The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP012413	Piscirickettsia salmonis strain PM15972A1 chromosome, complete genome	3062470	3076	55138	3062470	tRNA,transposase	Staphylococcus_phage(36.36%)	55	NA	NA
WP_016209326.1|3076_4456_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE	tRNA	NA	NA	NA	NA
WP_016209346.1|4570_6463_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
WP_036776463.1|6510_7137_+	16S rRNA (guanine(527)-N(7))-methyltransferase RsmG	NA	NA	NA	NA	NA
WP_016209314.1|7156_8041_+	ParA family protein	NA	Q8JL10	Natrialba_phage	27.7	1.7e-17
WP_016209349.1|8073_8967_+	ParB/RepB/Spo0J family partition protein	NA	I3NLC2	Bifidobacterium_phage	31.8	6.7e-14
WP_016209313.1|9081_9480_+	ATP synthase subunit I	NA	NA	NA	NA	NA
WP_016209354.1|9484_10300_+	F0F1 ATP synthase subunit A	NA	NA	NA	NA	NA
WP_016209328.1|10351_10756_+	F0F1 ATP synthase subunit C	NA	NA	NA	NA	NA
WP_017378485.1|10810_11281_+	F0F1 ATP synthase subunit B	NA	NA	NA	NA	NA
WP_016209332.1|11292_11820_+	F0F1 ATP synthase subunit delta	NA	NA	NA	NA	NA
WP_016209323.1|11836_13378_+	F0F1 ATP synthase subunit alpha	NA	NA	NA	NA	NA
WP_016209322.1|13403_14264_+	F0F1 ATP synthase subunit gamma	NA	NA	NA	NA	NA
WP_016209339.1|14294_15686_+	F0F1 ATP synthase subunit beta	NA	NA	NA	NA	NA
WP_016209335.1|15710_16139_+	F0F1 ATP synthase subunit epsilon	NA	NA	NA	NA	NA
WP_016209325.1|16232_17597_+	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	40.5	6.6e-37
WP_036776458.1|17652_19488_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	44.0	3.3e-124
WP_155047007.1|19646_20252_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_075273393.1|20316_21024_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075273395.1|21168_21351_-	phosphatase	NA	NA	NA	NA	NA
WP_075273397.1|21670_22066_-|transposase	transposase zinc-binding domain-containing protein	transposase	NA	NA	NA	NA
WP_016211851.1|22754_23411_-	2OG-Fe dioxygenase family protein	NA	NA	NA	NA	NA
WP_075273625.1|23607_24360_-	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_016211852.1|24418_25132_-	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	36.0	1.7e-28
WP_129556614.1|25717_25870_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_122942409.1|26007_26439_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211924.1|26798_26957_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211923.1|27112_28084_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_157883632.1|28002_28248_-|transposase	transposase zinc-binding domain-containing protein	transposase	NA	NA	NA	NA
WP_016212448.1|28766_29546_+	O-methyltransferase family protein	NA	NA	NA	NA	NA
WP_080743040.1|29592_30249_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_054300271.1|30307_31282_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_155047006.1|31535_31676_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052104719.1|32082_33507_-	MFS transporter	NA	NA	NA	NA	NA
WP_016211299.1|33734_34676_+	ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_032126720.1|34695_36690_+	cytochrome o ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_016211298.1|36686_37292_+	cytochrome c oxidase subunit 3	NA	NA	NA	NA	NA
WP_016211294.1|37293_37635_+	prokaryotic cytochrome C oxidase subunit IV family protein	NA	NA	NA	NA	NA
WP_016211297.1|37635_38472_+	protoheme IX farnesyltransferase	NA	NA	NA	NA	NA
WP_081007064.1|38468_38744_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_054300271.1|38783_39758_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_155047005.1|39956_40806_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300271.1|40865_41840_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016211791.1|41912_42176_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211793.1|42201_43629_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_016211790.1|43625_44321_-	TVP38/TMEM64 family protein	NA	NA	NA	NA	NA
WP_054300144.1|45625_45991_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155047004.1|46005_46512_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_081007065.1|46724_47564_+	proline iminopeptidase-family hydrolase	NA	NA	NA	NA	NA
WP_016212335.1|47580_47919_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155049176.1|48100_48247_-	phosphatase	NA	NA	NA	NA	NA
WP_054300271.1|49013_49988_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_032126148.1|50591_50774_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212051.1|51315_52089_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_032126637.1|53696_53990_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	8.3e-06
WP_081006999.1|54766_55138_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	52.2	3.4e-20
>prophage 2
NZ_CP012413	Piscirickettsia salmonis strain PM15972A1 chromosome, complete genome	3062470	73728	154515	3062470	tRNA,transposase	Staphylococcus_phage(28.57%)	79	NA	NA
WP_016211227.1|73728_75807_-|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_016211231.1|75806_76757_-|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_016211232.1|77624_78023_+	DUF3135 domain-containing protein	NA	NA	NA	NA	NA
WP_129556608.1|78249_78960_-	VUT family protein	NA	NA	NA	NA	NA
WP_032126349.1|79242_79737_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126698.1|80012_80321_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211866.1|80770_81073_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126699.1|81724_82261_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_036776841.1|82345_82885_-	peroxiredoxin	NA	NA	NA	NA	NA
WP_054300148.1|83324_84386_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212371.1|84363_84996_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212372.1|85111_85333_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047003.1|85518_86405_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300151.1|87893_88226_-	DMT family transporter	NA	NA	NA	NA	NA
WP_075273401.1|88263_88716_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155046757.1|88860_89016_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300152.1|89072_89438_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_172673404.1|89464_90001_-	DMT family transporter	NA	NA	NA	NA	NA
WP_054300153.1|89981_90218_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|90261_91236_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016209719.1|91367_91655_+	trp operon repressor	NA	NA	NA	NA	NA
WP_016209713.1|91698_93168_+	anthranilate synthase component I family protein	NA	NA	NA	NA	NA
WP_016209697.1|93164_93743_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	45.0	2.8e-45
WP_016209717.1|93744_94743_+	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	32.7	5.2e-39
WP_016209710.1|94746_95523_+	indole-3-glycerol-phosphate synthase	NA	NA	NA	NA	NA
WP_016209711.1|95544_96216_+	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_016209702.1|96199_97399_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_016209700.1|97400_98159_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_016209706.1|98162_99161_+	3-deoxy-7-phosphoheptulonate synthase	NA	NA	NA	NA	NA
WP_051307314.1|99288_100404_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_075274705.1|100421_102020_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209712.1|102104_103985_-	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
WP_016209709.1|104104_104446_-	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_016209714.1|104594_104876_+	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_016209723.1|104903_106409_+	YifB family Mg chelatase-like AAA ATPase	NA	NA	NA	NA	NA
WP_016209727.1|106410_109518_-	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_032126705.1|109537_110695_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_016209715.1|111480_111837_+	TrbC/VIRB2 family protein	NA	NA	NA	NA	NA
WP_017377396.1|111837_112092_+	VirB3 family type IV secretion system protein	NA	NA	NA	NA	NA
WP_016209720.1|112108_114598_+	cagE, TrbE, VirB, component of type IV transporter system family protein	NA	NA	NA	NA	NA
WP_129556606.1|114594_115278_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209722.1|115277_116321_+	TrbG/VirB9 family P-type conjugative transfer protein	NA	NA	NA	NA	NA
WP_016209703.1|116320_117550_+	conjugal transfer protein TrbI	NA	NA	NA	NA	NA
WP_016209707.1|117551_117875_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209698.1|117871_119071_+	type IV secretion system protein	NA	NA	NA	NA	NA
WP_032126703.1|119057_119573_+	S26 family signal peptidase	NA	NA	NA	NA	NA
WP_051307313.1|119569_120517_+	P-type conjugative transfer ATPase TrbB	NA	NA	NA	NA	NA
WP_036776867.1|120636_122034_+|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	34.4	1.8e-77
WP_155047002.1|122404_123010_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300209.1|123024_123390_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|123672_124248_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|124193_124559_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300157.1|125391_126672_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081007000.1|126895_127984_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126362.1|128047_128413_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300159.1|128469_128751_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_051307322.1|128754_128934_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212386.1|129124_129430_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300160.1|129494_132887_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556603.1|133070_135086_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_016211610.1|135206_137537_-	penicillin-binding protein 1A	NA	NA	NA	NA	NA
WP_032126362.1|137801_138167_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|138112_138688_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_129556669.1|139617_140013_+	PilN domain-containing protein	NA	NA	NA	NA	NA
WP_016212222.1|140009_140483_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211207.1|140620_140764_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556668.1|141030_142269_+	type IV pilus secretin PilQ	NA	G4WZN6	Enterobacteria_phage	24.1	6.0e-13
WP_032126430.1|142516_143041_+	shikimate kinase AroK	NA	NA	NA	NA	NA
WP_016211203.1|143149_144148_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_016211205.1|144234_145131_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_036778698.1|145272_146490_+	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_016211206.1|146951_148268_+	MFS transporter	NA	NA	NA	NA	NA
WP_016211201.1|148382_148691_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300161.1|148771_149833_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300162.1|149880_150963_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_129556602.1|151837_152047_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047000.1|152251_152398_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300164.1|152445_153465_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300271.1|153540_154515_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
>prophage 3
NZ_CP012413	Piscirickettsia salmonis strain PM15972A1 chromosome, complete genome	3062470	336106	350743	3062470	tRNA,transposase	Staphylococcus_phage(100.0%)	13	NA	NA
WP_054300181.1|336106_336388_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_051307322.1|336391_336571_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300148.1|336597_337659_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046997.1|338233_340756_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046996.1|341690_344204_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212310.1|345234_345690_+	DUF21 domain-containing protein	NA	NA	NA	NA	NA
WP_052104637.1|345719_346256_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_016212085.1|346311_346785_+|tRNA	tRNA (uridine(34)/cytosine(34)/5- carboxymethylaminomethyluridine(34)-2'-O)- methyltransferase TrmL	tRNA	NA	NA	NA	NA
WP_032126534.1|346826_347342_-	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_016212084.1|347341_348358_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_054300271.1|348639_349614_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_081007003.1|349986_350448_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_059372279.1|350407_350743_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP012413	Piscirickettsia salmonis strain PM15972A1 chromosome, complete genome	3062470	353920	390249	3062470	tRNA,protease,transposase	Erwinia_phage(20.0%)	37	NA	NA
WP_016210572.1|353920_355678_+|tRNA	arginine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_032126278.1|355799_356783_+	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_032126275.1|356863_357415_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_032126276.1|357425_358793_+|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A173GFL6	Erwinia_phage	30.1	9.5e-44
WP_032126279.1|358943_359183_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210582.1|359241_359985_+	bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE	NA	NA	NA	NA	NA
WP_016210581.1|359984_360629_+	SCP2 sterol-binding domain-containing protein	NA	NA	NA	NA	NA
WP_036777781.1|360625_362290_+	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	E5ERK4	Ostreococcus_lucimarinus_virus	28.5	5.4e-33
WP_016210576.1|362317_362653_+	histidine triad nucleotide-binding protein	NA	NA	NA	NA	NA
WP_036777784.1|362783_364382_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	64.3	1.5e-08
WP_016210577.1|364447_364738_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007004.1|364752_365208_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_081007005.1|365167_365503_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556663.1|365844_366210_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210376.1|366272_368753_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	44.3	4.1e-194
WP_016210384.1|368836_369316_+	LPS-assembly family protein	NA	NA	NA	NA	NA
WP_129556597.1|369312_370329_+	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_032126282.1|370325_370982_+	nicotinate (nicotinamide) nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_016210374.1|370994_371330_+	ribosome silencing factor	NA	NA	NA	NA	NA
WP_016210381.1|371366_371837_+	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_036777788.1|371879_373715_+	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_016210377.1|373711_374848_+	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_054300183.1|374869_375931_+	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_016210373.1|376009_376525_+	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_016210380.1|376565_377843_+	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	39.0	2.8e-66
WP_036779767.1|377857_378709_+	D-amino acid aminotransferase	NA	NA	NA	NA	NA
WP_032126283.1|378737_379385_+	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
WP_016210379.1|379381_380341_+	lipoyl synthase	NA	NA	NA	NA	NA
WP_032126284.1|380432_381143_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212036.1|381587_382436_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212038.1|382487_383399_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_129556595.1|385481_385898_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172673406.1|386042_386612_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300185.1|386756_387119_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300186.1|387362_388082_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016212415.1|388350_389097_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|389187_390249_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP012413	Piscirickettsia salmonis strain PM15972A1 chromosome, complete genome	3062470	420315	472525	3062470	tRNA,transposase	Staphylococcus_phage(22.22%)	52	NA	NA
WP_016210756.1|420315_423129_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A167RAL2	Powai_lake_megavirus	26.5	1.3e-76
WP_032126291.1|423121_423631_+	lipoprotein signal peptidase	NA	NA	NA	NA	NA
WP_016210766.1|423634_424078_+	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_075273424.1|424166_424790_-	inositol polyphosphate kinase family protein	NA	NA	NA	NA	NA
WP_075273426.1|424804_425380_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|425325_425691_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211782.1|425752_425935_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126294.1|426534_427812_-	MFS transporter	NA	NA	NA	NA	NA
WP_016211783.1|428092_428458_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211784.1|428449_429172_-	aquaporin family protein	NA	M1HH19	Acanthocystis_turfacea_Chlorella_virus	35.8	1.6e-26
WP_054300148.1|429725_430787_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300188.1|431032_432592_+	methyl-accepting chemotaxis protein	NA	A0A1B0V854	Salmonella_phage	50.4	9.9e-37
WP_016210175.1|432905_433235_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210177.1|433620_433986_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126297.1|434110_434971_+	DUF692 domain-containing protein	NA	NA	NA	NA	NA
WP_016210164.1|434957_435737_+	putative DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_162034448.1|435812_436421_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556592.1|436656_437187_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210179.1|437477_437981_+	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_016210161.1|438181_438436_+	DUF2282 domain-containing protein	NA	NA	NA	NA	NA
WP_016210178.1|438937_439405_+	DoxX family protein	NA	NA	NA	NA	NA
WP_016210163.1|439494_440025_-	transcriptional repressor	NA	NA	NA	NA	NA
WP_016210172.1|440024_440549_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	59.6	6.9e-51
WP_036776947.1|440711_441827_-	DSD1 family PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_016210174.1|442063_443224_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	58.5	8.2e-121
WP_016210183.1|443674_445678_+	transketolase	NA	NA	NA	NA	NA
WP_016210176.1|445746_446754_+	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_016210181.1|446827_448012_+	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_032126295.1|448021_449476_+	pyruvate kinase	NA	NA	NA	NA	NA
WP_016210162.1|449506_450544_+	fructose-bisphosphate aldolase class II	NA	NA	NA	NA	NA
WP_155046995.1|451228_452115_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300190.1|452241_453204_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300191.1|453698_454655_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300192.1|454699_454921_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126299.1|454943_455165_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|455415_456390_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016211964.1|456448_456769_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211965.1|456881_457532_-	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_016211963.1|457633_458293_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212030.1|459366_459612_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212033.1|459703_460366_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_016212032.1|460489_461617_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052104666.1|462204_462663_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300193.1|462827_463034_+	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_032126304.1|464079_464424_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210983.1|464661_466845_+	protein kinase family protein	NA	A0A1S5XZ05	Kurlavirus	34.9	1.1e-06
WP_016210981.1|466860_467499_-	ribonuclease T	NA	NA	NA	NA	NA
WP_016210987.1|467528_468728_-	Bcr/CflA family efflux MFS transporter	NA	NA	NA	NA	NA
WP_098082804.1|468965_470063_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	43.1	1.1e-05
WP_036778253.1|470175_471714_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.5	3.5e-87
WP_059372279.1|471774_472110_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007004.1|472069_472525_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_CP012413	Piscirickettsia salmonis strain PM15972A1 chromosome, complete genome	3062470	475737	523290	3062470	protease,transposase,integrase	Escherichia_phage(47.06%)	53	500616:500675	513351:513610
WP_054300148.1|475737_476799_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_172673407.1|476776_477493_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210813.1|477552_477981_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210814.1|478330_478528_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210817.1|478770_479403_-	riboflavin synthase	NA	A0A1V0SE20	Indivirus	32.8	1.1e-13
WP_016210815.1|479823_480774_-	alpha-L-glutamate ligase-like protein	NA	NA	NA	NA	NA
WP_054300195.1|480770_482303_-	inactive transglutaminase family protein	NA	NA	NA	NA	NA
WP_017377821.1|482299_482830_-|protease	ATP-dependent zinc protease	protease	NA	NA	NA	NA
WP_054300196.1|483164_483803_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210811.1|484217_484922_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210818.1|485213_485438_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210820.1|485941_486883_-	DMT family transporter	NA	NA	NA	NA	NA
WP_054300197.1|487122_488307_+	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	25.2	4.9e-20
WP_016210937.1|488398_488680_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_032126309.1|488765_489443_-	TIGR00153 family protein	NA	NA	NA	NA	NA
WP_032126310.1|489489_490749_-	inorganic phosphate transporter	NA	E5ESL8	Bathycoccus_sp._RCC1105_virus	34.7	5.9e-24
WP_016210941.1|490946_491996_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_016210931.1|492074_492881_+	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_016210936.1|492902_493697_+	thymidylate synthase	NA	A0A2R4A1R4	Microbacterium_phage	69.0	5.3e-103
WP_016210944.1|493798_494818_+	S-methyl-5-thioribose-1-phosphate isomerase	NA	NA	NA	NA	NA
WP_036778484.1|494864_495476_+	methylthioribulose 1-phosphate dehydratase	NA	NA	NA	NA	NA
WP_016210943.1|495479_496166_+	acireductone synthase	NA	NA	NA	NA	NA
WP_016210935.1|496162_496705_+	acireductone dioxygenase	NA	NA	NA	NA	NA
WP_017375910.1|497091_497820_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_054300198.1|497970_498300_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126737.1|498711_499440_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_016212022.1|499669_499888_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036780881.1|499887_500487_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_016212024.1|500483_500732_+	hypothetical protein	NA	NA	NA	NA	NA
500616:500675	attL	CGTAAGCGTCGCTACCTCGGTAGGTATTTTGCACATCCAATGATGCAAAATCGCCGAGCA	NA	NA	NA	NA
WP_155046993.1|500876_501239_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	37.6	1.3e-13
WP_054300200.1|501231_501810_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	51.5	3.9e-47
WP_054300201.1|502111_502840_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	9.6e-43
WP_016212023.1|503235_504228_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	33.7	1.1e-17
WP_075273432.1|504224_504959_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	5.7e-43
WP_054300202.1|505269_505998_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_051307368.1|506704_507985_+	AAA family ATPase	NA	Q7Y3Y6	Yersinia_phage	33.5	7.3e-38
WP_016211918.1|507984_508953_+	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_016211646.1|509324_509564_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211642.1|509556_509910_+	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_016211643.1|510219_510813_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_054300203.1|510817_511276_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|511758_512334_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|512279_512645_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046992.1|512605_513145_+	queuosine precursor transporter	NA	A0A2H4J2N7	uncultured_Caudovirales_phage	30.5	8.7e-09
WP_054300206.1|513611_513848_-	hypothetical protein	NA	NA	NA	NA	NA
513351:513610	attR	TGCTCGGCGATTTTGCATCATTGGATGTGCAAAATACCTACCGAGGTAGCGACGCTTACGTTTTTAAGATTGCCTTTGATGGGTATTTTTGGAAAGTTATGATAGCTATAATAATATCATTTCCAATGTGGTATATGATAAAATGGCTAAAGAGATCTGAGAAAGTCGATGTTTATGATTACAATACAAACTATAATCCTTTTTCTATTAGAACAATGAAGACAAGTTGATTTGGTAGTTTGTCTTTTAAAAAGAATATG	NA	NA	NA	NA
WP_054300202.1|514133_514862_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_016211235.1|515356_515794_-	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_129556626.1|516223_517612_+	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_016211238.1|518054_519548_+	amino acid permease	NA	NA	NA	NA	NA
WP_129556456.1|519749_520499_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211242.1|520542_521511_-	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_016211244.1|521464_522160_-	ATP-binding cassette domain-containing protein	NA	W5SAS9	Pithovirus	27.4	2.7e-10
WP_054300202.1|522561_523290_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
>prophage 7
NZ_CP012413	Piscirickettsia salmonis strain PM15972A1 chromosome, complete genome	3062470	527786	570228	3062470	tRNA,transposase	Synechococcus_phage(50.0%)	47	NA	NA
WP_075273438.1|527786_528362_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|528307_528673_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016212580.1|528760_529111_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|529846_530908_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016210908.1|532119_532935_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126716.1|533025_534009_+	transaldolase	NA	V5UTB0	Synechococcus_phage	32.9	2.2e-13
WP_016210913.1|534179_534701_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	43.8	1.8e-27
WP_016210914.1|534734_534986_+	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	58.8	1.8e-20
WP_016210909.1|534991_536269_-	na+ dependent nucleoside transporter family protein	NA	NA	NA	NA	NA
WP_051307343.1|536961_537489_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210906.1|537608_539921_-	RNA-binding transcriptional accessory protein	NA	NA	NA	NA	NA
WP_032126715.1|540049_540865_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_016210915.1|541062_541527_+	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_054300173.1|541656_542718_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211491.1|542978_543275_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211493.1|543557_545021_+	4-hydroxy-3-polyprenylbenzoate decarboxylase	NA	NA	NA	NA	NA
WP_016211489.1|545023_546076_+	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	M4QRZ2	Synechococcus_phage	41.1	5.3e-10
WP_036779281.1|546065_546521_+	arginine repressor	NA	NA	NA	NA	NA
WP_155046991.1|546545_546869_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126199.1|547216_547528_-	DOPA 4,5-dioxygenase	NA	NA	NA	NA	NA
WP_054300208.1|547657_548449_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300148.1|548426_549488_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036779278.1|549607_550561_-	DMT family transporter	NA	NA	NA	NA	NA
WP_016212075.1|550674_550872_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052047032.1|551084_551318_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_142396463.1|551428_551545_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212074.1|551631_551853_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_054300209.1|551879_552245_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046696.1|552301_552466_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007009.1|552455_552626_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300210.1|552582_552771_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046713.1|552908_553073_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126195.1|553367_554804_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_016210532.1|554845_556297_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_016210537.1|556408_556696_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_016210526.1|556885_557929_+	rod shape-determining protein	NA	NA	NA	NA	NA
WP_016210536.1|557944_558844_+	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_016210528.1|558840_559359_+	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_054300211.1|559428_560046_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_036776217.1|560055_561543_+	ribonuclease G	NA	NA	NA	NA	NA
WP_054300212.1|561552_565233_+	DUF3971 domain-containing protein	NA	NA	NA	NA	NA
WP_016210535.1|565306_566119_+	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_016210530.1|566115_566796_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_081007010.1|567636_568257_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556461.1|568306_568597_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300215.1|569400_569895_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007066.1|569889_570228_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 8
NZ_CP012413	Piscirickettsia salmonis strain PM15972A1 chromosome, complete genome	3062470	591698	694137	3062470	tRNA,protease,transposase,plate	Prochlorococcus_phage(16.67%)	107	NA	NA
WP_032126189.1|591698_593006_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_016209510.1|593098_593536_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_016209501.1|593797_595309_+	DUF2169 domain-containing protein	NA	NA	NA	NA	NA
WP_036778935.1|595314_596541_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_016209528.1|596534_597563_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_016209514.1|597540_598233_+	DUF3540 domain-containing protein	NA	NA	NA	NA	NA
WP_016209516.1|598237_599707_+	type VI secretion system domain-containing protein	NA	NA	NA	NA	NA
WP_036778941.1|599699_600188_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_051307310.1|600193_601666_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_032126187.1|601665_602064_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_016209524.1|602060_603749_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_016209506.1|603730_604687_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_016209515.1|604729_605245_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209526.1|605349_606282_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	25.8	1.2e-21
WP_016209534.1|606501_606888_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164997271.1|606904_607552_-	2-polyprenyl-3-methyl-6-methoxy-1,4-benzoquinone monooxygenase	NA	NA	NA	NA	NA
WP_016209504.1|607729_608569_+	carbon-nitrogen hydrolase family protein	NA	M1I6H3	Paramecium_bursaria_Chlorella_virus	28.8	2.0e-15
WP_016209502.1|608644_609247_+	signal peptidase I	NA	NA	NA	NA	NA
WP_016209512.1|609247_610102_-	RNase adapter RapZ	NA	NA	NA	NA	NA
WP_016209537.1|610458_610770_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_016209519.1|610794_612186_-	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_016209538.1|612341_613073_-	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.7	1.3e-20
WP_054300558.1|613069_613597_-	lipopolysaccharide transport periplasmic protein LptA	NA	NA	NA	NA	NA
WP_016209499.1|613628_614186_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_016209498.1|614191_615172_-	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	30.4	6.0e-32
WP_016209539.1|615311_616112_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.7	7.6e-25
WP_036780687.1|616115_616883_+	lipid asymmetry maintenance ABC transporter permease subunit MlaE	NA	NA	NA	NA	NA
WP_016209535.1|616879_617344_+	outer membrane lipid asymmetry maintenance protein MlaD	NA	NA	NA	NA	NA
WP_016209507.1|617366_618020_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_016209517.1|618023_618371_+	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_016209505.1|618404_618656_+	BolA/IbaG family iron-sulfur metabolism protein	NA	NA	NA	NA	NA
WP_016209518.1|618731_620000_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_016209527.1|620002_620761_+	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_016209508.1|620822_621713_+	OmpA family protein	NA	NA	NA	NA	NA
WP_016209511.1|621763_622447_+	uracil-DNA glycosylase	NA	A0A0R5YU95	Harp_seal_herpesvirus	49.5	2.3e-46
WP_075273445.1|622532_622790_-	DUF4286 family protein	NA	NA	NA	NA	NA
WP_054300217.1|623062_625216_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210408.1|625207_626080_-	DNA replication terminus site-binding family protein	NA	NA	NA	NA	NA
WP_016210409.1|626247_628077_+	class I poly(R)-hydroxyalkanoic acid synthase	NA	NA	NA	NA	NA
WP_016210411.1|628239_628881_-	BON domain-containing protein	NA	NA	NA	NA	NA
WP_075273448.1|629122_629653_+	DUF177 domain-containing protein	NA	NA	NA	NA	NA
WP_016210404.1|629670_629844_+	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_016210402.1|629902_630952_+	phosphate acyltransferase PlsX	NA	NA	NA	NA	NA
WP_016210405.1|630958_631909_+	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_016210406.1|631962_632907_+	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_016210415.1|632934_633672_+	3-oxoacyl-ACP reductase FabG	NA	NA	NA	NA	NA
WP_016210413.1|633760_634003_+	acyl carrier protein	NA	A0A1P8VVJ5	Erythrobacter_phage	39.7	2.0e-05
WP_016210403.1|634077_635301_+	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_016210400.1|635332_636181_+	aminodeoxychorismate lyase	NA	NA	NA	NA	NA
WP_016210401.1|636177_637230_+	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
WP_032126181.1|637350_637971_+	dTMP kinase	NA	A0A1L2BX49	Bacteriophage	44.2	4.2e-39
WP_054300218.1|637986_639018_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|639061_640036_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_081007004.1|640189_640645_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_059372279.1|640604_640940_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126790.1|641735_642641_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_054300173.1|642687_643749_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212599.1|643798_644008_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212369.1|645242_645689_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|645692_646268_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|646213_646579_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032126651.1|646699_646885_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209899.1|646988_648023_-	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	34.2	1.3e-32
WP_016209908.1|648019_648730_-	winged helix-turn-helix domain-containing protein	NA	W8CYM9	Bacillus_phage	34.8	2.2e-31
WP_016209923.1|649204_649723_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209901.1|649840_650173_-	GIY-YIG nuclease family protein	NA	D7F5V9	Apocheima_cinerarium_nucleopolyhedrovirus	34.2	8.0e-05
WP_054300220.1|650202_653157_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_054300221.1|653202_653700_-|protease	protease inhibitor I42 family protein	protease	NA	NA	NA	NA
WP_155049110.1|653759_654182_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209915.1|654267_655128_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_032126652.1|655210_655777_+	chorismate lyase	NA	NA	NA	NA	NA
WP_164997272.1|655800_656664_+	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_054300222.1|656705_659612_+	bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase	NA	NA	NA	NA	NA
WP_016209904.1|659672_659870_+	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_016209903.1|659876_660887_+	lipopolysaccharide heptosyltransferase II	NA	NA	NA	NA	NA
WP_016209910.1|660883_661942_+	lipopolysaccharide heptosyltransferase I	NA	NA	NA	NA	NA
WP_032126655.1|661935_662736_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_016209913.1|662738_663557_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_016209907.1|663568_664516_+	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	37.9	1.6e-37
WP_032126654.1|664523_665825_+	lipid IV(A) 3-deoxy-D-manno-octulosonic acid transferase	NA	NA	NA	NA	NA
WP_016209919.1|666003_667107_+	glycine cleavage system aminomethyltransferase GcvT	NA	NA	NA	NA	NA
WP_016209906.1|667103_667496_+	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_016209924.1|667507_668884_+	aminomethyl-transferring glycine dehydrogenase subunit GcvPA	NA	E3SN07	Prochlorococcus_phage	34.6	4.2e-47
WP_016209900.1|668877_670347_+	aminomethyl-transferring glycine dehydrogenase subunit GcvPB	NA	M4QFZ1	Prochlorococcus_phage	41.9	2.7e-84
WP_054300223.1|670538_671510_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	32.9	1.3e-34
WP_129556478.1|671746_672633_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_162034437.1|674140_674494_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_155046954.1|674666_674840_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126800.1|675066_675801_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300148.1|675925_676987_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_122940948.1|677309_678014_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_016210599.1|678107_678821_-	5'-methylthioadenosine/adenosylhomocysteine nucleosidase	NA	NA	NA	NA	NA
WP_016210601.1|678903_679995_-	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_054300226.1|680066_680648_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_016210606.1|680653_681280_-	50S ribosomal protein L25/general stress protein Ctc	NA	NA	NA	NA	NA
WP_168183191.1|681376_682324_-	ribose-phosphate pyrophosphokinase	NA	A0A1V0SHF7	Hokovirus	34.7	5.8e-40
WP_016210600.1|682671_683334_-	outer membrane lipoprotein LolB	NA	NA	NA	NA	NA
WP_016210598.1|683484_684144_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210607.1|684312_685572_+|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_016210611.1|685568_686654_+	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.2	4.3e-07
WP_016210605.1|686646_687528_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_016210612.1|687516_688767_-	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_155046988.1|690052_690421_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046990.1|690436_691114_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300228.1|691091_692345_-	LbtU family siderophore porin	NA	NA	NA	NA	NA
WP_032126362.1|693250_693616_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|693561_694137_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 9
NZ_CP012413	Piscirickettsia salmonis strain PM15972A1 chromosome, complete genome	3062470	729507	774962	3062470	tRNA,transposase	Staphylococcus_phage(42.86%)	34	NA	NA
WP_054300232.1|729507_730959_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_016209368.1|730994_732524_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	42.2	1.6e-84
WP_054300233.1|733099_734743_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300234.1|735284_736226_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209384.1|736576_737392_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209395.1|737683_740374_+	DUF4135 domain-containing protein	NA	NA	NA	NA	NA
WP_172673408.1|740718_741843_+	MFS transporter	NA	NA	NA	NA	NA
WP_016209362.1|742010_743717_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209398.1|744315_745542_+	MFS transporter	NA	NA	NA	NA	NA
WP_054300276.1|746124_747099_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	4.0e-28
WP_075273456.1|747221_747521_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007004.1|747480_747936_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_054300559.1|748816_749365_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|750080_750446_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|750391_750967_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300237.1|750993_752055_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300238.1|752595_752874_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126399.1|753170_753671_-	superoxide dismutase family protein	NA	NA	NA	NA	NA
WP_016211818.1|753873_755130_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036777316.1|755486_755900_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273460.1|756209_757094_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300240.1|757350_757554_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|757853_758828_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016212172.1|759130_760603_+	tyrosine kinase family protein	NA	NA	NA	NA	NA
WP_054300271.1|760622_761597_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_036793948.1|761828_762023_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210745.1|762188_762809_+	DUF2272 domain-containing protein	NA	NA	NA	NA	NA
WP_054300241.1|763127_765104_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210739.1|765259_766717_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	42.6	7.2e-98
WP_016210743.1|766785_768366_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	27.3	8.8e-17
WP_054300242.1|768406_768943_+|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
WP_016210746.1|768988_772885_+	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	54.4	4.4e-118
WP_016210741.1|772891_773215_-	late competence development ComFB family protein	NA	NA	NA	NA	NA
WP_054300173.1|773900_774962_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 10
NZ_CP012413	Piscirickettsia salmonis strain PM15972A1 chromosome, complete genome	3062470	791643	840511	3062470	protease,transposase	unidentified_phage(15.38%)	40	NA	NA
WP_054300245.1|791643_792519_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016211687.1|792774_793419_+	UvrY/SirA/GacA family response regulator transcription factor	NA	NA	NA	NA	NA
WP_016211685.1|793449_795255_+	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_016211684.1|795278_795854_+	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_054300246.1|796398_797472_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273474.1|797706_798681_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.9	4.0e-28
WP_155046989.1|798913_799978_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300248.1|800070_801045_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	32.2	3.1e-28
WP_155046989.1|801277_802342_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300249.1|802832_803198_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556449.1|803212_803719_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300250.1|803708_804368_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.0	1.3e-09
WP_016209640.1|804786_805806_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209649.1|806264_807230_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	39.8	7.9e-45
WP_016209646.1|807274_807850_-	VOC family protein	NA	NA	NA	NA	NA
WP_016209651.1|807880_809155_-	MFS transporter	NA	NA	NA	NA	NA
WP_032126159.1|809800_810514_+	class II aldolase/adducin family protein	NA	NA	NA	NA	NA
WP_016209641.1|810593_811331_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_016209658.1|811451_812807_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_075273478.1|812983_813655_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_032126160.1|813770_814649_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	39.7	1.5e-34
WP_016209645.1|815249_816554_+	trigger factor	NA	NA	NA	NA	NA
WP_016209647.1|816666_817272_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	59.8	8.4e-61
WP_016209663.1|817353_818655_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	57.3	1.5e-134
WP_032126161.1|818722_821155_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.7	9.5e-220
WP_016209655.1|821258_821531_+	HU family DNA-binding protein	NA	A4JWM7	Burkholderia_virus	62.9	2.0e-22
WP_075273480.1|821613_823512_+	SurA N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_016209643.1|823543_824428_+	lipid A biosynthesis acyltransferase	NA	A0A1W6JP29	Morganella_phage	35.3	2.4e-40
WP_016209657.1|824436_824832_-	CrcB family protein	NA	NA	NA	NA	NA
WP_016209662.1|825259_827407_+	EAL domain-containing protein	NA	G3MA91	Bacillus_virus	36.7	1.8e-25
WP_016209652.1|827378_828728_-	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_016209642.1|828724_830845_-	ATP-binding cassette domain-containing protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	28.1	2.0e-16
WP_016209656.1|830841_832545_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	24.8	2.8e-21
WP_016209654.1|832663_833806_-	galactokinase	NA	NA	NA	NA	NA
WP_016209659.1|833870_834899_-	UDP-glucose--hexose-1-phosphate uridylyltransferase	NA	NA	NA	NA	NA
WP_054300251.1|835025_836540_+	D-alanyl-D-alanine carboxypeptidase	NA	NA	NA	NA	NA
WP_059372266.1|836629_837115_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046988.1|837447_837816_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046987.1|837831_838515_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126790.1|839605_840511_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 11
NZ_CP012413	Piscirickettsia salmonis strain PM15972A1 chromosome, complete genome	3062470	853501	895968	3062470	transposase,integrase	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage(16.67%)	47	853197:853212	870428:870443
853197:853212	attL	TTTCCCATAATAATCT	NA	NA	NA	NA
WP_032126152.1|853501_854092_-|integrase	site-specific integrase	integrase	A0A1B0V4T7	Roseobacter_phage	32.7	1.1e-15
WP_016212424.1|854294_854573_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036781387.1|854565_854838_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300162.1|854930_856013_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_036780532.1|856115_857156_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_081007067.1|857667_863142_-	DUF4011 domain-containing protein	NA	NA	NA	NA	NA
WP_016212302.1|863362_863662_-	HU family DNA-binding protein	NA	A0A0H3UZA0	Geobacillus_virus	44.4	3.9e-11
WP_155046986.1|863846_864732_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300237.1|864921_865983_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036781361.1|866002_866392_+	HU family DNA-binding protein	NA	NA	NA	NA	NA
WP_054300162.1|866662_867745_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_016211579.1|867955_868441_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016211583.1|868508_869417_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300257.1|869693_870503_+	DUF4942 domain-containing protein	NA	A0A1J0GUW2	Halomonas_phage	30.6	1.8e-29
870428:870443	attR	AGATTATTATGGGAAA	NA	NA	NA	NA
WP_075273486.1|870479_871454_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.2e-29
WP_016211585.1|871688_872246_+	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_054300258.1|872307_873087_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211584.1|873184_873538_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211586.1|873604_873799_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211578.1|873814_874159_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|874228_874804_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|874749_875115_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273488.1|875199_875835_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052047108.1|875890_876289_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155046984.1|877100_878219_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046716.1|878640_878787_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162034432.1|879057_879231_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210555.1|879484_880039_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210551.1|880475_880658_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556629.1|881180_881927_+	DNA/RNA non-specific endonuclease	NA	A0A2H4N7Z3	Lake_Baikal_phage	33.0	3.6e-29
WP_026063577.1|882153_882447_+	HU family DNA-binding protein	NA	A3E2K9	Sodalis_phage	52.8	4.7e-17
WP_129556482.1|882518_883124_-	NUDIX domain-containing protein	NA	A0A1S6L1P8	Vibrio_phage	30.9	1.2e-17
WP_172673418.1|883272_884253_-	malate dehydrogenase	NA	NA	NA	NA	NA
WP_054300261.1|884346_885789_-	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_016210553.1|885815_886469_-	protein-L-isoaspartate O-methyltransferase	NA	NA	NA	NA	NA
WP_016210552.1|886593_887160_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051307331.1|887514_889293_+	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	30.6	1.5e-33
WP_052104721.1|889364_891071_+	thiol reductant ABC exporter subunit CydC	NA	W8CYL7	Bacillus_phage	26.7	7.3e-25
WP_016210548.1|891062_891317_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|891815_892181_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|892126_892702_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212461.1|892705_893080_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|893455_894430_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_054300263.1|894501_894942_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300264.1|894929_895268_-|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
WP_054300265.1|895412_895673_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059372279.1|895632_895968_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 12
NZ_CP012413	Piscirickettsia salmonis strain PM15972A1 chromosome, complete genome	3062470	916829	982240	3062470	tRNA,transposase	uncultured_Mediterranean_phage(11.11%)	60	NA	NA
WP_054300173.1|916829_917891_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211781.1|918107_919355_+	LbtU family siderophore porin	NA	NA	NA	NA	NA
WP_161625476.1|919727_921014_+	methyltransferase regulatory domain-containing protein	NA	NA	NA	NA	NA
WP_032126557.1|921099_921525_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273492.1|921537_921657_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300268.1|921765_922827_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007012.1|922821_922992_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046696.1|922981_923146_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300209.1|923202_923568_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300269.1|923589_923958_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126559.1|924102_924846_-	queuosine precursor transporter	NA	NA	NA	NA	NA
WP_016210898.1|924869_925220_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210902.1|925308_925563_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016210894.1|926073_926376_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300270.1|926716_927694_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556487.1|927772_929110_-	Do family serine endopeptidase	NA	A0A1B1IRD3	uncultured_Mediterranean_phage	34.8	9.4e-12
WP_016210903.1|929228_929600_-	DUF1043 family protein	NA	NA	NA	NA	NA
WP_016210904.1|929820_930471_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_016210896.1|930513_931596_+	cell division protein ZapE	NA	NA	NA	NA	NA
WP_016210899.1|931649_933533_+	APC family permease	NA	NA	NA	NA	NA
WP_032126790.1|934032_934938_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_033923637.1|935012_937607_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273494.1|938557_939118_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300271.1|939137_940112_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016211036.1|940459_942331_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	30.7	2.7e-33
WP_016211039.1|942422_944168_-	DNA primase	NA	A0A1S5RGL3	Helicobacter_phage	37.1	2.6e-46
WP_016211043.1|944247_944697_-	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	44.2	4.1e-20
WP_016211035.1|944749_944965_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_016211042.1|945211_946228_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	54.2	5.3e-100
WP_016211037.1|946276_946906_-	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_016211040.1|947256_948468_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_032126170.1|948695_948968_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|949131_950193_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_052104774.1|950240_950873_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300272.1|951017_951413_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211450.1|951966_952989_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_016211448.1|953087_954296_-	MFS transporter	NA	NA	NA	NA	NA
WP_016211446.1|954285_956013_-	glycoside hydrolase family 32 protein	NA	NA	NA	NA	NA
WP_036776407.1|956196_957333_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|957581_958643_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126397.1|958991_959582_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210561.1|959696_961031_-	dihydroorotase	NA	NA	NA	NA	NA
WP_016210568.1|961158_961800_-	pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
WP_016210566.1|962105_962528_+	universal stress protein	NA	NA	NA	NA	NA
WP_016210559.1|962884_963847_+	formimidoylglutamase	NA	NA	NA	NA	NA
WP_075273501.1|963843_965061_+	imidazolonepropionase	NA	NA	NA	NA	NA
WP_155046983.1|965149_966850_+	urocanate hydratase	NA	NA	NA	NA	NA
WP_054300273.1|966849_968388_+	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	37.2	5.1e-70
WP_016210562.1|968416_970069_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210558.1|970142_970898_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556478.1|971178_972065_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016211932.1|972475_973765_-	GDA1/CD39 family protein	NA	NA	NA	NA	NA
WP_036777061.1|973960_975148_-	MFS transporter	NA	NA	NA	NA	NA
WP_016211476.1|975465_975675_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211473.1|975658_976258_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211474.1|976332_977682_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	E4ZFI6	Streptococcus_phage	27.6	5.7e-33
WP_032126518.1|977764_979966_+	GTP diphosphokinase	NA	NA	NA	NA	NA
WP_016211478.1|979982_980798_+	nucleoside triphosphate pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_032126519.1|980777_981497_-	TIGR00730 family Rossman fold protein	NA	A0A1D8KUT5	Synechococcus_phage	34.8	1.9e-19
WP_075273327.1|981664_982240_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 13
NZ_CP012413	Piscirickettsia salmonis strain PM15972A1 chromosome, complete genome	3062470	997074	1051220	3062470	tRNA,transposase	Bacillus_phage(20.0%)	56	NA	NA
WP_081007013.1|997074_997374_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155049809.1|997377_998673_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300276.1|998847_999822_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	4.0e-28
WP_016209411.1|1000027_1000822_-	inositol monophosphatase	NA	NA	NA	NA	NA
WP_016209421.1|1000984_1001773_+|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
WP_016209447.1|1001769_1002981_+	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_032126508.1|1002970_1003330_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209444.1|1003424_1003853_+	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	39.4	1.1e-17
WP_129556555.1|1003983_1005114_+	23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN	NA	NA	NA	NA	NA
WP_016209436.1|1005110_1005839_+	type IV pilus biogenesis/stability protein PilW	NA	NA	NA	NA	NA
WP_016209412.1|1005896_1006784_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016209433.1|1006868_1007243_+	rhodanese-like domain protein	NA	NA	NA	NA	NA
WP_016209424.1|1007342_1008620_+|tRNA	histidine--tRNA ligase	tRNA	A0A2I2L577	Orpheovirus	25.1	6.6e-23
WP_016209402.1|1008634_1009363_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_016209446.1|1009376_1010600_+	outer membrane protein assembly factor BamB	NA	NA	NA	NA	NA
WP_016209427.1|1010693_1012097_+	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_016209408.1|1012250_1012421_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209406.1|1012735_1013557_+	ParA family protein	NA	Q8JL10	Natrialba_phage	32.2	5.0e-16
WP_016209405.1|1013553_1014447_+	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_016209443.1|1014492_1015014_+	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_016209413.1|1015088_1015574_+	DUF2802 domain-containing protein	NA	NA	NA	NA	NA
WP_016209416.1|1015862_1016648_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_016209404.1|1016637_1017501_-	chemotaxis protein CheX	NA	NA	NA	NA	NA
WP_016209435.1|1017527_1017899_-	response regulator	NA	W8CYM9	Bacillus_phage	29.4	1.1e-05
WP_016209445.1|1017999_1018956_-	23S rRNA pseudouridine(955/2504/2580) synthase RluC	NA	NA	NA	NA	NA
WP_054300277.1|1019438_1022120_+	Rne/Rng family ribonuclease	NA	NA	NA	NA	NA
WP_016209439.1|1022200_1022827_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_129556553.1|1022990_1024583_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_016209434.1|1024672_1026094_+|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_016209437.1|1026124_1026646_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	34.2	2.0e-10
WP_016209438.1|1026642_1027242_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_016209440.1|1027319_1028330_+	Holliday junction branch migration DNA helicase RuvB	NA	B3GAM6	uncultured_virus	29.9	1.5e-06
WP_016209415.1|1028442_1029147_+	protein TolQ	NA	NA	NA	NA	NA
WP_016209407.1|1029183_1029615_+	protein TolR	NA	NA	NA	NA	NA
WP_016209428.1|1029617_1030712_+	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_016209441.1|1030762_1032115_+	Tol-Pal system beta propeller repeat protein TolB	NA	NA	NA	NA	NA
WP_016209425.1|1032150_1032792_+	OmpA family protein	NA	NA	NA	NA	NA
WP_036776589.1|1032834_1033764_+	tol-pal system protein YbgF	NA	NA	NA	NA	NA
WP_016209451.1|1033766_1034414_+	7-carboxy-7-deazaguanine synthase QueE	NA	J9PV61	Bacillus_phage	37.9	1.2e-36
WP_032126506.1|1034464_1035268_-	PhoH family protein	NA	A0A0E3G5H5	Synechococcus_phage	43.1	8.9e-42
WP_016209417.1|1035449_1035662_+	SlyX family protein	NA	NA	NA	NA	NA
WP_016209423.1|1035665_1035899_-	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_016209422.1|1035960_1037541_-	exodeoxyribonuclease VII large subunit	NA	NA	NA	NA	NA
WP_036776584.1|1037742_1038672_+	ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	31.9	7.0e-14
WP_036776581.1|1038673_1039441_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_032126509.1|1039845_1040562_+	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_016209442.1|1040599_1040962_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209432.1|1041133_1042843_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_054300278.1|1043100_1044432_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300279.1|1044873_1046346_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300152.1|1047061_1047427_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273508.1|1047667_1048534_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075273512.1|1049046_1049391_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036776562.1|1049543_1049735_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007014.1|1049978_1050374_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_105962625.1|1050334_1051220_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 14
NZ_CP012413	Piscirickettsia salmonis strain PM15972A1 chromosome, complete genome	3062470	1054382	1102477	3062470	protease,transposase	Staphylococcus_phage(16.67%)	43	NA	NA
WP_054300271.1|1054382_1055357_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_054300284.1|1055714_1057103_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036780476.1|1057338_1059276_-	CHASE domain-containing protein	NA	NA	NA	NA	NA
WP_016210517.1|1060289_1061009_-	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_032126504.1|1061122_1064662_+	chromosome segregation protein SMC	NA	NA	NA	NA	NA
WP_016210525.1|1064728_1065547_+	ZipA protein	NA	NA	NA	NA	NA
WP_016210518.1|1065533_1067573_+	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	40.8	3.0e-126
WP_016210522.1|1067588_1068641_+|protease	protease SohB	protease	NA	NA	NA	NA
WP_016210524.1|1068651_1069182_+	7-cyano-7-deazaguanine synthase	NA	NA	NA	NA	NA
WP_016210010.1|1070819_1070996_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036780418.1|1071172_1071556_+	Hpt domain-containing protein	NA	NA	NA	NA	NA
WP_075273518.1|1071631_1071925_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210016.1|1072091_1073051_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210020.1|1073781_1073937_+	putative membrane protein	NA	NA	NA	NA	NA
WP_016210025.1|1074201_1075572_+	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_052104723.1|1075564_1076518_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_036779556.1|1076498_1079303_-	response regulator	NA	A0A1V0SGX0	Hokovirus	32.0	3.1e-57
WP_016210027.1|1079382_1079979_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210008.1|1080368_1081124_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_016210004.1|1081323_1081965_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210021.1|1082225_1083551_+	acetyl-CoA C-acetyltransferase	NA	NA	NA	NA	NA
WP_016210023.1|1083547_1085605_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_016210007.1|1085582_1086155_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_032126616.1|1086210_1086570_+	DUF1820 family protein	NA	NA	NA	NA	NA
WP_016210019.1|1086634_1087669_+	beta-N-acetylhexosaminidase	NA	NA	NA	NA	NA
WP_122941592.1|1087926_1088778_+	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_017377777.1|1088872_1089850_-	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_016210013.1|1090012_1091680_+	long-chain-fatty-acid--CoA ligase	NA	A0A1V0SBX8	Catovirus	25.1	6.2e-21
WP_172673411.1|1092129_1092648_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075273327.1|1092666_1093242_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1093187_1093553_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300287.1|1093574_1093904_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300288.1|1094312_1095002_+	hypothetical protein	NA	A0A0N7AE80	Bacillus_phage	28.2	3.2e-08
WP_129556499.1|1095010_1096164_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	1.5e-58
WP_054300291.1|1096656_1097031_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_098082828.1|1097293_1097551_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036779544.1|1097550_1098558_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_054300292.1|1098812_1099814_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007069.1|1100269_1100422_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007016.1|1100394_1100568_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046696.1|1100557_1100722_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300293.1|1100778_1101144_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300294.1|1101415_1102477_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 15
NZ_CP012413	Piscirickettsia salmonis strain PM15972A1 chromosome, complete genome	3062470	1146988	1165770	3062470	transposase	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage(50.0%)	17	NA	NA
WP_054300162.1|1146988_1148071_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_054300297.1|1148133_1149201_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212246.1|1150136_1150793_+	AT hook motif family protein	NA	NA	NA	NA	NA
WP_054300162.1|1150896_1151979_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_054300271.1|1152318_1153293_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016212247.1|1153920_1154676_-	ZIP family metal transporter	NA	NA	NA	NA	NA
WP_036779544.1|1155042_1156050_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_098082828.1|1156049_1156307_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300271.1|1156671_1157646_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_075273524.1|1157686_1158652_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212058.1|1158807_1160358_+	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_054300299.1|1162559_1163642_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046981.1|1163731_1163908_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046980.1|1163897_1164197_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046696.1|1164186_1164351_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300189.1|1164407_1164773_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032126540.1|1164906_1165770_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 16
NZ_CP012413	Piscirickettsia salmonis strain PM15972A1 chromosome, complete genome	3062470	1210174	1253947	3062470	transposase	Escherichia_phage(33.33%)	42	NA	NA
WP_033923708.1|1210174_1211050_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016211947.1|1211164_1212310_-	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
WP_016211943.1|1212302_1212656_-	ArsC family reductase	NA	NA	NA	NA	NA
WP_016211946.1|1212916_1213672_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212551.1|1215027_1215522_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556643.1|1215979_1217344_-	histidine kinase	NA	NA	NA	NA	NA
WP_016211983.1|1217439_1218099_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_054300306.1|1218346_1218571_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300307.1|1218673_1219402_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	1.9e-43
WP_054300308.1|1219431_1219662_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300309.1|1219956_1221516_-	APC family permease	NA	NA	NA	NA	NA
WP_016211215.1|1221876_1223847_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	37.2	1.5e-77
WP_016211211.1|1224038_1225118_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_052104715.1|1225166_1225373_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_016211210.1|1225379_1226861_+	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_054300310.1|1226963_1227488_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300311.1|1228492_1228969_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211942.1|1229289_1230549_+	DUF4804 domain-containing protein	NA	NA	NA	NA	NA
WP_016211940.1|1230669_1231002_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556538.1|1231115_1232090_-	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_016211341.1|1232234_1232405_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300312.1|1232603_1233626_+	YHYH protein	NA	NA	NA	NA	NA
WP_054300313.1|1233633_1235316_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.7	1.6e-32
WP_016211344.1|1235476_1236295_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_016211347.1|1236508_1237492_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	38.7	2.1e-53
WP_016211340.1|1237484_1237706_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211346.1|1237733_1238375_+	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	28.8	7.4e-07
WP_033923708.1|1238906_1239782_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_172673412.1|1240117_1240258_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105962625.1|1242244_1243130_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_081007020.1|1243134_1243422_-|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_036774554.1|1243474_1243753_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126998.1|1243851_1244199_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_032126997.1|1244520_1244760_+	membrane protein insertion efficiency factor YidD	NA	NA	NA	NA	NA
WP_075273532.1|1244977_1245565_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_054300314.1|1245525_1245861_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211315.1|1246048_1246693_-	porin family protein	NA	NA	NA	NA	NA
WP_016211316.1|1247027_1247678_-	porin family protein	NA	NA	NA	NA	NA
WP_016211319.1|1248210_1249263_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_032126786.1|1249280_1252361_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_081007021.1|1252659_1253226_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300202.1|1253218_1253947_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
>prophage 17
NZ_CP012413	Piscirickettsia salmonis strain PM15972A1 chromosome, complete genome	3062470	1257875	1323601	3062470	tRNA,transposase,plate	Bacillus_thuringiensis_phage(33.33%)	55	NA	NA
WP_016209622.1|1257875_1259039_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_036777073.1|1259070_1261608_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209626.1|1261639_1263532_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273639.1|1263899_1264616_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209631.1|1264618_1267492_+	DUF4280 domain-containing protein	NA	NA	NA	NA	NA
WP_016209636.1|1267492_1267897_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209614.1|1267911_1269633_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209633.1|1269632_1272581_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209625.1|1272583_1273981_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209630.1|1273994_1274735_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209632.1|1274715_1275150_+	lipoprotein	NA	NA	NA	NA	NA
WP_016209618.1|1275194_1275824_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_016209616.1|1275894_1276809_-	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_033923701.1|1276839_1280142_-	translocation/assembly module TamB domain-containing protein	NA	NA	NA	NA	NA
WP_016209627.1|1280138_1281962_-	BamA/TamA family outer membrane protein	NA	NA	NA	NA	NA
WP_016209617.1|1282001_1282400_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209621.1|1282520_1283525_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_016209619.1|1283957_1285406_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_036777066.1|1285492_1288549_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_081007073.1|1288531_1288702_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300317.1|1289201_1289735_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126753.1|1290691_1291156_-	copper chaperone PCu(A)C	NA	NA	NA	NA	NA
WP_016211466.1|1291225_1292746_-	RsmB/NOP family class I SAM-dependent RNA methyltransferase	NA	NA	NA	NA	NA
WP_016211458.1|1292833_1293433_-	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_016211464.1|1293432_1293780_-	arsenate reductase (glutaredoxin)	NA	NA	NA	NA	NA
WP_016211465.1|1293930_1294914_+	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	32.7	2.9e-34
WP_054300318.1|1295541_1296519_+	NAD(P)H-quinone oxidoreductase	NA	NA	NA	NA	NA
WP_052104629.1|1296666_1297692_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_052047087.1|1298142_1298361_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300320.1|1298338_1298938_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300321.1|1299155_1299527_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126540.1|1300701_1301565_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_016211749.1|1301773_1302967_+	fatty acid desaturase	NA	NA	NA	NA	NA
WP_016211748.1|1303046_1304651_+	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_016211752.1|1304666_1305812_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_129556531.1|1306016_1306214_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059372279.1|1306179_1306515_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007004.1|1306474_1306930_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_016212445.1|1307175_1307442_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_016212446.1|1307804_1308566_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.1	1.2e-48
WP_081007023.1|1308600_1309257_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_016212534.1|1309333_1309600_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211725.1|1311170_1312085_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300322.1|1312123_1314058_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300323.1|1314445_1315039_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052104629.1|1315282_1316308_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_075273534.1|1316670_1317552_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300325.1|1317745_1318018_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300326.1|1318119_1318584_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046975.1|1318997_1319447_+	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_016212459.1|1319566_1319947_+	glycine-zipper containing OmpA-like membrane domain protein	NA	NA	NA	NA	NA
WP_054300328.1|1320084_1320861_-	methyltransferase domain-containing protein	NA	R4ZD91	Adoxophyes_honmai_entomopoxvirus	25.5	8.1e-16
WP_155046974.1|1320971_1321133_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274658.1|1321284_1322490_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300330.1|1322539_1323601_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 18
NZ_CP012413	Piscirickettsia salmonis strain PM15972A1 chromosome, complete genome	3062470	1350110	1393249	3062470	transposase	Staphylococcus_phage(100.0%)	42	NA	NA
WP_098082828.1|1350110_1350368_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036779544.1|1350367_1351375_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_054300338.1|1351399_1352965_-	APC family permease	NA	NA	NA	NA	NA
WP_016210800.1|1353171_1353999_-	thioredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_075273540.1|1354365_1354977_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556527.1|1355161_1355422_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210799.1|1355595_1356549_+	chemotaxis protein CheV	NA	NA	NA	NA	NA
WP_016210791.1|1356971_1357172_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052104738.1|1357546_1358353_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_016210795.1|1358458_1359430_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_016210801.1|1359411_1360383_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_081007027.1|1360705_1360891_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081007028.1|1361675_1362131_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_059372279.1|1362090_1362426_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211352.1|1362602_1363043_-	universal stress protein	NA	NA	NA	NA	NA
WP_016211350.1|1363721_1364660_+	ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_016211349.1|1364723_1366718_+	cytochrome o ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_032127067.1|1366714_1367317_+	cytochrome o ubiquinol oxidase subunit III	NA	NA	NA	NA	NA
WP_016211351.1|1367313_1367652_+	cytochrome o ubiquinol oxidase subunit IV	NA	NA	NA	NA	NA
WP_129556640.1|1367727_1368954_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211856.1|1370698_1370884_+	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
WP_016211855.1|1371010_1371478_+	bacterioferritin	NA	NA	NA	NA	NA
WP_016211857.1|1371474_1372353_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_032126602.1|1372603_1373911_+	MFS transporter	NA	NA	NA	NA	NA
WP_081007004.1|1374063_1374519_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_059372279.1|1374478_1374814_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126790.1|1375806_1376712_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_016211741.1|1377875_1378652_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_032126783.1|1378797_1380039_+	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_016211739.1|1380149_1380656_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046970.1|1380772_1381021_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211177.1|1382445_1383666_-	amino acid permease	NA	NA	NA	NA	NA
WP_036776658.1|1384057_1386052_-	monovalent cation:proton antiporter family protein	NA	NA	NA	NA	NA
WP_081007029.1|1386164_1386773_-	Smr/MutS family protein	NA	NA	NA	NA	NA
WP_032126449.1|1386839_1387763_+	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_016211180.1|1387783_1388248_+	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_016211178.1|1388310_1389339_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_032126448.1|1389429_1389810_+	lactoylglutathione lyase	NA	NA	NA	NA	NA
WP_036776661.1|1389841_1390171_+	DUF4404 family protein	NA	NA	NA	NA	NA
WP_016212474.1|1390898_1391075_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|1391437_1392412_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_155046969.1|1392431_1393249_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 19
NZ_CP012413	Piscirickettsia salmonis strain PM15972A1 chromosome, complete genome	3062470	1404078	1459689	3062470	tRNA,transposase	Staphylococcus_phage(18.75%)	52	NA	NA
WP_054300239.1|1404078_1404912_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300343.1|1404947_1405175_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105962625.1|1405178_1406065_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_081007031.1|1406152_1406425_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209794.1|1407055_1407679_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300344.1|1407724_1409668_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A1U9WQS3	Geobacillus_phage	23.9	1.1e-05
WP_016209788.1|1409789_1410542_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_161625457.1|1410746_1411052_+	flagellar basal body-associated FliL family protein	NA	NA	NA	NA	NA
WP_129556639.1|1411347_1411758_+	flagellar basal body-associated FliL family protein	NA	NA	NA	NA	NA
WP_016209775.1|1411774_1412230_+	flagellar motor switch protein FliN	NA	NA	NA	NA	NA
WP_016209797.1|1412226_1412718_+	flagellar biosynthetic protein FliO	NA	NA	NA	NA	NA
WP_080664822.1|1412714_1413464_+	flagellar type III secretion system pore protein FliP	NA	NA	NA	NA	NA
WP_016209776.1|1413493_1413763_+	flagellar biosynthesis protein FliQ	NA	NA	NA	NA	NA
WP_016209787.1|1413778_1414564_+	flagellar biosynthetic protein FliR	NA	NA	NA	NA	NA
WP_016209786.1|1414577_1415711_+	flagellar biosynthesis protein FlhB	NA	NA	NA	NA	NA
WP_016209770.1|1415745_1417839_+	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_016209767.1|1417869_1419330_+	flagellar biosynthesis protein FlhF	NA	NA	NA	NA	NA
WP_032126438.1|1419355_1420198_+	MinD/ParA family protein	NA	NA	NA	NA	NA
WP_016209784.1|1420194_1420917_+	RNA polymerase sigma factor FliA	NA	A0A1B1P7V3	Bacillus_phage	24.1	2.7e-05
WP_017377132.1|1421003_1421387_+	chemotaxis protein CheY	NA	NA	NA	NA	NA
WP_016209769.1|1421428_1422172_+	protein phosphatase CheZ	NA	NA	NA	NA	NA
WP_036776682.1|1422184_1424209_+	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_051307317.1|1424270_1424564_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209791.1|1424700_1425423_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209771.1|1425587_1426310_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_032126436.1|1427016_1427472_+	SUF system Fe-S cluster assembly regulator	NA	NA	NA	NA	NA
WP_016209793.1|1427487_1428936_+	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_016209795.1|1428976_1429732_+	Fe-S cluster assembly ATPase SufC	NA	A0A285PWH2	Cedratvirus	24.6	1.3e-10
WP_016209780.1|1429736_1431113_+	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_016209796.1|1431136_1432354_+	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	42.0	2.9e-92
WP_016209778.1|1432384_1432759_+	iron-sulfur cluster assembly accessory protein	NA	A0A218MM00	uncultured_virus	38.5	1.7e-11
WP_016209772.1|1432777_1433329_+	putative Fe-S cluster assembly protein SufT	NA	NA	NA	NA	NA
WP_054300271.1|1434610_1435585_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_054300148.1|1435682_1436744_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300271.1|1437298_1438273_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_075273327.1|1438963_1439539_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1439484_1439850_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300345.1|1439986_1441066_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300162.1|1441147_1442230_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_054300346.1|1442376_1443252_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126678.1|1443262_1444273_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.6	1.2e-22
WP_016211554.1|1444599_1445226_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	41.3	1.6e-33
WP_016211557.1|1445271_1446501_+	na+ dependent nucleoside transporter family protein	NA	B2YG43	Musca_hytrovirus	22.0	2.0e-08
WP_032126677.1|1446695_1447259_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_016211555.1|1447333_1448692_+	dGTPase	NA	NA	NA	NA	NA
WP_016211664.1|1448942_1449671_-	single-stranded DNA-binding protein	NA	A0A2I7QWB5	Vibrio_phage	65.6	6.2e-42
WP_016211666.1|1450043_1452863_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	55.2	1.0e-311
WP_016211669.1|1453017_1453368_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_162034419.1|1453729_1453876_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|1454192_1455167_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_129556522.1|1456477_1457710_+	MFS transporter	NA	S4TR35	Salmonella_phage	23.2	9.0e-17
WP_016211405.1|1457916_1459689_+|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L0E9	Tupanvirus	41.9	4.9e-08
>prophage 20
NZ_CP012413	Piscirickettsia salmonis strain PM15972A1 chromosome, complete genome	3062470	1466381	1529740	3062470	tRNA,transposase,integrase	Acinetobacter_phage(12.5%)	57	1454192:1454251	1521490:1522502
1454192:1454251	attL	GATGGTTTATCGGCACTTAAATGAAAAAGATCGTTTTTATATCGAACAACGGTTATCAGA	NA	NA	NA	NA
WP_054300161.1|1466381_1467443_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212266.1|1468069_1468717_-	LysE family translocator	NA	NA	NA	NA	NA
WP_016212267.1|1468997_1469357_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007004.1|1469523_1469979_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_059372279.1|1469938_1470274_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211482.1|1470412_1472686_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126823.1|1472674_1473397_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052104609.1|1473507_1474140_+	MarC family protein	NA	NA	NA	NA	NA
WP_098082850.1|1474175_1474352_-	DUF1508 domain-containing protein	NA	NA	NA	NA	NA
WP_016211481.1|1474426_1475569_-	carboxypeptidase family protein	NA	NA	NA	NA	NA
WP_155049129.1|1475647_1475785_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126825.1|1475801_1477115_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.0	3.5e-51
WP_054300349.1|1477666_1479391_+	protein kinase	NA	M1I1A9	Paramecium_bursaria_Chlorella_virus	25.6	1.7e-05
WP_155046942.1|1480542_1481428_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_105962623.1|1481813_1482967_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_155046729.1|1483184_1484231_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211631.1|1484489_1485296_-	DUF2807 domain-containing protein	NA	NA	NA	NA	NA
WP_054300351.1|1485551_1486373_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_016211632.1|1486408_1487263_-	DUF481 domain-containing protein	NA	NA	NA	NA	NA
WP_016211627.1|1487488_1487653_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|1487816_1488392_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1488337_1488703_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155066176.1|1488965_1489235_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046968.1|1489243_1490397_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.4	2.2e-57
WP_032126362.1|1490905_1491271_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1491216_1491792_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016210103.1|1492144_1493503_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	37.2	7.7e-70
WP_016210115.1|1493577_1493751_+	membrane protein	NA	NA	NA	NA	NA
WP_016210117.1|1493784_1494144_-	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
WP_054300275.1|1494379_1495255_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016210111.1|1495559_1497194_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	49.9	9.7e-144
WP_017377579.1|1497200_1498037_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	41.3	1.7e-51
WP_016210099.1|1498058_1499336_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	60.9	2.5e-139
WP_016210105.1|1499419_1499740_+	cell division protein FtsB	NA	NA	NA	NA	NA
WP_016210106.1|1499759_1500851_+|tRNA	tRNA pseudouridine(13) synthase TruD	tRNA	NA	NA	NA	NA
WP_036777611.1|1501033_1502623_+	APC family permease	NA	NA	NA	NA	NA
WP_016210110.1|1502683_1503439_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	52.0	5.4e-65
WP_016210113.1|1503626_1504676_+	RNA polymerase sigma factor RpoS	NA	M4SMP8	Cyanophage	31.5	7.9e-30
WP_032126689.1|1506342_1507803_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210107.1|1508092_1508365_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210114.1|1508436_1509696_-	calcineurin-like phosphoesterase	NA	NA	NA	NA	NA
WP_016210108.1|1509788_1511054_-	sodium:proton antiporter	NA	A0A2H4J178	uncultured_Caudovirales_phage	42.8	9.1e-49
WP_122943012.1|1511239_1511695_+	DUF4442 domain-containing protein	NA	NA	NA	NA	NA
WP_016210112.1|1511811_1513239_+	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	35.0	2.5e-55
WP_075273549.1|1513932_1514415_-	WbuC family cupin fold metalloprotein	NA	NA	NA	NA	NA
WP_054300353.1|1520459_1520687_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046967.1|1520737_1521352_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	S5WIU1	Leptospira_phage	40.1	1.5e-33
WP_054300271.1|1521490_1522465_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_172673403.1|1522537_1522798_-	hypothetical protein	NA	NA	NA	NA	NA
1521490:1522502	attR	GATGGTTTATCGGCACTTAAATGAAAAAGATCGTTTTTATATCGAACAACGGTTATCAGAGGGAGACTCGCTCAGATCAATTGCTAGAGCACTTGGCTTTTCTCCTAGCACGATTAGCCGTGAGATTAAACGGCACACCCCAATCGATTTTAAAGGTCTTTATTGTCACCGGCTTACTTCTCGCTGTGCACAAGAAAAACGAGCTAACGCTAAGCAAGGTCAAGCTTTTCGACAAATTTCAGAGGAGGCAAAAATGTTGATCCATCAACGGTTAAGCACCCATACATCCCCCGATGTTATCAGTCAGGAACTTATACGAGAGCATGATATCCAGGTGAGTGAAAGCACGATTTACCGTTATATTTATGATGATAGAGAGCAGGGCGGAGAGCTTTACAAAAACCTGCCTCATTCGGGAAAACCTTATAAGAAAAAGGTGAATCGTGGTGATCAAATAAAAATACCTAATCGCGTTGGTATTGAACACCGGCCTGCTATTGCTGATGAAAAGACAGAGTTTGGTCATTTTGAAATTGATACGGTTGTGGGTCGCGATCACCAATCTTATTTATTAACACTGGTCGATAAGGCGAATAAAATGTGTTGTATAAGGAAAATGCCTAACAAACAAGCCAAGACTGTTATCAATACATTCATGAATGTGGTTGGCTCAACTTTCTTTGATTTTAAAACCATCACCTCTGACAATGGAACAGAGTTTGCGGGTCATGAGGCCATTTCAAAGATCACTGAAGCAGACTTTTACTTTGCTAGACCTTATCGTTCTTGTGATAGAGGTCTAAATGAGCACACAAATGGTTTGATAAGGCGTTTTCTACCTAAAGGGACAGATTTTAATGAAATTAGTGACAAAGAAATAGCAAAAATAGAGCATACATTGAACACCAGAAGAAGAGCGAGTTTGAATTATTGCTCACCTAATCATGTTTTTTTAGAGTATTTGATGGCGGCTTAGTATAGAGTAGTGTTGCACTTCAGATGACGGAGGGCGT	NA	NA	NA	NA
WP_032126362.1|1522878_1523244_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1523189_1523765_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300355.1|1523754_1523940_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211563.1|1524150_1524312_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211564.1|1524344_1525220_-	ParA family protein	NA	NA	NA	NA	NA
WP_052104693.1|1525385_1529252_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SBU4	Catovirus	26.2	1.9e-49
WP_080728343.1|1529333_1529474_-	hypothetical protein	NA	A0A0U2RK18	Escherichia_phage	69.0	1.6e-07
WP_081007034.1|1529455_1529740_-|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
>prophage 21
NZ_CP012413	Piscirickettsia salmonis strain PM15972A1 chromosome, complete genome	3062470	1535714	1573869	3062470	protease,transposase,integrase	Staphylococcus_phage(50.0%)	37	1545309:1545368	1571969:1572258
WP_054300276.1|1535714_1536689_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	4.0e-28
WP_016212012.1|1536732_1537410_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_016212013.1|1537425_1537809_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212011.1|1538030_1539152_-	calcium:proton antiporter	NA	NA	NA	NA	NA
WP_054300357.1|1539385_1540261_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016211974.1|1540543_1541665_+	alanine dehydrogenase	NA	NA	NA	NA	NA
WP_075273551.1|1541764_1542067_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556638.1|1542066_1542747_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|1543325_1543691_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_081377865.1|1545050_1545335_-|transposase	transposase	transposase	NA	NA	NA	NA
1545309:1545368	attL	CGCTGCGAGCCATGGAGTGCTAAGCACGGGGTGAGTAGGCCGAGGTAGGTTCGGGTTTTT	NA	NA	NA	NA
WP_172673413.1|1545693_1547469_-	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
WP_054300359.1|1547779_1548352_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273651.1|1548710_1549748_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007035.1|1550573_1551239_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300271.1|1551278_1552253_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016211144.1|1552809_1553439_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_036779218.1|1553422_1553845_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_016211145.1|1553851_1555591_+	lipid A export permease/ATP-binding protein MsbA	NA	W8CYL7	Bacillus_phage	30.8	8.4e-53
WP_016211153.1|1555591_1556656_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_016211147.1|1556659_1557013_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211146.1|1557125_1558082_+	ferrochelatase	NA	NA	NA	NA	NA
WP_016211151.1|1558091_1558403_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211143.1|1558418_1558988_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	39.5	7.3e-30
WP_016211148.1|1559251_1560580_+	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_054300271.1|1560784_1561759_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_148037535.1|1562137_1562344_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210839.1|1562402_1563176_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_036778955.1|1563327_1565898_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126340.1|1566063_1566825_+	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_122941824.1|1566905_1568642_-	cation:proton antiporter	NA	NA	NA	NA	NA
WP_016210844.1|1568826_1569954_-	Fic family protein	NA	D7RWK9	Brochothrix_phage	23.2	5.7e-10
WP_016210843.1|1570040_1570271_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556637.1|1570885_1571665_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_016212589.1|1572139_1572577_-	MFS transporter	NA	NA	NA	NA	NA
1571969:1572258	attR	CGCTGCGAGCCATGGAGTGCTAAGCACGGGGTGAGTAGGCCGAGGTAGGTTCGGGTTTTTAGCAGAGCGGAGTTGCGAAAGACCGTTAGGTCTGTAGCAAGCGTAACGAGTGTCTAAAAATCTATACGAACCGTAGAGTCATGTGAGAGCACAGTGGTGGAGTGTGCCGATTCAAGGCACGCAACGCTGTGTGACGCGGACAGCCGAGGGTTTATAGTCGTCGCGTTTTGCTCGGCGATTTTGCATCATTGGATGTGCAAAATACCTACCGAGGTAGCGACGCTTACGTA	NA	NA	NA	NA
WP_164997261.1|1572611_1572761_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300363.1|1573000_1573348_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046964.1|1573293_1573869_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 23
NZ_CP012413	Piscirickettsia salmonis strain PM15972A1 chromosome, complete genome	3062470	1752104	1812164	3062470	tRNA,transposase	Wolbachia_phage(25.0%)	51	NA	NA
WP_129556449.1|1752104_1752611_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300209.1|1752625_1752991_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300380.1|1753194_1753851_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300382.1|1754121_1754544_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300383.1|1754814_1757295_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_032126139.1|1757390_1758320_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_016210804.1|1758326_1760246_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	34.0	4.5e-84
WP_032126141.1|1760310_1761585_-	sphingomyelin phosphodiesterase	NA	NA	NA	NA	NA
WP_016210805.1|1761994_1762666_-	pyrimidine 5'-nucleotidase	NA	NA	NA	NA	NA
WP_036776426.1|1762674_1763526_-	pyridoxal kinase PdxY	NA	NA	NA	NA	NA
WP_016210803.1|1763703_1765002_+	PAS domain S-box protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	52.3	7.5e-14
WP_054300162.1|1765076_1766159_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_016212040.1|1766362_1767712_-	DNA recombination protein RmuC	NA	NA	NA	NA	NA
WP_144019344.1|1767888_1768416_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052133287.1|1768634_1769033_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_075273581.1|1769088_1770456_-	group II intron reverse transcriptase/maturase	NA	A0A0N7AE80	Bacillus_phage	24.3	1.6e-11
WP_054300384.1|1770864_1771680_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_016212251.1|1771841_1772378_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212250.1|1772539_1773190_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300385.1|1773312_1773876_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126789.1|1774147_1774330_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211219.1|1774679_1775957_-	FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	NA	NA	NA	NA	NA
WP_080664858.1|1775953_1776091_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211223.1|1776602_1778204_+	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_016211221.1|1778220_1779363_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_054300386.1|1779615_1780353_-	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_016211224.1|1780377_1781649_-	phosphopentomutase	NA	NA	NA	NA	NA
WP_032126790.1|1781877_1782783_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_054300385.1|1783107_1783671_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126789.1|1783942_1784125_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080664858.1|1785747_1785885_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211223.1|1786396_1787998_+	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_016211221.1|1788014_1789157_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_054300386.1|1789409_1790147_-	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_016211224.1|1790171_1791443_-	phosphopentomutase	NA	NA	NA	NA	NA
WP_032126790.1|1791671_1792577_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_054300385.1|1792901_1793465_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211219.1|1794266_1795544_-	FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	NA	NA	NA	NA	NA
WP_080664858.1|1795540_1795678_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211221.1|1797807_1798950_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_054300386.1|1799202_1799940_-	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_032126790.1|1801463_1802369_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_054300385.1|1802693_1803257_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126789.1|1803528_1803711_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211219.1|1804060_1805338_-	FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	NA	NA	NA	NA	NA
WP_080664858.1|1805334_1805472_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211223.1|1805983_1807585_+	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_016211221.1|1807601_1808744_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_054300386.1|1808996_1809734_-	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_016211224.1|1809758_1811030_-	phosphopentomutase	NA	NA	NA	NA	NA
WP_032126790.1|1811258_1812164_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 24
NZ_CP012413	Piscirickettsia salmonis strain PM15972A1 chromosome, complete genome	3062470	1848741	1972129	3062470	tRNA,transposase	uncultured_Mediterranean_phage(20.83%)	104	NA	NA
WP_054300392.1|1848741_1849803_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300393.1|1850346_1850928_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300394.1|1850890_1851253_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212000.1|1851383_1852112_-	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
WP_016212002.1|1852231_1852510_+	DNA-J related family protein	NA	NA	NA	NA	NA
WP_075273590.1|1852513_1853089_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155046705.1|1853034_1853202_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300397.1|1853442_1853688_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_172673420.1|1853838_1854060_+	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_016210889.1|1854077_1856924_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210887.1|1857433_1858384_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_016210886.1|1858466_1859246_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_155053505.1|1859314_1860037_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_016210888.1|1859982_1860234_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126206.1|1860256_1860553_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210891.1|1861086_1861860_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210892.1|1861892_1862489_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300398.1|1862546_1863428_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273592.1|1863803_1864778_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	4.3e-30
WP_054300399.1|1864876_1865143_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300400.1|1865287_1865530_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168183217.1|1865544_1866114_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_107517381.1|1866779_1866974_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376688.1|1867187_1867541_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300401.1|1867872_1868154_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300402.1|1868756_1872902_-	cadherin-like domain-containing protein	NA	NA	NA	NA	NA
WP_016211770.1|1873101_1874235_+	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_016211771.1|1874248_1874437_-	Trm112 family protein	NA	NA	NA	NA	NA
WP_054300403.1|1874729_1875704_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.0	2.0e-27
WP_075273594.1|1875743_1877114_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	27.4	4.2e-39
WP_054300404.1|1877186_1878080_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_016209948.1|1878188_1879106_-	TIGR01777 family protein	NA	NA	NA	NA	NA
WP_016209943.1|1879157_1879913_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209939.1|1879980_1881255_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	51.2	1.7e-90
WP_016209927.1|1881389_1882067_-	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_016209944.1|1882267_1883695_+	aminodeoxychorismate synthase component I	NA	S4VNU7	Pandoravirus	29.8	4.2e-42
WP_016209938.1|1883669_1884308_+	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_016209925.1|1884517_1884796_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209935.1|1885029_1885974_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	35.2	3.2e-38
WP_036777561.1|1885995_1887864_-	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_016209930.1|1887884_1888238_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	45.7	3.1e-07
WP_036777579.1|1888276_1889392_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	48.9	4.8e-94
WP_016209932.1|1889574_1890615_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_016209945.1|1890617_1891652_-	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_016209926.1|1891648_1892710_-	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_016209931.1|1892821_1894294_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	30.4	7.9e-44
WP_052104625.1|1894446_1894890_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_016209940.1|1894965_1897737_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	39.3	1.8e-150
WP_036777555.1|1897893_1899123_+	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_016209947.1|1899149_1899812_-	carbonic anhydrase	NA	NA	NA	NA	NA
WP_054300405.1|1900333_1900834_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_075273595.1|1900889_1902260_-	group II intron reverse transcriptase/maturase	NA	A0A0N7AE80	Bacillus_phage	24.3	9.6e-12
WP_081007042.1|1902668_1903484_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300406.1|1905783_1908519_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|1908819_1909881_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126856.1|1909941_1910283_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105962623.1|1910587_1911741_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_016212005.1|1912641_1914402_-	gamma-glutamyltransferase	NA	NA	NA	NA	NA
WP_016210592.1|1914791_1915448_-|tRNA	tRNA-(ms[2]io[6]A)-hydroxylase	tRNA	NA	NA	NA	NA
WP_016210586.1|1915460_1916966_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	41.0	1.7e-86
WP_016210593.1|1916987_1917518_-	CvpA family protein	NA	NA	NA	NA	NA
WP_016210590.1|1917597_1918860_-	bifunctional tetrahydrofolate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_016210587.1|1919034_1919895_-	acetyl-CoA carboxylase carboxyltransferase subunit beta	NA	NA	NA	NA	NA
WP_032126176.1|1919996_1920779_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_016210588.1|1920869_1922195_-	fimV domain protein	NA	NA	NA	NA	NA
WP_016210595.1|1922562_1923741_-	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_016210594.1|1923917_1924571_-	glutaredoxin 2	NA	NA	NA	NA	NA
WP_036778626.1|1924706_1926647_+	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	33.0	1.8e-72
WP_129556498.1|1926643_1927252_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_054300271.1|1927431_1928406_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_075273597.1|1928677_1930522_+	MFS transporter	NA	NA	NA	NA	NA
WP_155046942.1|1930511_1931398_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016211114.1|1931543_1934474_-	insulinase family protein	NA	NA	NA	NA	NA
WP_016211115.1|1934606_1936559_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	28.0	2.7e-44
WP_016211112.1|1936751_1937399_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016211113.1|1937454_1938780_+	ribonuclease HI	NA	G3MB70	Bacillus_virus	36.3	1.7e-37
WP_032126179.1|1938809_1939061_-	TSUP family transporter	NA	NA	NA	NA	NA
WP_080664854.1|1939018_1939600_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_054300408.1|1939936_1940593_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.0	9.6e-10
WP_032126362.1|1940643_1941009_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1940954_1941530_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016209823.1|1942751_1943195_-	response regulator	NA	NA	NA	NA	NA
WP_016209809.1|1943619_1944108_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209817.1|1944214_1945183_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_016209820.1|1945884_1949184_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209803.1|1949242_1950280_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_016209810.1|1950484_1952398_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	38.3	6.9e-117
WP_016209822.1|1952454_1953102_-	class I SAM-dependent methyltransferase	NA	W8CYT3	Bacillus_phage	30.8	1.4e-08
WP_036777933.1|1953237_1954362_-	2-hydroxyacid dehydrogenase	NA	NA	NA	NA	NA
WP_016209800.1|1954358_1954955_-	recombination protein RecR	NA	NA	NA	NA	NA
WP_016209821.1|1954985_1955318_-	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_016209812.1|1955407_1957231_-	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	40.5	9.7e-44
WP_054300409.1|1957677_1959390_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	30.2	4.3e-25
WP_016209815.1|1959707_1960247_+	DUF2975 domain-containing protein	NA	NA	NA	NA	NA
WP_016209799.1|1960633_1961050_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209818.1|1961145_1961961_+	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_016209805.1|1962093_1963587_+	sodium-dependent transporter	NA	NA	NA	NA	NA
WP_032126324.1|1963765_1964188_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209801.1|1964187_1966242_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_016209813.1|1966526_1967342_+	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_016209824.1|1967442_1968261_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_016209808.1|1968257_1968626_+	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_016212343.1|1969930_1970737_+	SDR family NAD(P)-dependent oxidoreductase	NA	W8CYX9	Bacillus_phage	42.9	7.7e-09
WP_129556499.1|1970975_1972129_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	1.5e-58
>prophage 25
NZ_CP012413	Piscirickettsia salmonis strain PM15972A1 chromosome, complete genome	3062470	1978646	2024748	3062470	tRNA,transposase	Bacillus_phage(20.0%)	49	NA	NA
WP_032126637.1|1978646_1978940_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	8.3e-06
WP_032126540.1|1979170_1980034_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_054300410.1|1980167_1980533_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273298.1|1980478_1981054_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126332.1|1981700_1982900_-	trans-2-enoyl-CoA reductase family protein	NA	NA	NA	NA	NA
WP_016211366.1|1983152_1983440_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036779263.1|1983495_1985505_-	TRAP transporter permease	NA	NA	NA	NA	NA
WP_032126330.1|1985559_1986519_-	TAXI family TRAP transporter solute-binding subunit	NA	NA	NA	NA	NA
WP_016211367.1|1986666_1987449_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273303.1|1987604_1988321_+	murein L,D-transpeptidase catalytic domain family protein	NA	NA	NA	NA	NA
WP_016210281.1|1988334_1989726_-	flagellar hook-associated protein FlgL	NA	NA	NA	NA	NA
WP_016210270.1|1989767_1992755_-	flagellar hook-associated protein FlgK	NA	NA	NA	NA	NA
WP_016210277.1|1992824_1993658_-	rod-binding protein	NA	NA	NA	NA	NA
WP_016210279.1|1993711_1994878_-	flagellar basal body P-ring protein FlgI	NA	NA	NA	NA	NA
WP_016210272.1|1994865_1995576_-	flagellar basal body L-ring protein FlgH	NA	NA	NA	NA	NA
WP_016210283.1|1995615_1996401_-	flagellar basal-body rod protein FlgG	NA	NA	NA	NA	NA
WP_016210282.1|1996428_1997166_-	flagellar basal body rod protein FlgF	NA	NA	NA	NA	NA
WP_016210285.1|1997269_1999465_-	flagellar hook-basal body complex protein	NA	NA	NA	NA	NA
WP_016210271.1|1999531_2000215_-	flagellar hook assembly protein FlgD	NA	NA	NA	NA	NA
WP_032126334.1|2000225_2000657_-	flagellar basal body rod protein FlgC	NA	NA	NA	NA	NA
WP_016210274.1|2000696_2001095_-	flagellar basal body rod protein FlgB	NA	NA	NA	NA	NA
WP_016210273.1|2001467_2002175_+	flagellar basal body P-ring formation protein FlgA	NA	NA	NA	NA	NA
WP_016210275.1|2002239_2002542_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210276.1|2002597_2003074_+	flagellar protein FlgN	NA	NA	NA	NA	NA
WP_016210284.1|2003128_2003650_-	peptidylprolyl isomerase	NA	A0A1V0SCU1	Indivirus	53.4	1.7e-25
WP_016210280.1|2003731_2004826_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_054300412.1|2005062_2005377_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273307.1|2005521_2005932_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300414.1|2006202_2006688_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300415.1|2007351_2008053_+	dual specificity protein phosphatase family protein	NA	A0A068QKX9	Armadillidium_vulgare_iridescent_virus	33.0	1.6e-07
WP_032126500.1|2008186_2008903_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211118.1|2009039_2010287_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	72.2	1.1e-14
WP_032126499.1|2010665_2011277_-	PilZ domain-containing protein	NA	NA	NA	NA	NA
WP_016211122.1|2011373_2012240_-	OmpA family protein	NA	NA	NA	NA	NA
WP_016211119.1|2012243_2013005_-	flagellar motor protein PomA	NA	NA	NA	NA	NA
WP_036779309.1|2013168_2014074_+	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_016211125.1|2014296_2015127_+	GTP cyclohydrolase I FolE2	NA	NA	NA	NA	NA
WP_016211126.1|2015296_2015686_+	lipoprotein	NA	NA	NA	NA	NA
WP_054300416.1|2015818_2016769_+	methyl-accepting chemotaxis protein	NA	NA	NA	NA	NA
WP_016212585.1|2017063_2017384_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300417.1|2017495_2018470_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_155046958.1|2018854_2019415_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2019360_2019726_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300421.1|2020662_2021508_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300422.1|2021558_2021996_-	TauD/TfdA family dioxygenase	NA	NA	NA	NA	NA
WP_016212519.1|2022266_2022647_-	taurine catabolism dioxygenase TauD, TfdA family protein	NA	NA	NA	NA	NA
WP_054300423.1|2022721_2023783_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212611.1|2023830_2024151_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_052047048.1|2024247_2024748_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
>prophage 26
NZ_CP012413	Piscirickettsia salmonis strain PM15972A1 chromosome, complete genome	3062470	2054682	2096920	3062470	tRNA,protease,transposase	Bacillus_thuringiensis_phage(16.67%)	45	NA	NA
WP_081007004.1|2054682_2055138_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_059372279.1|2055097_2055433_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212093.1|2055648_2056578_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	30.1	3.7e-31
WP_129556559.1|2056734_2057163_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556560.1|2057243_2057780_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126790.1|2057749_2058655_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_080728345.1|2058823_2059432_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_075273298.1|2059472_2060048_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155046705.1|2059993_2060161_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556499.1|2060266_2061419_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	1.5e-58
WP_016211971.1|2061625_2062237_-	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_032126649.1|2062257_2063454_-	site-specific DNA-methyltransferase	NA	A0A2L1IZ21	Streptomyces_phage	33.5	1.2e-42
WP_017377024.1|2063550_2063691_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211968.1|2063703_2064108_-	SufE family protein	NA	NA	NA	NA	NA
WP_155046954.1|2064262_2064436_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007044.1|2064542_2064860_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300431.1|2064819_2065122_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046743.1|2065266_2065452_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211961.1|2066021_2066603_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300573.1|2066630_2067764_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211960.1|2068027_2068555_-	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	NA	NA	NA	NA
WP_081007045.1|2068876_2069506_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300433.1|2069805_2070036_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556650.1|2070365_2071340_-	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_016209885.1|2071768_2072482_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_016209894.1|2072650_2073142_+	Spy/CpxP family protein refolding chaperone	NA	NA	NA	NA	NA
WP_016209887.1|2073285_2073777_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209877.1|2073979_2074870_+	Rossmann-like and DUF2520 domain-containing protein	NA	NA	NA	NA	NA
WP_080664826.1|2075036_2075636_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_016209878.1|2075716_2076655_-	signal peptide peptidase SppA	NA	A0A2I6UGK8	Salinibacter_virus	29.6	1.9e-14
WP_036777110.1|2076706_2077801_-	FUSC family protein	NA	NA	NA	NA	NA
WP_052104599.1|2077925_2079242_+	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	40.1	3.2e-65
WP_016209893.1|2079296_2084186_-	NAD-glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_016209881.1|2084278_2084581_-	DUF2835 family protein	NA	NA	NA	NA	NA
WP_016209876.1|2084691_2086614_+	PrkA family serine protein kinase	NA	NA	NA	NA	NA
WP_016209888.1|2086635_2087931_+	YeaH/YhbH family protein	NA	A0A219UQP6	Bacillus_phage	32.8	1.2e-06
WP_016209898.1|2087927_2089538_+	SpoVR family protein	NA	NA	NA	NA	NA
WP_052104600.1|2089644_2090538_-	thiol:disulfide interchange protein DsbG	NA	NA	NA	NA	NA
WP_016209884.1|2090647_2091271_+|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_036777115.1|2091347_2091548_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209891.1|2091689_2092388_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_016209896.1|2092534_2093104_-	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_122940402.1|2093418_2094042_-	porin family protein	NA	NA	NA	NA	NA
WP_032126745.1|2094250_2094853_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105962625.1|2096033_2096920_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 27
NZ_CP012413	Piscirickettsia salmonis strain PM15972A1 chromosome, complete genome	3062470	2100299	2220529	3062470	tRNA,transposase	Staphylococcus_phage(23.81%)	116	NA	NA
WP_054300357.1|2100299_2101175_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_026063519.1|2101223_2101640_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016210465.1|2101926_2102769_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	I6XGV6	Vibriophage	35.3	5.2e-32
WP_016210463.1|2102819_2103167_-	phosphomannose isomerase type II C-terminal cupin domain	NA	A0A1V0SH58	Hokovirus	42.1	9.2e-20
WP_016210471.1|2103357_2104245_+	ROK family protein	NA	NA	NA	NA	NA
WP_016210467.1|2104359_2104962_-	HAD family phosphatase	NA	NA	NA	NA	NA
WP_016210468.1|2104958_2105678_-	TIGR00266 family protein	NA	NA	NA	NA	NA
WP_054300435.1|2105746_2107459_-	ABC transporter ATP-binding protein/permease	NA	NA	NA	NA	NA
WP_036777098.1|2107606_2109544_+	AsmA family protein	NA	NA	NA	NA	NA
WP_032126596.1|2109652_2110705_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_016210461.1|2110704_2110980_+	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_016210458.1|2111060_2111609_+	DUF2147 domain-containing protein	NA	NA	NA	NA	NA
WP_054300436.1|2111925_2114517_-	bifunctional acetaldehyde-CoA/alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_016210459.1|2114681_2115200_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075285947.1|2115404_2116523_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144019255.1|2117013_2117694_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016211716.1|2117707_2118631_+	PAS and helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032126595.1|2118578_2119235_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211719.1|2119537_2120365_+	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_052133280.1|2120805_2121177_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126590.1|2121369_2122902_+	nuclease	NA	NA	NA	NA	NA
WP_032126591.1|2122964_2124302_-	N-succinylarginine dihydrolase	NA	NA	NA	NA	NA
WP_016210313.1|2124444_2125911_-	succinylglutamate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_016210314.1|2125907_2126957_-	arginine N-succinyltransferase	NA	NA	NA	NA	NA
WP_054300438.1|2127080_2129195_-	ATP-dependent DNA helicase RecG	NA	NA	NA	NA	NA
WP_016210305.1|2129359_2129764_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_016210308.1|2129824_2130550_-	ribonuclease PH	NA	NA	NA	NA	NA
WP_016210307.1|2130635_2131526_+	YicC family protein	NA	NA	NA	NA	NA
WP_032126592.1|2131566_2132187_+	guanylate kinase	NA	A0A143DIC6	Abalone_herpesvirus	36.3	2.5e-20
WP_016210310.1|2132247_2132454_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_016210316.1|2132475_2134629_+	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A2I2L310	Orpheovirus	37.1	1.1e-12
WP_054300439.1|2134635_2136618_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046953.1|2136889_2137030_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556499.1|2137038_2138192_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	1.5e-58
WP_054300440.1|2138488_2139700_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300441.1|2139844_2140207_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155083637.1|2140488_2142570_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211538.1|2143279_2144203_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	42.1	1.1e-24
WP_054300443.1|2144441_2144720_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007046.1|2144772_2145021_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300444.1|2144978_2146040_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212177.1|2147035_2147209_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212174.1|2147285_2147543_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212205.1|2149228_2149408_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212204.1|2149547_2150993_+	MFS transporter	NA	NA	NA	NA	NA
WP_036781320.1|2151839_2152067_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212320.1|2152053_2152380_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212318.1|2152381_2152813_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300148.1|2153341_2154403_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300445.1|2154497_2155049_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210829.1|2155318_2156338_-	thiamine-phosphate kinase	NA	NA	NA	NA	NA
WP_016210832.1|2156324_2156747_-	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_016210828.1|2156748_2157222_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	42.8	6.9e-26
WP_016210834.1|2157337_2157994_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	43.7	1.5e-39
WP_016210836.1|2157990_2158665_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	37.7	3.0e-30
WP_016210835.1|2158670_2159819_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	35.4	1.0e-43
WP_032126465.1|2159815_2160277_-	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_016210830.1|2160352_2161603_-	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	54.7	6.3e-103
WP_016210824.1|2161729_2163409_+	energy-dependent translational throttle protein EttA	NA	A0A2K9L3Z8	Tupanvirus	26.7	4.3e-38
WP_016210826.1|2163518_2164385_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300446.1|2165815_2166550_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	30.9	1.1e-09
WP_036781250.1|2166645_2167431_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_155046951.1|2168237_2168501_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211002.1|2168582_2168981_-	VOC family protein	NA	NA	NA	NA	NA
WP_016211001.1|2169144_2169450_-	helix-hairpin-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016210998.1|2169527_2169782_-	LapA family protein	NA	NA	NA	NA	NA
WP_032126469.1|2169935_2171597_-	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_016210997.1|2171656_2172340_-	(d)CMP kinase	NA	NA	NA	NA	NA
WP_080664849.1|2172339_2173428_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	43.3	4.9e-75
WP_054300447.1|2173476_2176113_-	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	32.6	2.0e-98
WP_054300173.1|2176525_2177587_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300448.1|2177776_2180146_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300276.1|2180189_2181164_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	4.0e-28
WP_054300449.1|2181183_2181963_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059372279.1|2182095_2182431_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007004.1|2182390_2182846_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_054300450.1|2183171_2184491_+	TRZ/ATZ family hydrolase	NA	NA	NA	NA	NA
WP_016211505.1|2184494_2185211_+	bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG	NA	NA	NA	NA	NA
WP_016211506.1|2185207_2185849_+	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_081007048.1|2185841_2185940_+	VOC family protein	NA	NA	NA	NA	NA
WP_081007049.1|2185917_2186214_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211503.1|2186224_2186680_-	VOC family protein	NA	NA	NA	NA	NA
WP_016211508.1|2186734_2187079_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016211502.1|2187108_2188152_-	ACR3 family arsenite efflux transporter	NA	NA	NA	NA	NA
WP_016211504.1|2188491_2188776_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105962625.1|2188765_2189652_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016210192.1|2189964_2190483_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210193.1|2190854_2191016_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210194.1|2191072_2191420_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036778869.1|2191454_2192117_-	serine/threonine protein kinase	NA	NA	NA	NA	NA
WP_036778872.1|2192160_2192766_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210201.1|2192995_2194051_+	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	34.9	3.4e-49
WP_016210187.1|2194054_2197240_+	carbamoyl-phosphate synthase (glutamine-hydrolyzing) large subunit	NA	NA	NA	NA	NA
WP_016210205.1|2197320_2198277_+	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	39.6	5.3e-49
WP_016210206.1|2198325_2198862_+	orotate phosphoribosyltransferase	NA	A0A1V0SHG3	Hokovirus	38.4	8.4e-20
WP_016210199.1|2198858_2199620_+	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_036778866.1|2199725_2202314_-	ATP-dependent chaperone ClpB	NA	K4FB40	Cronobacter_phage	36.9	3.3e-122
WP_032126472.1|2202776_2203427_-	DUF1669 domain-containing protein	NA	NA	NA	NA	NA
WP_016210190.1|2203646_2204522_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210195.1|2204712_2205114_+	cytidine deaminase	NA	NA	NA	NA	NA
WP_016210198.1|2205130_2205682_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210188.1|2205993_2206680_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036779341.1|2206680_2208891_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210196.1|2209244_2209598_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300452.1|2209555_2210617_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046950.1|2210666_2210921_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|2210910_2211486_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2211431_2211797_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300454.1|2211898_2212249_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556449.1|2212238_2212745_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300455.1|2212759_2213125_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300456.1|2213175_2214387_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300148.1|2214434_2215496_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300457.1|2215683_2216973_-	MFS transporter	NA	NA	NA	NA	NA
WP_054300173.1|2217133_2218195_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211428.1|2218465_2220529_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0S905	Catovirus	26.8	3.8e-36
>prophage 28
NZ_CP012413	Piscirickettsia salmonis strain PM15972A1 chromosome, complete genome	3062470	2260836	2322333	3062470	tRNA,transposase	Planktothrix_phage(20.0%)	59	NA	NA
WP_016209560.1|2260836_2261511_+|tRNA	tRNA (guanosine(18)-2'-O)-methyltransferase TrmH	tRNA	NA	NA	NA	NA
WP_017376619.1|2261539_2261944_+	RidA family protein	NA	NA	NA	NA	NA
WP_036777168.1|2261968_2262928_-	response regulator	NA	NA	NA	NA	NA
WP_016209567.1|2263059_2263677_-	MFS transporter	NA	NA	NA	NA	NA
WP_155046949.1|2263747_2263918_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126712.1|2264111_2264570_-	MFS transporter	NA	NA	NA	NA	NA
WP_016209553.1|2265314_2266325_+	DUF475 domain-containing protein	NA	A0A172Q0Y5	Acinetobacter_phage	42.2	2.9e-58
WP_016209566.1|2266809_2267721_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209545.1|2268046_2271541_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209551.1|2271578_2272418_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	45.0	1.8e-45
WP_036777155.1|2272604_2272820_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209547.1|2272868_2273444_-	ribonuclease HI	NA	V9M0C8	Vibrio_phage	46.6	1.3e-29
WP_016209540.1|2273440_2273779_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209568.1|2273947_2274937_-	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G9BWD6	Planktothrix_phage	32.7	1.7e-18
WP_016209572.1|2274937_2275900_-	oligopeptide ABC transporter ATP-binding protein OppD	NA	G9BWD6	Planktothrix_phage	32.1	7.7e-16
WP_016209559.1|2275909_2276812_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_054300460.1|2276855_2277131_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032126362.1|2277192_2277558_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273298.1|2277503_2278079_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212572.1|2278136_2278529_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300209.1|2278658_2279024_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300461.1|2279080_2279389_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|2279480_2280056_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2280001_2280367_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273331.1|2280492_2280792_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_172673414.1|2280927_2281068_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126774.1|2281688_2282024_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051307356.1|2282183_2283716_-	apolipoprotein N-acyltransferase	NA	NA	NA	NA	NA
WP_016211407.1|2283748_2284588_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_016211411.1|2284584_2285082_-	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_016211412.1|2285085_2286078_-	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	45.1	9.3e-49
WP_016211408.1|2286192_2287539_-|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_054300173.1|2287762_2288824_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212287.1|2288902_2290048_+|tRNA	multifunctional tRNA nucleotidyltransferase/2',3'-cyclic phosphodiesterase/2' nucleotidase/2'phosphatase	tRNA	A0A0F6YPT7	Sinorhizobium_phage	41.7	2.7e-60
WP_016211372.1|2295859_2296717_-	PIG-L family deacetylase	NA	NA	NA	NA	NA
WP_016211371.1|2296703_2297627_-	badF/BadG/BcrA/BcrD ATPase	NA	NA	NA	NA	NA
WP_016211368.1|2297823_2299215_+	sugar porter family MFS transporter	NA	NA	NA	NA	NA
WP_016211369.1|2299261_2300305_+	SIS domain-containing protein	NA	F2Y1G4	Organic_Lake_phycodnavirus	28.4	5.2e-18
WP_016211370.1|2300347_2300791_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_016211374.1|2300923_2302114_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_016211373.1|2302168_2302315_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212140.1|2302865_2303783_-	EamA family transporter RarD	NA	NA	NA	NA	NA
WP_036794860.1|2304050_2304344_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080664878.1|2304420_2304615_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300462.1|2305633_2306551_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210876.1|2307016_2307859_-	isopenicillin N synthase family oxygenase	NA	NA	NA	NA	NA
WP_016210873.1|2307926_2308577_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	36.6	4.1e-21
WP_032126665.1|2308591_2309650_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	44.0	1.5e-68
WP_036794016.1|2309769_2310840_+	DUF2066 domain-containing protein	NA	NA	NA	NA	NA
WP_016210872.1|2310866_2311976_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_016210871.1|2311992_2312310_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_016210879.1|2312306_2312666_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_054300463.1|2312768_2315498_-	kinase	NA	NA	NA	NA	NA
WP_016210881.1|2315998_2316814_-	LD-carboxypeptidase	NA	NA	NA	NA	NA
WP_054300173.1|2317024_2318086_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212048.1|2318849_2319407_+	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_032126664.1|2319600_2320284_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126663.1|2321002_2321245_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300464.1|2321271_2322333_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 29
NZ_CP012413	Piscirickettsia salmonis strain PM15972A1 chromosome, complete genome	3062470	2410583	2501792	3062470	tRNA,transposase,integrase	Escherichia_phage(39.29%)	87	2437511:2437570	2501252:2501860
WP_054300202.1|2410583_2411312_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_016210945.1|2412999_2413590_+	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_016210946.1|2413716_2415102_+	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_016210947.1|2415196_2415394_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126573.1|2415487_2416306_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126574.1|2416812_2417190_+	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_016210948.1|2417202_2417439_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210951.1|2417438_2417645_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036779389.1|2417827_2418547_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_016210954.1|2418635_2420420_+	SLC13 family permease	NA	NA	NA	NA	NA
WP_036779399.1|2420518_2420773_+	DUF2282 domain-containing protein	NA	NA	NA	NA	NA
WP_144019244.1|2421129_2421741_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_054300202.1|2422228_2422957_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_016211812.1|2423162_2424776_-	DEAD/DEAH box helicase	NA	A0A2I7RG64	Vibrio_phage	32.6	9.2e-62
WP_016211816.1|2424817_2425171_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300202.1|2425699_2426428_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_016211951.1|2426604_2427702_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	34.3	3.9e-48
WP_016211949.1|2427735_2428986_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	46.3	1.6e-93
WP_054300202.1|2429125_2429854_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_016212193.1|2429976_2430315_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212195.1|2430382_2430769_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_016212196.1|2430765_2431011_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_054300475.1|2431419_2432148_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	5.6e-43
WP_016211625.1|2432631_2433501_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	47.5	1.2e-68
WP_036779883.1|2433497_2434847_-	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	37.2	2.1e-75
WP_016211623.1|2434959_2436600_+	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_054300477.1|2437322_2438051_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	5.6e-43
2437511:2437570	attL	CATTTTCAATGCAGTTGTTTAAATACTTCACTCGCCTGAGTTTACACTGACTAGAAAAGA	NA	NA	NA	NA
WP_054300478.1|2438330_2440067_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	44.0	1.3e-24
WP_054300202.1|2440570_2441299_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_016212214.1|2441457_2441958_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_036780855.1|2441932_2442430_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300202.1|2443041_2443770_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_054300479.1|2443920_2444961_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211653.1|2445158_2446184_-	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	78.8	2.3e-18
WP_016211652.1|2446291_2447497_-	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	26.6	2.5e-35
WP_016211655.1|2447756_2448170_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211654.1|2448298_2448868_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211657.1|2448871_2449204_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300480.1|2449196_2450036_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211047.1|2450123_2451758_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211051.1|2452119_2452623_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A167R6J9	Powai_lake_megavirus	43.5	1.1e-13
WP_016211050.1|2452585_2453293_-	dethiobiotin synthase	NA	NA	NA	NA	NA
WP_016211044.1|2453361_2454222_-	malonyl-ACP O-methyltransferase BioC	NA	NA	NA	NA	NA
WP_036777969.1|2454202_2454976_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_016211052.1|2455006_2456260_-	8-amino-7-oxononanoate synthase	NA	NA	NA	NA	NA
WP_016211049.1|2456259_2457222_-	biotin synthase BioB	NA	NA	NA	NA	NA
WP_016211056.1|2457265_2458018_+	ComF family protein	NA	NA	NA	NA	NA
WP_032126362.1|2459553_2459919_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|2459864_2460440_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016210615.1|2461346_2461817_-	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	35.7	2.1e-19
WP_016210624.1|2461862_2462102_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036777984.1|2462120_2462570_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210617.1|2462790_2464215_+	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	M4QSA2	Synechococcus_phage	42.3	1.4e-16
WP_032126482.1|2464279_2465317_-	UDP-N-acetylmuramate dehydrogenase	NA	NA	NA	NA	NA
WP_051307334.1|2465595_2466375_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|2466391_2466967_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2466912_2467278_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556587.1|2467377_2468280_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210625.1|2468338_2469085_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.8	1.3e-18
WP_016210616.1|2469333_2472144_+	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
WP_036778141.1|2472414_2473239_+	HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_054300481.1|2473340_2474069_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	9.6e-43
WP_080664881.1|2474158_2474365_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_081007054.1|2474527_2475760_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.6	1.1e-27
WP_054300482.1|2476275_2477565_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300201.1|2477594_2478323_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	9.6e-43
WP_036780093.1|2478426_2479248_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_016211722.1|2479257_2482560_-	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	27.1	1.7e-54
WP_016211323.1|2483986_2485084_-	Fic family protein	NA	D7RWK9	Brochothrix_phage	28.3	1.0e-27
WP_016211325.1|2485073_2486594_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	38.9	7.3e-85
WP_016211322.1|2486656_2487247_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_054300483.1|2487782_2488337_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300484.1|2488833_2489781_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212568.1|2490005_2490155_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212659.1|2490299_2490545_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172673415.1|2490682_2490928_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212294.1|2491279_2491624_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036776735.1|2491637_2492090_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242937.1|2492086_2492305_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375841.1|2492611_2492821_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081007056.1|2493122_2493332_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212679.1|2494692_2495073_+|transposase	transposase zinc-binding domain-containing protein	transposase	NA	NA	NA	NA
WP_087910645.1|2495130_2496283_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	8.9e-59
WP_016212230.1|2496339_2497788_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126389.1|2499321_2499510_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046946.1|2500911_2501187_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_054300489.1|2501189_2501792_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	46.2	6.5e-37
2501252:2501860	attR	CATTTTCAATGCAGTTGTTTAAATACTTCACTCGCCTGAGTTTACACTGACTAGAAAAGACACCTTCATCTTTGGCTTTTTGGTGAGCGGGTGGAAATGAAGCGTGCTTGTCGACATTCACAACACGCGGTGATTTCACATAAGGTTGGGCGATTGCCTTTTTGAAAAAGCGCATCGCCGCTTTGGCATTTTGCTGTCGGCTGAGCATCCAGTCCAAAGTATGGCCATATTTATCAATGGCTCGATAAAGGTAATACCAACGACCTTTGATTTTCACCAACGTTTCATCTAACCGCCAAGAGGCACACGTTTGACGAAAGTGGGGCCTCAGCCGTTTGGCGATCTGCGAGCCATACTCGTGCACCCAGCGACAAATGGTTGAACGCTCAATCTCAAGACCTCTTTCAGCTGCTATTTCTTTGAGATCACGGTAAGATAAGGCATAGCGGCCATACCAACGCACCAGCCAAAGAATGATCTCACCGGAATAATGCTTCCATTTAAAGGGTTGATTCTTCTTAAATCGTTTACGTCTACCCACAGCAATTCACTCTTAACTTCCGTTGATTGCTACACCCTACTCAAATCTAAATTTTTTGCAACAGTGCC	NA	NA	NA	NA
>prophage 30
NZ_CP012413	Piscirickettsia salmonis strain PM15972A1 chromosome, complete genome	3062470	2505847	2627479	3062470	tRNA,transposase	Escherichia_phage(30.0%)	113	NA	NA
WP_032126790.1|2505847_2506753_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_155046944.1|2507223_2507361_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210068.1|2508547_2509123_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_036778086.1|2509198_2510074_-	6-carboxytetrahydropterin synthase	NA	A0A140B3P3	Vibrio_phage	24.0	8.0e-12
WP_016210054.1|2510138_2510660_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_036778088.1|2510644_2511727_-	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.5	2.0e-20
WP_036777829.1|2511967_2512372_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210073.1|2512796_2513528_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210076.1|2513784_2515086_+	inosine/guanosine kinase	NA	NA	NA	NA	NA
WP_016210066.1|2515227_2515896_+	Bax inhibitor-1 family protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	44.1	3.6e-28
WP_032126425.1|2516339_2516936_-	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_016210052.1|2516956_2518153_-|tRNA	tyrosine--tRNA ligase	tRNA	A0A2I2L594	Orpheovirus	24.4	8.2e-07
WP_016210064.1|2518277_2519642_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A088FRM7	Mycobacterium_phage	52.2	2.6e-17
WP_016210075.1|2519638_2520730_+	anhydro-N-acetylmuramic acid kinase	NA	NA	NA	NA	NA
WP_016210065.1|2520983_2521643_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210057.1|2521783_2522293_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126424.1|2522301_2523126_-	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_016210061.1|2523138_2523783_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	33.5	3.8e-19
WP_036778098.1|2523772_2524612_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	23.3	1.4e-08
WP_016210074.1|2524617_2525244_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_016210053.1|2525405_2525948_+	septation protein A	NA	NA	NA	NA	NA
WP_016210060.1|2526031_2526334_+	YciI family protein	NA	NA	NA	NA	NA
WP_032126423.1|2526330_2526594_+	BolA family transcriptional regulator	NA	NA	NA	NA	NA
WP_016210070.1|2526687_2526960_+	DUF1315 family protein	NA	NA	NA	NA	NA
WP_016210055.1|2526998_2527637_+	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_032126421.1|2527904_2528996_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_054300491.1|2529199_2530960_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210679.1|2531635_2533960_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	39.9	2.0e-17
WP_016210675.1|2534127_2534844_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210677.1|2534923_2535538_-	UbiX family flavin prenyltransferase	NA	NA	NA	NA	NA
WP_016210672.1|2535530_2536913_-	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_036778297.1|2536921_2537395_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210671.1|2537527_2538787_+	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_016210676.1|2539242_2541324_+	kinase domain protein	NA	NA	NA	NA	NA
WP_054300492.1|2541627_2542638_+	protein kinase	NA	NA	NA	NA	NA
WP_032126362.1|2543070_2543436_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|2543381_2543957_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016211905.1|2544287_2544698_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275117.1|2544941_2545364_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046943.1|2545396_2545537_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556490.1|2547306_2548193_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_129556590.1|2548876_2549272_+	SEC-C domain-containing protein	NA	NA	NA	NA	NA
WP_032126312.1|2549268_2550063_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_016211756.1|2550241_2550967_-	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_016211759.1|2551212_2552400_+	S-methyl-5-thioribose kinase	NA	NA	NA	NA	NA
WP_017375910.1|2552731_2553460_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_016212269.1|2553941_2554625_+	Fic family protein	NA	NA	NA	NA	NA
WP_016212268.1|2554628_2555213_+	recombinase family protein	NA	W6CWV1	Ralstonia_phage	38.0	5.9e-27
WP_017375910.1|2555369_2556098_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_155046942.1|2556483_2557369_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_075275277.1|2557702_2557942_-|transposase	transposase zinc-binding domain-containing protein	transposase	NA	NA	NA	NA
WP_017375910.1|2558302_2559031_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_162034404.1|2559710_2562992_+	autotransporter domain-containing protein	NA	NA	NA	NA	NA
WP_017375910.1|2563066_2563795_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_017375910.1|2564693_2565422_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_054300500.1|2565950_2566679_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	2.7e-45
WP_016212070.1|2567088_2567688_-	DUF1353 domain-containing protein	NA	NA	NA	NA	NA
WP_016212069.1|2567662_2567830_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212066.1|2568041_2568818_-	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
WP_054300501.1|2569178_2569907_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_032126794.1|2569918_2570311_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_016212477.1|2570307_2570553_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_054300502.1|2570725_2571403_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	30.8	2.9e-09
WP_054300500.1|2571432_2572161_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	2.7e-45
WP_155046941.1|2572832_2573096_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212146.1|2573497_2575237_+	PLD-like domain protein	NA	NA	NA	NA	NA
WP_129556452.1|2575239_2575587_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126799.1|2576707_2577520_+	DNA/RNA non-specific endonuclease	NA	NA	NA	NA	NA
WP_054300481.1|2577600_2578329_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	9.6e-43
WP_054300506.1|2578400_2578808_+	hypothetical protein	NA	NA	NA	NA	NA
WP_122941726.1|2579286_2580210_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210488.1|2580477_2580774_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210487.1|2580802_2581048_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210475.1|2581349_2581898_-	DUF2058 family protein	NA	NA	NA	NA	NA
WP_032126625.1|2582001_2582574_-	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_016210486.1|2582781_2583540_+	oxidoreductase NAD-binding domain protein	NA	NA	NA	NA	NA
WP_016210484.1|2584088_2585846_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210482.1|2586055_2587633_+	FMN-binding glutamate synthase family protein	NA	NA	NA	NA	NA
WP_016210485.1|2587765_2588707_+	hypothetical protein	NA	A0A068C8G6	Acinetobacter_phage	26.5	2.3e-20
WP_016210472.1|2588708_2589482_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172673422.1|2589523_2590201_-	acid phosphatase AphA	NA	NA	NA	NA	NA
WP_054300507.1|2590452_2591742_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273615.1|2592226_2592325_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300271.1|2593225_2594200_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_054300509.1|2594324_2594522_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052133265.1|2594666_2595143_+	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_016211707.1|2595414_2595702_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	33.7	3.0e-08
WP_036777440.1|2595707_2598089_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_016211706.1|2598101_2599097_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	37.4	2.5e-33
WP_016210495.1|2599516_2599876_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_016210493.1|2599918_2600113_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_075273353.1|2600147_2600678_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.9	4.7e-15
WP_016210489.1|2600682_2602614_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	36.5	2.3e-120
WP_016210496.1|2603492_2604887_+	capsule polysaccharide biosynthesis family protein	NA	NA	NA	NA	NA
WP_016210494.1|2604953_2606003_-	pseudaminic acid synthase	NA	NA	NA	NA	NA
WP_016210500.1|2606023_2607514_-	UDP-2,4-diacetamido-2,4, 6-trideoxy-beta-L-altropyranose hydrolase	NA	NA	NA	NA	NA
WP_016210502.1|2607648_2608344_-	pseudaminic acid cytidylyltransferase	NA	A0A1B1IVD3	uncultured_Mediterranean_phage	35.5	1.5e-08
WP_032126129.1|2608340_2609501_-	UDP-4-amino-4, 6-dideoxy-N-acetyl-beta-L-altrosamine transaminase	NA	A0A2D2W2B8	Stenotrophomonas_phage	28.6	1.3e-14
WP_016210501.1|2609497_2610484_-	UDP-N-acetylglucosamine 4,6-dehydratase (inverting)	NA	K7Y9E1	Megavirus	34.2	4.9e-42
WP_032126128.1|2610501_2611908_-	capsule biosynthesis protein	NA	NA	NA	NA	NA
WP_032126362.1|2612824_2613190_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300510.1|2613246_2613429_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300511.1|2613699_2613999_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016210649.1|2614620_2616609_-	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_016210650.1|2616686_2617871_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_054300512.1|2617976_2619086_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_129556624.1|2619417_2620404_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_016210645.1|2620469_2622047_-	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_032126123.1|2622058_2623024_-	elongation factor P--(R)-beta-lysine ligase	NA	A0A1V0SAC0	Catovirus	25.3	2.8e-21
WP_016210643.1|2623165_2623735_-	elongation factor P	NA	NA	NA	NA	NA
WP_051307335.1|2623783_2624818_+	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
WP_032126126.1|2624839_2626396_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	24.9	3.0e-09
WP_054300513.1|2626615_2627479_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 31
NZ_CP012413	Piscirickettsia salmonis strain PM15972A1 chromosome, complete genome	3062470	2711175	2839135	3062470	tRNA,transposase,tail	Acinetobacter_phage(35.71%)	116	NA	NA
WP_155046938.1|2711175_2711751_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300520.1|2711791_2712106_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273359.1|2712051_2712627_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016211797.1|2712677_2714081_-	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_054300521.1|2714242_2715301_-	acyl-CoA/acyl-ACP dehydrogenase	NA	NA	NA	NA	NA
WP_016211795.1|2715986_2716181_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036794771.1|2716318_2717305_-	APC family permease	NA	NA	NA	NA	NA
WP_016212044.1|2718027_2718282_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155049101.1|2720349_2721591_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210130.1|2721902_2722193_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_036777805.1|2722369_2723608_+	MFS transporter	NA	NA	NA	NA	NA
WP_016210137.1|2723834_2724386_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162034403.1|2724408_2725116_+	queuosine precursor transporter	NA	A0A1W7AG82	Streptococcus_virus	30.4	3.7e-15
WP_016210141.1|2725149_2726448_+	MFS transporter	NA	NA	NA	NA	NA
WP_032126493.1|2726537_2727764_-	cysteine desulfurase-like protein	NA	NA	NA	NA	NA
WP_016210136.1|2728013_2728361_+	DUF4286 family protein	NA	NA	NA	NA	NA
WP_016210121.1|2728361_2730134_-	single-stranded-DNA-specific exonuclease RecJ	NA	NA	NA	NA	NA
WP_032126492.1|2730123_2731098_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210122.1|2731724_2732417_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210140.1|2733258_2733636_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300523.1|2733652_2734675_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036777812.1|2734709_2736137_-	amino acid permease	NA	NA	NA	NA	NA
WP_129556442.1|2736850_2739223_-	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	35.3	2.8e-160
WP_016210132.1|2739295_2740114_+	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_016210128.1|2740480_2740744_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210127.1|2740837_2741863_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273298.1|2741915_2742491_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155046705.1|2742436_2742604_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300397.1|2742844_2743090_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016212130.1|2743284_2743461_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126495.1|2743495_2744380_-	N-acetylneuraminate lyase	NA	NA	NA	NA	NA
WP_016212128.1|2744470_2745217_-	solute symporter family protein	NA	NA	NA	NA	NA
WP_016210870.1|2746130_2746922_-	3-hydroxybutyrate dehydrogenase	NA	NA	NA	NA	NA
WP_016210862.1|2747073_2747319_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210861.1|2747470_2747701_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210859.1|2747726_2748506_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_016210868.1|2748537_2748837_-	pilZ domain protein	NA	NA	NA	NA	NA
WP_032126490.1|2748833_2749799_-	DNA polymerase III subunit delta'	NA	NA	NA	NA	NA
WP_016210864.1|2750075_2751374_+	MFS transporter	NA	NA	NA	NA	NA
WP_105962623.1|2754424_2755578_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_016212102.1|2757088_2758729_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211029.1|2758902_2759265_-	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	50.5	7.6e-25
WP_016211023.1|2759478_2759913_+	protoporphyrinogen oxidase HemJ	NA	NA	NA	NA	NA
WP_016211034.1|2759923_2760103_-	rubredoxin	NA	NA	NA	NA	NA
WP_032126377.1|2760219_2761221_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211033.1|2761386_2762679_+	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_016211032.1|2762790_2763588_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211031.1|2763897_2764377_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300525.1|2764541_2766629_-	serine/threonine protein kinase	NA	A0A2H4UVE2	Bodo_saltans_virus	28.0	4.0e-17
WP_075273367.1|2766637_2767414_-	serine/threonine-protein phosphatase	NA	NA	NA	NA	NA
WP_016211026.1|2767706_2768111_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_172673417.1|2768227_2768374_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273369.1|2768927_2769743_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211607.1|2769925_2770150_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211606.1|2770178_2770709_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_016211605.1|2770925_2771159_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300527.1|2771272_2773459_-	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	45.0	3.5e-141
WP_016211609.1|2773491_2773800_-	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_032126362.1|2774670_2775036_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273371.1|2774981_2775557_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016210634.1|2775807_2776539_-|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	NA	NA	NA	NA
WP_016210629.1|2776535_2777072_-	tim44-like domain protein	NA	NA	NA	NA	NA
WP_032126367.1|2777125_2777890_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_016210636.1|2777893_2779471_-	peptide chain release factor 3	NA	A0A2K9L6L3	Tupanvirus	31.4	3.6e-10
WP_016210637.1|2779477_2779954_-	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_129556439.1|2779929_2780385_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210633.1|2780390_2781146_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_016210632.1|2781320_2781608_+	DUF3579 domain-containing protein	NA	NA	NA	NA	NA
WP_016210640.1|2781993_2782218_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036779423.1|2782682_2783846_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_032126366.1|2783884_2784862_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126365.1|2784855_2785509_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_016210630.1|2785480_2786596_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300529.1|2786876_2787278_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046937.1|2787449_2788335_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155046703.1|2788339_2788477_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126861.1|2788670_2788985_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105962623.1|2791092_2792246_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_155046935.1|2792538_2792961_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105962623.1|2793002_2794156_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_054300162.1|2795658_2796741_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_162034402.1|2796828_2796966_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046934.1|2797114_2797285_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|2797648_2798710_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211359.1|2798762_2799167_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211354.1|2799696_2801658_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211355.1|2801755_2802865_+	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	29.8	2.9e-35
WP_016211357.1|2802927_2804409_-	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.3	6.3e-49
WP_016211358.1|2804832_2805294_+	DUF1499 domain-containing protein	NA	NA	NA	NA	NA
WP_054300534.1|2805341_2805542_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300535.1|2805686_2806406_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075273371.1|2806409_2806985_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2806930_2807296_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211800.1|2807992_2808778_-	type III pantothenate kinase	NA	NA	NA	NA	NA
WP_036778206.1|2808774_2809758_-	biotin--[acetyl-CoA-carboxylase] ligase	NA	NA	NA	NA	NA
WP_016211802.1|2809814_2811086_-	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_155046933.1|2816518_2817196_-	paraquat-inducible protein A	NA	NA	NA	NA	NA
WP_016210096.1|2817469_2818831_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_016210097.1|2819104_2820385_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_054300536.1|2820402_2821059_+	DedA family protein	NA	NA	NA	NA	NA
WP_016210082.1|2821109_2822159_+	nitronate monooxygenase	NA	NA	NA	NA	NA
WP_016210083.1|2822313_2823168_+	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
WP_122940784.1|2823472_2824279_+	trfA family protein	NA	NA	NA	NA	NA
WP_016210080.1|2824385_2824679_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_016210084.1|2824838_2825675_-	D-methionine-binding lipoprotein metQ	NA	NA	NA	NA	NA
WP_032126605.1|2825664_2826342_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_016210086.1|2826310_2827366_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	34.2	4.3e-28
WP_016210077.1|2827698_2829129_-	exodeoxyribonuclease I	NA	NA	NA	NA	NA
WP_016210094.1|2829115_2829742_-	DUF938 domain-containing protein	NA	NA	NA	NA	NA
WP_016210081.1|2829747_2830020_-	DUF615 domain-containing protein	NA	NA	NA	NA	NA
WP_016210093.1|2830105_2831899_-	aminopeptidase P family protein	NA	A0A0P0I8D7	Acinetobacter_phage	41.3	2.6e-118
WP_080664831.1|2832214_2833777_+	APC family permease	NA	NA	NA	NA	NA
WP_016210095.1|2833879_2834575_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_016210079.1|2834745_2835243_+	purine-binding chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_032126362.1|2838248_2838614_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|2838559_2839135_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 32
NZ_CP012413	Piscirickettsia salmonis strain PM15972A1 chromosome, complete genome	3062470	2860877	2907425	3062470	protease,transposase	Ostreococcus_lucimarinus_virus(50.0%)	52	NA	NA
WP_016209871.1|2860877_2862860_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	G9E4U6	Ostreococcus_lucimarinus_virus	40.9	3.9e-115
WP_016209868.1|2862937_2863564_-	23S rRNA (uridine(2552)-2'-O)-methyltransferase RlmE	NA	NA	NA	NA	NA
WP_016209873.1|2863541_2863799_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209853.1|2863853_2864297_+	YhbY family RNA-binding protein	NA	NA	NA	NA	NA
WP_016209863.1|2864537_2864960_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300538.1|2865012_2866080_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016210785.1|2867528_2868923_-	protein kinase family protein	NA	NA	NA	NA	NA
WP_052047085.1|2869186_2870527_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210776.1|2870851_2871289_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210789.1|2871764_2872343_+	TMEM165/GDT1 family protein	NA	NA	NA	NA	NA
WP_036779493.1|2872452_2873094_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_016210786.1|2873090_2873537_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210782.1|2873695_2874592_+	branched-chain amino acid transaminase	NA	NA	NA	NA	NA
WP_016210784.1|2874614_2875586_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_017377589.1|2875763_2876417_+	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_016210775.1|2876385_2876979_-	CDP-alcohol phosphatidyltransferase family protein	NA	NA	NA	NA	NA
WP_054300539.1|2877271_2878615_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300540.1|2879630_2879855_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212443.1|2880122_2880329_-	pyridoxine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
WP_032126362.1|2880458_2880824_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|2880769_2881345_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016211859.1|2881348_2881636_-	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
WP_016211858.1|2881712_2882471_-	ion transporter	NA	NA	NA	NA	NA
WP_032126848.1|2882689_2883490_-	carbonic anhydrase	NA	NA	NA	NA	NA
WP_054300541.1|2884023_2884803_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|2885130_2885496_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273371.1|2885441_2886017_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_129556686.1|2886250_2887132_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126790.1|2887562_2888468_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_054300542.1|2888493_2888730_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210225.1|2889410_2889689_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210244.1|2889862_2890084_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210239.1|2890055_2890940_+	formyltetrahydrofolate deformylase	NA	NA	NA	NA	NA
WP_080664837.1|2890970_2891114_+	lipoprotein	NA	NA	NA	NA	NA
WP_036778324.1|2891128_2891959_+	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_016210226.1|2891976_2892408_-	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_016210238.1|2892677_2893163_+	ProQ/FinO family protein	NA	NA	NA	NA	NA
WP_016210228.1|2893205_2895398_-	DNA helicase II	NA	A7KV33	Bacillus_phage	36.0	1.3e-106
WP_016210243.1|2895458_2895989_-	outer membrane family protein	NA	NA	NA	NA	NA
WP_016210242.1|2896073_2896412_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210231.1|2896499_2897942_-	D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase	NA	NA	NA	NA	NA
WP_054300543.1|2897969_2899406_-	D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase	NA	NA	NA	NA	NA
WP_016210247.1|2899410_2899662_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210236.1|2899705_2900422_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_016210233.1|2900740_2901163_+	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_032126724.1|2901252_2901510_+	glutaredoxin 3	NA	NA	NA	NA	NA
WP_016210237.1|2901601_2902096_+	protein-export chaperone SecB	NA	NA	NA	NA	NA
WP_016210246.1|2902127_2903123_+	NAD(P)-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_016210235.1|2903174_2904098_-	two pore domain potassium channel family protein	NA	NA	NA	NA	NA
WP_016210241.1|2904729_2905515_+	phenylalanine 4-monooxygenase	NA	NA	NA	NA	NA
WP_032126725.1|2905526_2906093_+	DUF1415 domain-containing protein	NA	NA	NA	NA	NA
WP_081007013.1|2907125_2907425_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 33
NZ_CP012413	Piscirickettsia salmonis strain PM15972A1 chromosome, complete genome	3062470	2972026	3005067	3062470	transposase	Streptococcus_phage(20.0%)	33	NA	NA
WP_054300546.1|2972026_2972623_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_054300362.1|2972617_2973142_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273383.1|2973394_2973967_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211250.1|2974122_2974335_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211251.1|2974654_2975278_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211247.1|2975382_2976171_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_016211245.1|2976170_2976902_-	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_054300547.1|2976941_2978663_-	NAD-dependent malic enzyme	NA	NA	NA	NA	NA
WP_017376242.1|2978676_2979738_-	uroporphyrinogen decarboxylase	NA	NA	NA	NA	NA
WP_016211248.1|2980038_2981253_+	aromatic amino acid transport family protein	NA	NA	NA	NA	NA
WP_032126486.1|2981382_2981613_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|2981662_2982724_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211108.1|2982718_2983087_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126370.1|2983416_2984241_-	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	35.5	5.4e-26
WP_016211103.1|2984251_2984950_-	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_016211109.1|2984992_2985739_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211105.1|2985731_2986154_-	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_032126371.1|2986280_2986832_-	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_016211100.1|2986887_2987838_-	TonB family protein	NA	NA	NA	NA	NA
WP_032126369.1|2987838_2988066_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036777711.1|2988255_2989065_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211097.1|2989044_2989887_-	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_016211099.1|2989883_2991128_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210706.1|2991266_2992355_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_016210697.1|2992372_2992873_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	41.2	1.0e-19
WP_032126484.1|2993060_2993660_+	RdgB/HAM1 family non-canonical purine NTP pyrophosphatase	NA	NA	NA	NA	NA
WP_016210700.1|2993665_2994829_+	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_016210703.1|2994860_2995814_+	glutathione synthase	NA	NA	NA	NA	NA
WP_016210701.1|2996169_2997234_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_016210702.1|2997230_3000293_+	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	22.9	1.2e-62
WP_017377700.1|3003788_3004082_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	6.4e-06
WP_081007062.1|3004198_3004528_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.0	7.7e-08
WP_075273327.1|3004491_3005067_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP012417	Piscirickettsia salmonis strain PM15972A1 plasmid pPSA1-4, complete sequence	31951	1711	7132	31951	transposase,tail,head	Staphylococcus_phage(33.33%)	8	NA	NA
WP_016211139.1|1711_2107_-	HK97 gp10 family phage protein	NA	Q7Y404	Yersinia_phage	40.7	2.1e-07
WP_016211132.1|2099_2423_-|head	phage head closure protein	head	A0A1W6JP44	Morganella_phage	39.8	5.0e-12
WP_016211137.1|2419_2731_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4J711	uncultured_Caudovirales_phage	34.7	1.1e-08
WP_016211131.1|2727_2883_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211133.1|2921_4256_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300680.1|4701_5382_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.0	1.0e-09
WP_155046942.1|5408_6294_+|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	22.8	2.6e-10
WP_054300681.1|6631_7132_-	hypothetical protein	NA	A0A1W6JQ30	Staphylococcus_phage	42.7	8.1e-17
