The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP009459	Cedecea neteri strain ND14a, complete genome	4659311	12176	31719	4659311	tail,lysis	Salmonella_phage(29.17%)	30	NA	NA
WP_039297296.1|12176_12734_-	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	84.7	2.0e-85
WP_071842800.1|12763_13243_+	hypothetical protein	NA	A0A0F7LCR3	Escherichia_phage	47.7	5.7e-36
WP_039297299.1|13242_13842_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	49.0	2.8e-48
WP_039306461.1|13822_14008_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081942985.1|14021_14708_-	hypothetical protein	NA	A0A0M3ULD8	Salmonella_phage	53.6	4.3e-29
WP_039297303.1|14707_15388_-	DUF2612 domain-containing protein	NA	A0A2H4J1A9	uncultured_Caudovirales_phage	76.1	1.3e-97
WP_039297306.1|15384_16584_-	bacteriophage protein	NA	A0A0M4RD32	Salmonella_phage	71.4	2.0e-154
WP_039297308.1|16584_16935_-	hypothetical protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	57.3	2.0e-30
WP_039297311.1|16931_17615_-	translation initiation factor IF-2	NA	A0A0M5M1K7	Salmonella_phage	55.4	1.6e-60
WP_039297313.1|17659_18661_-	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	40.7	1.9e-73
WP_039297315.1|18671_18980_-	hypothetical protein	NA	A0A0M4R5B7	Salmonella_phage	53.0	7.1e-24
WP_039297317.1|18989_19568_-	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	45.5	1.4e-33
WP_039297320.1|19567_21319_-	hypothetical protein	NA	A0A0M4REK7	Salmonella_phage	34.7	4.5e-62
WP_052045528.1|21308_21497_-	lytic transglycosylase	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	50.0	2.2e-07
WP_039297322.1|21496_21910_-	hypothetical protein	NA	A0A2H4J2V6	uncultured_Caudovirales_phage	58.2	5.2e-38
WP_039297325.1|21913_22354_-	DUF3277 family protein	NA	A0A0M5M1K6	Salmonella_phage	63.7	6.2e-45
WP_039297328.1|22364_23504_-	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	62.0	4.7e-129
WP_039297331.1|23507_24047_-	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	41.9	2.0e-37
WP_039305791.1|24091_24970_-	triacylglycerol lipase	NA	NA	NA	NA	NA
WP_039297332.1|25020_25473_-|lysis	lysis protein	lysis	Q2A0C4	Sodalis_phage	40.8	1.4e-20
WP_039297335.1|25469_25961_-	lysozyme	NA	A0A1R3Y5W5	Salmonella_virus	50.0	2.3e-40
WP_039297337.1|25960_26260_-	hypothetical protein	NA	O64361	Escherichia_phage	46.9	3.3e-18
WP_039297341.1|26317_26653_-	antitermination protein	NA	Q716D8	Shigella_phage	46.4	1.1e-14
WP_008459494.1|26939_27686_-	helix-turn-helix transcriptional regulator	NA	A0A2I6PIE7	Escherichia_phage	45.9	1.9e-46
WP_039297344.1|27947_28208_+	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	50.0	4.2e-17
WP_008459499.1|28204_28585_-	holo-ACP synthase	NA	NA	NA	NA	NA
WP_039297347.1|28584_29316_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_039297349.1|29390_30128_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_039297352.1|30133_31042_-	GTPase Era	NA	NA	NA	NA	NA
WP_008459505.1|31038_31719_-	ribonuclease III	NA	A0A0P0YM82	Yellowstone_lake_phycodnavirus	29.7	4.3e-21
>prophage 2
NZ_CP009459	Cedecea neteri strain ND14a, complete genome	4659311	1698782	1740136	4659311	head,terminase,tail,capsid,portal,plate,lysis,transposase,integrase,tRNA	Salmonella_phage(78.05%)	50	1697395:1697441	1733793:1733839
1697395:1697441	attL	TGGTGGCCCCTGCTGGACTTGAACCAGCGACCAAGCGATTATGAGTC	NA	NA	NA	NA
WP_039300029.1|1698782_1699811_-|integrase	tyrosine-type recombinase/integrase	integrase	F1BUS9	Erwinia_phage	59.9	8.3e-117
WP_039300032.1|1699814_1700435_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	37.4	2.8e-35
WP_039300035.1|1700534_1700771_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039300037.1|1700805_1701315_+	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	77.5	3.8e-70
WP_071842863.1|1701322_1701523_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	80.3	4.2e-25
WP_039300040.1|1701486_1701828_+	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	76.1	1.7e-42
WP_039300043.1|1701894_1702122_+	DUF2732 domain-containing protein	NA	A0A0M3UL87	Salmonella_phage	69.3	1.7e-19
WP_039300047.1|1702121_1702349_+	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	84.0	7.6e-31
WP_039300050.1|1702476_1703349_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	67.9	8.1e-105
WP_039300056.1|1704178_1706455_+	replication endonuclease	NA	A0A0M4RTM8	Salmonella_phage	62.6	2.5e-267
WP_039300059.1|1706782_1707247_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039300062.1|1707243_1707618_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156107014.1|1707995_1709115_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.7	5.1e-51
WP_032678736.1|1709405_1709594_+	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	93.5	1.5e-24
WP_039300077.1|1709604_1709838_+	DinI family protein	NA	A0A1S6L014	Salmonella_phage	85.5	4.3e-29
WP_039300081.1|1710123_1710318_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039300085.1|1710327_1711116_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039300087.1|1711371_1712070_+	DUF4145 domain-containing protein	NA	NA	NA	NA	NA
WP_156107015.1|1712078_1713122_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	90.4	2.6e-182
WP_039300093.1|1713118_1714885_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	94.2	0.0e+00
WP_039300096.1|1715027_1715852_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	82.7	3.2e-111
WP_039300099.1|1715868_1716933_+|capsid	phage major capsid protein, P2 family	capsid	A0A1S6KZZ3	Salmonella_phage	89.5	1.3e-178
WP_039300102.1|1716936_1717587_+	hypothetical protein	NA	A0A1S6KZX1	Salmonella_phage	79.2	1.5e-92
WP_039300106.1|1717681_1718146_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	85.7	1.8e-71
WP_039300109.1|1718145_1718349_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	89.6	3.0e-31
WP_039300112.1|1718351_1718567_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	50.7	3.3e-12
WP_039300115.1|1718547_1719057_+	lysozyme	NA	A0A1S6KZY9	Salmonella_phage	91.1	1.7e-86
WP_039300118.1|1719061_1719439_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	75.2	3.1e-45
WP_039300120.1|1719438_1719864_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	85.1	9.5e-59
WP_039300123.1|1719959_1720391_+|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	89.5	1.6e-69
WP_039300126.1|1720383_1720833_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	71.1	1.3e-53
WP_052045557.1|1720806_1721616_-	DUF2971 domain-containing protein	NA	NA	NA	NA	NA
WP_039300129.1|1721746_1722382_+|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	73.8	3.7e-83
WP_039300131.1|1722378_1722738_+|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	72.9	7.3e-44
WP_039300135.1|1722724_1723633_+|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	83.1	3.1e-131
WP_039300138.1|1723625_1724168_+|tail	phage tail protein I	tail	Q858V5	Yersinia_virus	74.9	8.3e-76
WP_039300141.1|1726122_1726692_+|tail	tail fiber assembly protein	tail	U5N0T1	Enterobacteria_phage	43.7	4.6e-24
WP_039300144.1|1726856_1728029_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	88.2	8.1e-201
WP_039300146.1|1728038_1728554_+|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	84.8	5.9e-79
WP_039300148.1|1728608_1728911_+|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	82.0	6.8e-35
WP_071842818.1|1728925_1729045_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	89.7	1.7e-13
WP_039300150.1|1729037_1731785_+|tail	phage tail tape measure protein	tail	Q9ZXK0	Pseudomonas_virus	40.5	3.1e-158
WP_039300152.1|1731781_1732267_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	78.8	5.3e-66
WP_039300155.1|1732263_1733361_+	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	84.7	1.3e-171
WP_071842819.1|1733436_1733655_+	levansucrase regulator	NA	Q53ZE7	Salmonella_virus	76.4	7.5e-28
WP_039300159.1|1733994_1734501_+	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
1733793:1733839	attR	TGGTGGCCCCTGCTGGACTTGAACCAGCGACCAAGCGATTATGAGTC	NA	NA	NA	NA
WP_039300162.1|1734763_1736608_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.3	1.9e-34
WP_039306006.1|1736758_1738504_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	39.1	4.9e-77
WP_001144069.1|1738657_1738873_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_039300165.1|1739122_1740136_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.8	4.3e-110
>prophage 3
NZ_CP009459	Cedecea neteri strain ND14a, complete genome	4659311	2515290	2524874	4659311	protease,tRNA	Dickeya_phage(16.67%)	8	NA	NA
WP_039301527.1|2515290_2516406_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	39.8	1.4e-08
WP_039301529.1|2516402_2518349_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	41.4	5.0e-38
WP_008461102.1|2518426_2518648_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	62.7	3.6e-17
WP_008461103.1|2518971_2519292_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	47.2	2.4e-14
WP_008461105.1|2519319_2521593_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	4.3e-166
WP_002211347.1|2521690_2521909_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_039301531.1|2522194_2522890_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_039301533.1|2523152_2524874_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	F2Y2R6	Organic_Lake_phycodnavirus	26.1	8.7e-18
>prophage 4
NZ_CP009459	Cedecea neteri strain ND14a, complete genome	4659311	4040366	4052183	4659311		Enterobacteria_phage(33.33%)	11	NA	NA
WP_039304607.1|4040366_4041377_-	NAD-dependent epimerase/dehydratase family protein	NA	K7Y9E1	Megavirus	38.8	8.3e-45
WP_039304610.1|4041415_4042780_-	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
WP_039304613.1|4042772_4043897_-	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	A0A2P1ELT3	Moumouvirus	28.5	3.7e-25
WP_039304616.1|4043898_4044987_-	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	A0A2K9L0G1	Tupanvirus	31.6	6.9e-29
WP_039304620.1|4044996_4045770_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_039304623.1|4045820_4046366_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	60.9	1.5e-56
WP_039304626.1|4046369_4047248_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.1	8.7e-107
WP_039304628.1|4047296_4048196_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	33.3	4.5e-26
WP_039304630.1|4048192_4049278_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	52.8	3.7e-99
WP_039304633.1|4049684_4050584_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	41.8	1.0e-49
WP_039304636.1|4050758_4052183_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	28.3	1.1e-18
>prophage 5
NZ_CP009459	Cedecea neteri strain ND14a, complete genome	4659311	4650339	4658362	4659311	tail	Salmonella_phage(42.86%)	9	NA	NA
WP_039297296.1|4650339_4650897_-	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	84.7	2.0e-85
WP_039306461.1|4651320_4651506_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039305771.1|4652086_4652872_-|tail	tail fiber protein	tail	M1TAS6	Escherichia_phage	42.6	3.6e-35
WP_039297303.1|4652871_4653552_-	DUF2612 domain-containing protein	NA	A0A2H4J1A9	uncultured_Caudovirales_phage	76.1	1.3e-97
WP_039297306.1|4653548_4654748_-	bacteriophage protein	NA	A0A0M4RD32	Salmonella_phage	71.4	2.0e-154
WP_039297308.1|4654748_4655099_-	hypothetical protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	57.3	2.0e-30
WP_039297315.1|4656832_4657141_-	hypothetical protein	NA	A0A0M4R5B7	Salmonella_phage	53.0	7.1e-24
WP_156107054.1|4657728_4657950_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039305772.1|4658098_4658362_-	hypothetical protein	NA	A0A0M4REK7	Salmonella_phage	35.0	2.7e-08
