e-19
>prophage 8
NZ_CP007646	Ligilactobacillus salivarius strain JCM1046 chromosome, complete genome	1836297	1357370	1420221	1836297	transposase,tail,holin,integrase,terminase,tRNA,capsid,portal,head,protease	Erysipelothrix_phage(65.52%)	51	1383375:1383390	1425882:1425897
WP_044005161.1|1357370_1358660_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	30.2	2.8e-45
WP_044005165.1|1359473_1360652_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_044005167.1|1360664_1362752_-	SAM-dependent DNA methyltransferase	NA	A0A220A2U5	Liberibacter_phage	22.7	2.4e-22
WP_044005169.1|1363042_1363372_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087448619.1|1363456_1364314_-	Mrr restriction system protein	NA	NA	NA	NA	NA
WP_180707232.1|1364655_1364817_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044005171.1|1365016_1366291_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044005173.1|1366406_1367594_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_044005175.1|1367597_1369226_-	SAM-dependent DNA methyltransferase	NA	A0A2H4PQP4	Staphylococcus_phage	27.5	1.3e-28
WP_044005177.1|1369231_1372306_-	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	24.5	1.0e-24
WP_044005179.1|1372338_1372560_-	helix-turn-helix transcriptional regulator	NA	A0A2K5B263	Erysipelothrix_phage	67.2	6.1e-17
WP_044005181.1|1372573_1375189_-	helicase	NA	NA	NA	NA	NA
WP_080739378.1|1375193_1376153_-	DUF1837 domain-containing protein	NA	NA	NA	NA	NA
WP_148305438.1|1376882_1377410_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_044005185.1|1377514_1377712_+	hypothetical protein	NA	A0A2I4R673	Erysipelothrix_phage	40.4	1.7e-07
WP_044005187.1|1377698_1378031_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044005189.1|1378014_1379157_+	DUF2800 domain-containing protein	NA	A0A2K5B2A8	Erysipelothrix_phage	55.1	3.3e-114
WP_044005191.1|1379158_1379710_+	DUF2815 family protein	NA	A0A2K5B2A9	Erysipelothrix_phage	72.1	2.2e-71
WP_044005193.1|1379760_1381695_+	DNA polymerase	NA	A0A2K5B2B0	Erysipelothrix_phage	58.5	1.7e-224
WP_044005609.1|1381789_1382188_+	hypothetical protein	NA	A0A2K5B270	Erysipelothrix_phage	37.3	8.4e-17
WP_044005195.1|1382190_1384440_+	primase C-terminal domain-containing protein	NA	E4ZFK6	Streptococcus_phage	48.8	2.0e-211
1383375:1383390	attL	GCCACTACTTAATAAA	NA	NA	NA	NA
WP_044005197.1|1384634_1384937_+	VRR-NUC domain-containing protein	NA	A0A2K5B272	Erysipelothrix_phage	56.7	1.9e-21
WP_044005199.1|1384896_1386279_+	DEAD/DEAH box helicase	NA	A0A2K5B273	Erysipelothrix_phage	65.9	1.3e-154
WP_044005201.1|1386247_1386718_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044005203.1|1386852_1387230_+	HNH endonuclease	NA	A0A2K5B276	Erysipelothrix_phage	53.8	1.8e-32
WP_044005205.1|1387346_1387889_+|terminase	terminase	terminase	A0A2K5B277	Erysipelothrix_phage	59.0	1.3e-57
WP_044005207.1|1387888_1389118_+	DNA modification methylase	NA	A0A2I4R670	Erysipelothrix_phage	62.9	5.2e-150
WP_044005209.1|1389189_1389822_+	hypothetical protein	NA	A0A2K5B280	Erysipelothrix_phage	40.4	4.3e-39
WP_044005211.1|1389814_1390021_+	DUF5049 domain-containing protein	NA	NA	NA	NA	NA
WP_044005213.1|1390083_1391685_+|terminase	terminase large subunit	terminase	A0A2K5B285	Erysipelothrix_phage	78.8	1.8e-251
WP_191980114.1|1391712_1391874_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044005215.1|1392235_1393492_+|portal	phage portal protein	portal	Q6DMU2	Streptococcus_phage	62.1	4.1e-150
WP_044005217.1|1393488_1394151_+|protease	Clp protease ClpP	protease	A0A2K5B288	Erysipelothrix_phage	56.9	1.2e-55
WP_044005219.1|1394171_1395350_+|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	59.7	2.0e-130
WP_003672647.1|1395361_1395640_+|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
WP_044005226.1|1395640_1396021_+|head	phage head closure protein	head	NA	NA	NA	NA
WP_003672651.1|1396010_1396433_+|holin	phage holin family protein	holin	A0A2K5B2A2	Erysipelothrix_phage	65.8	1.5e-40
WP_003672653.1|1396530_1396719_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044005229.1|1396781_1398332_+	recombinase family protein	NA	A0A2K5B2B2	Erysipelothrix_phage	34.7	3.7e-84
WP_044005231.1|1398318_1398723_+	recombinase	NA	NA	NA	NA	NA
WP_044005233.1|1398709_1400296_+	recombinase family protein	NA	A0A2K5B2B4	Erysipelothrix_phage	47.3	1.5e-125
WP_044005235.1|1400539_1401913_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	49.6	2.5e-124
WP_003705249.1|1401993_1403013_-	diacylglycerol kinase	NA	A0A1V0SBJ0	Catovirus	29.0	1.5e-17
WP_003702437.1|1403045_1404479_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_034982969.1|1404478_1405942_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_003702422.1|1405944_1406244_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_034982968.1|1406395_1407541_-	CamS family sex pheromone protein	NA	NA	NA	NA	NA
WP_034982967.1|1407537_1409556_-	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	34.9	4.4e-106
WP_044005610.1|1409572_1411795_-	DNA helicase PcrA	NA	A7KV33	Bacillus_phage	42.3	2.9e-135
WP_034982965.1|1411914_1413054_-	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_034983499.1|1418988_1420221_-|integrase	site-specific integrase	integrase	H7BUX8	unidentified_phage	41.1	7.7e-85
1425882:1425897	attR	GCCACTACTTAATAAA	NA	NA	NA	NA
>prophage 1
NZ_CP007650	Ligilactobacillus salivarius strain JCM1046 plasmid pCTN1046, complete sequence	33315	431	17209	33315	integrase	Streptococcus_phage(100.0%)	18	11487:11501	18995:19009
WP_000813488.1|431_1817_+	DNA translocase FtsK	NA	A0A1S5SFB5	Streptococcus_phage	100.0	1.1e-265
WP_000879507.1|1819_1972_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000398284.1|1994_3200_+	replication initiation factor domain-containing protein	NA	A0A1S5SEX3	Streptococcus_phage	100.0	2.8e-233
WP_001009056.1|3242_3464_+	hypothetical protein	NA	A0A1S5SEY0	Streptococcus_phage	100.0	4.3e-31
WP_000342539.1|3580_4078_+	antirestriction protein ArdA	NA	A0A1S5SF25	Streptococcus_phage	100.0	1.7e-91
WP_000506270.1|4052_4559_+	conjugal transfer protein	NA	A0A1S5SEX7	Streptococcus_phage	100.0	8.6e-91
WP_000331160.1|4542_6990_+	ATP-binding protein	NA	A0A1S5SF64	Streptococcus_phage	100.0	0.0e+00
WP_000804748.1|6992_9170_+	membrane protein	NA	A0A1S5SF30	Streptococcus_phage	100.0	0.0e+00
WP_000769868.1|9166_10168_+	lysozyme family protein	NA	A0A1S5SEZ8	Streptococcus_phage	100.0	5.0e-191
WP_001224318.1|10164_11097_+	conjugal transfer protein	NA	A0A1S5SF22	Streptococcus_phage	99.4	3.1e-171
WP_001791010.1|11341_11458_+	tetracycline resistance determinant leader peptide	NA	NA	NA	NA	NA
WP_002371500.1|11473_13393_+	tetracycline resistance ribosomal protection protein Tet(M)	NA	A0A1S5SF82	Streptococcus_phage	99.2	0.0e+00
11487:11501	attL	ATATTGGAGTTTTAG	NA	NA	NA	NA
WP_000336323.1|13511_13679_+	cysteine-rich KTR domain-containing protein	NA	D0R0F6	Streptococcus_phage	68.0	1.6e-14
WP_001227347.1|13738_14092_-	helix-turn-helix domain-containing protein	NA	A0A1S5SFA6	Streptococcus_phage	100.0	1.3e-58
WP_000804885.1|14596_15019_+	sigma-70 family RNA polymerase sigma factor	NA	A0A1S5SEW0	Streptococcus_phage	100.0	2.5e-72
WP_000857133.1|15015_15246_+	helix-turn-helix domain-containing protein	NA	A0A1S5SEX1	Streptococcus_phage	100.0	2.7e-36
WP_000814511.1|15706_15910_+	excisionase	NA	A0A1S5SF07	Streptococcus_phage	100.0	4.0e-31
WP_044006028.1|15991_17209_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1S5SEW7	Streptococcus_phage	99.8	8.3e-233
18995:19009	attR	ATATTGGAGTTTTAG	NA	NA	NA	NA
>prophage 1
NZ_CP007647	Ligilactobacillus salivarius strain JCM1046 plasmid pMP1046A, complete sequence	219748	5301	14446	219748	transposase	Enterococcus_phage(33.33%)	6	NA	NA
WP_003699336.1|5301_6114_+	AAA family ATPase	NA	F0PIG8	Enterococcus_phage	61.0	8.6e-85
WP_003699335.1|6113_6449_+	DUF5388 domain-containing protein	NA	F0PIG7	Enterococcus_phage	34.2	1.3e-07
WP_034983710.1|6908_8126_+|transposase	transposase	transposase	A0A0P0IJS6	Lactobacillus_phage	55.3	3.3e-120
WP_034983803.1|8746_11281_-	M1 family metallopeptidase	NA	A0A0P0IY26	Acinetobacter_phage	26.5	3.3e-66
WP_044005673.1|12158_13448_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	30.0	8.1e-45
WP_044005674.1|13591_14446_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	39.9	4.5e-52
>prophage 2
NZ_CP007647	Ligilactobacillus salivarius strain JCM1046 plasmid pMP1046A, complete sequence	219748	71391	82550	219748		Streptococcus_phage(33.33%)	8	NA	NA
WP_080739395.1|71391_72234_+	DegV family protein	NA	A0A1X9I5J4	Streptococcus_phage	35.0	5.5e-42
WP_044005705.1|72421_72856_+	N-acetyltransferase	NA	A0A1X9I6I8	Streptococcus_phage	50.0	3.1e-33
WP_003699254.1|73948_74224_-	HU family DNA-binding protein	NA	A0A0H3UZA0	Geobacillus_virus	62.9	4.1e-23
WP_044005706.1|74528_79121_+	S8 family serine peptidase	NA	A0A1B0T6A2	Bacillus_phage	31.2	5.2e-17
WP_003703258.1|79249_79609_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003706971.1|79624_80437_+	SPFH domain-containing protein	NA	S4VT23	Pandoravirus	29.7	1.1e-15
WP_034983646.1|80771_81467_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003706982.1|81977_82550_+	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	42.6	3.9e-23
>prophage 3
NZ_CP007647	Ligilactobacillus salivarius strain JCM1046 plasmid pMP1046A, complete sequence	219748	119030	178577	219748	capsid,bacteriocin,transposase,integrase	Paramecium_bursaria_Chlorella_virus(20.0%)	52	144970:144986	181456:181472
WP_044005722.1|119030_120428_+|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_034982226.1|121123_121348_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032494132.1|121439_122414_+	choloylglycine hydrolase family protein	NA	M1HWD6	Paramecium_bursaria_Chlorella_virus	31.8	8.6e-23
WP_044005723.1|122535_123333_-	tyrosine-protein phosphatase	NA	NA	NA	NA	NA
WP_044005724.1|123405_124011_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_044005725.1|124013_125123_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_034982221.1|125131_125872_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_044005726.1|125874_126750_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.7	1.4e-19
WP_044005727.1|126986_127670_+	ribose-5-phosphate isomerase RpiA	NA	NA	NA	NA	NA
WP_034982218.1|127686_128334_+	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_034982250.1|128403_128928_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003702995.1|129435_129738_+	hypothetical protein	NA	NA	NA	NA	NA
WP_034982162.1|129995_130874_+	patatin family protein	NA	NA	NA	NA	NA
WP_003708477.1|130959_131796_-	pyruvate formate lyase-activating protein	NA	NA	NA	NA	NA
WP_044005728.1|131822_134090_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	42.2	2.8e-173
WP_080739397.1|134401_134986_-	VIT1/CCC1 transporter family protein	NA	NA	NA	NA	NA
WP_174633258.1|135178_136603_-	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_003706789.1|136574_137024_-	SUF system NifU family Fe-S cluster assembly protein	NA	NA	NA	NA	NA
WP_034982157.1|137020_138247_-	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	47.6	2.4e-110
WP_034982156.1|138230_139484_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_034982154.1|139496_140276_-	Fe-S cluster assembly ATPase SufC	NA	A0A285PWH2	Cedratvirus	28.3	1.3e-08
WP_044005729.1|140537_142172_-	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_044005762.1|142625_143783_-	chloride transporter	NA	NA	NA	NA	NA
WP_044005730.1|143976_144249_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
144970:144986	attL	TTATTTGCATAAATTTT	NA	NA	NA	NA
WP_004564415.1|145088_146138_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_044005731.1|146344_147340_+	D-2-hydroxyacid dehydrogenase	NA	M1H502	Paramecium_bursaria_Chlorella_virus	38.4	1.1e-44
WP_044005732.1|147400_148081_-	fructose-6-phosphate aldolase	NA	A0A0E3EPH4	Synechococcus_phage	30.9	1.5e-21
WP_044005733.1|148147_148528_-	PTS glucitol/sorbitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_044005734.1|148564_149590_-	PTS glucitol/sorbitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_003699442.1|149606_150149_-	PTS glucitol/sorbitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_003699440.1|150160_150658_-	transcriptional regulator GutM	NA	NA	NA	NA	NA
WP_044005735.1|150658_152518_-	HTH domain-containing protein	NA	NA	NA	NA	NA
WP_044005736.1|152533_153337_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_044005737.1|153638_154001_-	hypothetical protein	NA	A0A1S5RCP6	Lactobacillus_phage	44.9	1.1e-10
WP_080739399.1|155017_155866_-|capsid	minor capsid protein	capsid	U3PFU0	Lactobacillus_phage	46.4	1.7e-30
WP_044005739.1|155966_156863_-	nitronate monooxygenase	NA	NA	NA	NA	NA
WP_034982116.1|156965_159623_-	bifunctional acetaldehyde-CoA/alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_044005740.1|162693_163983_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	30.0	3.6e-45
WP_044005741.1|164400_166371_-	fructose-bisphosphatase class III	NA	NA	NA	NA	NA
WP_034983677.1|166715_167537_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_148305456.1|168342_169011_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044005743.1|169086_169419_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143453799.1|169423_169921_-	hypothetical protein	NA	NA	NA	NA	NA
WP_034983622.1|170397_170802_-	PIN domain-containing protein	NA	NA	NA	NA	NA
WP_034983620.1|170801_171023_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_044005744.1|171465_172614_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_034983617.1|174998_175196_-	hypothetical protein	NA	NA	NA	NA	NA
WP_034983616.1|175440_175680_-	hypothetical protein	NA	NA	NA	NA	NA
WP_034983615.1|175716_176511_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_034983613.1|176524_177817_-	GHKL domain-containing protein	NA	NA	NA	NA	NA
WP_034983611.1|177818_177938_-|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_034983610.1|178370_178577_-|bacteriocin	Blp family class II bacteriocin	bacteriocin	NA	NA	NA	NA
181456:181472	attR	AAAATTTATGCAAATAA	NA	NA	NA	NA
>prophage 1
NZ_CP007648	Ligilactobacillus salivarius strain JCM1046 plasmid pMP1046B, complete sequence	129218	44482	102139	129218	transposase,tail,integrase,holin	Lactobacillus_phage(33.33%)	60	64280:64299	101567:101586
WP_044005825.1|44482_45739_+|transposase	transposase	transposase	A0A288TXV8	Enterococcus_phage	36.9	1.7e-55
WP_044005905.1|47004_47721_+	deoxynucleoside kinase	NA	A0A2K9VCW4	Lactobacillus_phage	61.2	3.4e-77
WP_044005826.1|47729_47951_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052399089.1|48086_48593_+	nucleoside 2-deoxyribosyltransferase	NA	A0A2K9VD79	Lactobacillus_phage	45.8	2.6e-31
WP_044005827.1|48711_48993_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044005828.1|48997_49381_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044005829.1|49681_50239_+|integrase	tyrosine-type recombinase/integrase	integrase	D2XR58	Bacillus_phage	43.6	5.4e-30
WP_044005830.1|50990_51329_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044005831.1|51617_52283_-	thymidine kinase	NA	A0A1W6JMX7	Lactococcus_phage	54.8	5.6e-50
WP_044005833.1|52282_52627_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172399980.1|52651_52795_-	hypothetical protein	NA	A0A0A7NQQ0	Lactobacillus_phage	57.8	3.1e-06
WP_044005834.1|52886_53195_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044005835.1|53194_53713_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052399080.1|54035_54590_-	MazG-like family protein	NA	K4JW89	Streptococcus_phage	35.3	5.1e-20
WP_044005836.1|54593_54998_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044005837.1|54984_55653_-	N-6 DNA methylase	NA	L0P368	Streptococcus_phage	47.6	3.0e-51
WP_052399081.1|55872_56385_-	phosphatidylglycerophosphatase A	NA	A0A2K9VCI2	Lactobacillus_phage	43.2	9.7e-34
WP_044005838.1|56769_57054_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044005839.1|57214_57712_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044005840.1|57711_57993_-	hypothetical protein	NA	K4I1W7	Lactobacillus_phage	58.8	7.5e-20
WP_044005841.1|57994_58345_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044005842.1|58346_58727_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044005843.1|58740_59181_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148305462.1|59180_59666_-	adenine-specific DNA methylase	NA	A0A2H4IZ57	uncultured_Caudovirales_phage	68.2	5.7e-60
WP_148305463.1|59703_59958_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044005846.1|59950_60232_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044005847.1|60228_60603_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052399082.1|60832_61378_-	sugar-phospahte nucleotidyltransferase	NA	A0MN47	Thermus_phage	44.1	2.0e-37
WP_044005850.1|61579_62734_-|transposase	transposase	transposase	C1KFS0	Lactobacillus_virus	47.3	1.5e-95
WP_080739404.1|63544_64210_-	site-specific DNA-methyltransferase	NA	A0A2P0ZL38	Lactobacillus_phage	63.0	1.1e-72
64280:64299	attL	ATCCCACCTTATTATTTATT	NA	NA	NA	NA
WP_044005852.1|64290_64647_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044005853.1|64651_65305_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044005854.1|65317_65854_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044005855.1|65850_66372_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044005856.1|66358_66895_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044005857.1|66881_67409_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044005858.1|67412_67889_-	DUF1064 domain-containing protein	NA	A0A1I9KKZ1	Lactobacillus_phage	46.8	1.0e-32
WP_148305464.1|69847_70315_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044005861.1|70316_73658_-	DNA polymerase III subunit alpha	NA	A0A218KC91	Bacillus_phage	37.1	2.5e-202
WP_044005862.1|73647_74262_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158423237.1|74285_75413_-	PD-(D/E)XK nuclease family protein	NA	Q332G6	Clostridium_botulinum_C_phage	28.4	5.5e-29
WP_052399084.1|75480_76557_-	hypothetical protein	NA	Q332G7	Clostridium_botulinum_C_phage	31.3	1.6e-30
WP_044005865.1|76664_77138_-	hypothetical protein	NA	NA	NA	NA	NA
WP_191980120.1|77223_78465_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A0S2MYF3	Enterococcus_phage	47.9	3.0e-89
WP_052399085.1|78577_80941_-	hypothetical protein	NA	A0A0A7NNI1	Lactobacillus_phage	44.6	1.3e-80
WP_044005866.1|81038_81719_-	hypothetical protein	NA	A0A0U4IPJ0	Arthrobacter_phage	28.1	4.6e-07
WP_044005867.1|81731_83030_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044005868.1|83079_83478_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044005869.1|83485_84187_-	hypothetical protein	NA	A0A0H3V0Q5	Geobacillus_virus	32.8	2.2e-28
WP_044005913.1|84326_86465_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044005870.1|86503_87523_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044005914.1|87526_88654_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044005871.1|88808_97553_-|tail	phage tail tape measure protein	tail	A0A0K2FL55	Brevibacillus_phage	22.8	1.0e-18
WP_044005872.1|97491_98133_-	hypothetical protein	NA	NA	NA	NA	NA
WP_191980121.1|98225_98777_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044005874.1|98900_99938_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_080739409.1|100022_100235_-	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
WP_044005875.1|100307_100790_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044005876.1|100805_101558_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044005877.1|101698_102139_-|holin	phage holin family protein	holin	D9ZNF2	Clostridium_phage	36.6	1.5e-11
101567:101586	attR	ATCCCACCTTATTATTTATT	NA	NA	NA	NA
>prophage 2
NZ_CP007648	Ligilactobacillus salivarius strain JCM1046 plasmid pMP1046B, complete sequence	129218	116028	124121	129218		Bacillus_phage(28.57%)	9	NA	NA
WP_044005888.1|116028_117021_-	hypothetical protein	NA	A0A218KCB5	Bacillus_phage	32.1	1.6e-40
WP_044005889.1|117044_117491_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044005890.1|117511_119110_-	hypothetical protein	NA	A0A0K2FMA5	Brevibacillus_phage	35.0	2.7e-29
WP_044005891.1|119131_120619_-	hypothetical protein	NA	A0A2R2ZGH0	Clostridioides_phage	27.9	2.0e-34
WP_052399091.1|120631_122068_-	hypothetical protein	NA	A0A1P8CWR6	Bacillus_phage	42.1	5.2e-93
WP_044005892.1|122441_122651_-	hypothetical protein	NA	A0A0N9ST81	Staphylococcus_phage	46.3	7.0e-07
WP_044005893.1|122634_123423_-	hypothetical protein	NA	A0A0A8WEC3	Clostridium_phage	26.1	2.1e-11
WP_158423239.1|123412_123559_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044005895.1|123842_124121_-	HU family DNA-binding protein	NA	A0A075E147	Dickeya_phage	37.2	1.2e-06
