The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP012508	Piscirickettsia salmonis strain PM32597B1 chromosome, complete genome	3186149	3091	61662	3186149	transposase,tRNA	Escherichia_phage(28.57%)	54	NA	NA
WP_017378478.1|3091_4471_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE	tRNA	NA	NA	NA	NA
WP_017378479.1|4585_6478_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
WP_017378480.1|6525_7152_+	16S rRNA (guanine(527)-N(7))-methyltransferase RsmG	NA	NA	NA	NA	NA
WP_017378481.1|7171_8056_+	ParA family protein	NA	Q8JL10	Natrialba_phage	28.4	5.8e-18
WP_027242747.1|8088_8979_+	ParB/RepB/Spo0J family partition protein	NA	I3NLC2	Bifidobacterium_phage	31.8	6.7e-14
WP_017378483.1|9093_9492_+	ATP synthase subunit I	NA	NA	NA	NA	NA
WP_017378484.1|9496_10312_+	F0F1 ATP synthase subunit A	NA	NA	NA	NA	NA
WP_016209328.1|10363_10768_+	F0F1 ATP synthase subunit C	NA	NA	NA	NA	NA
WP_017378485.1|10822_11293_+	F0F1 ATP synthase subunit B	NA	NA	NA	NA	NA
WP_017378486.1|11304_11832_+	F0F1 ATP synthase subunit delta	NA	NA	NA	NA	NA
WP_017378487.1|11848_13390_+	F0F1 ATP synthase subunit alpha	NA	NA	NA	NA	NA
WP_027242748.1|13415_14276_+	F0F1 ATP synthase subunit gamma	NA	NA	NA	NA	NA
WP_016209339.1|14306_15698_+	F0F1 ATP synthase subunit beta	NA	NA	NA	NA	NA
WP_017378489.1|15722_16151_+	F0F1 ATP synthase subunit epsilon	NA	NA	NA	NA	NA
WP_027242749.1|16244_17609_+	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	40.9	3.9e-37
WP_027242750.1|17665_19501_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	43.7	5.8e-121
WP_036773290.1|19614_20343_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.2	2.3e-44
WP_027242751.1|20869_22411_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378498.1|22677_23334_-	2OG-Fe dioxygenase family protein	NA	NA	NA	NA	NA
WP_075275376.1|25205_25958_-	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_017376303.1|26016_26730_-	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	36.0	2.2e-28
WP_027242752.1|26921_27554_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|29288_30692_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155046628.1|30688_30913_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771332.1|30992_31967_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	7.3e-30
WP_036815787.1|31986_32304_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376724.1|32381_32594_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026063559.1|32840_33260_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_036816796.1|33357_33804_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242563.1|34148_35147_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051929590.1|35179_35533_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051929591.1|35577_35850_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376728.1|36246_37665_-	MFS transporter	NA	NA	NA	NA	NA
WP_017376729.1|37891_38833_+	ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_026063560.1|38867_40847_+	cytochrome o ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_027242562.1|40843_41449_+	cytochrome c oxidase subunit 3	NA	NA	NA	NA	NA
WP_016211294.1|41450_41792_+	prokaryotic cytochrome C oxidase subunit IV family protein	NA	NA	NA	NA	NA
WP_027242561.1|41792_42629_+	protoheme IX farnesyltransferase	NA	NA	NA	NA	NA
WP_080963573.1|42794_43112_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_027242560.1|43189_44611_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_017376735.1|44607_45303_-	TVP38/TMEM64 family protein	NA	NA	NA	NA	NA
WP_144420744.1|46777_47623_+	proline iminopeptidase-family hydrolase	NA	NA	NA	NA	NA
WP_017376738.1|47632_47971_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876080.1|48539_49943_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048876181.1|50056_50920_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048876079.1|51905_52955_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075275379.1|53109_53328_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|53647_55051_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048876179.1|55061_55619_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036772663.1|55615_56491_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376269.1|56715_57006_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772645.1|59629_60403_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_027243066.1|60821_61178_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_144420745.1|61209_61662_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP012508	Piscirickettsia salmonis strain PM32597B1 chromosome, complete genome	3186149	191889	322697	3186149	tail,transposase,protease,tRNA	Acinetobacter_phage(11.76%)	113	NA	NA
WP_017377604.1|191889_193872_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	G9E4U6	Ostreococcus_lucimarinus_virus	41.1	1.0e-115
WP_017377605.1|194081_195425_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_017377606.1|195691_198361_+	pyruvate dehydrogenase (acetyl-transferring), homodimeric type	NA	NA	NA	NA	NA
WP_017377607.1|198384_200301_+	dihydrolipoyllysine-residue acetyltransferase	NA	NA	NA	NA	NA
WP_026063653.1|200470_201892_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	28.1	3.1e-45
WP_017377609.1|202036_203011_+	phospholipase A	NA	NA	NA	NA	NA
WP_027242692.1|203020_203320_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377612.1|203437_203659_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377613.1|203822_205484_-	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	64.5	7.7e-181
WP_016209850.1|205556_205847_-	co-chaperone GroES	NA	A0A221S322	uncultured_virus	42.6	3.3e-15
WP_017377614.1|206073_206529_+	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_017377615.1|206593_207058_+	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_027242691.1|207149_208496_+	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_017377618.1|208495_209401_+	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_017377619.1|209462_210449_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_016209851.1|210441_210684_+	Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_017377620.1|210802_212347_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	46.9	1.6e-63
WP_017377621.1|212393_213680_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_017377622.1|213722_215126_+	aminopeptidase P family protein	NA	NA	NA	NA	NA
WP_144420750.1|215130_217668_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_144420593.1|218064_218313_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080963589.1|218244_218706_-	purine-binding chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_017377624.1|219200_219896_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_080963590.1|219997_221560_-	APC family permease	NA	NA	NA	NA	NA
WP_017377626.1|221887_223681_+	aminopeptidase P family protein	NA	A0A0P0I8D7	Acinetobacter_phage	41.0	2.2e-117
WP_017377627.1|223767_224040_+	DUF615 domain-containing protein	NA	NA	NA	NA	NA
WP_017377628.1|224045_224672_+	DUF938 domain-containing protein	NA	NA	NA	NA	NA
WP_017377629.1|224658_226089_+	exodeoxyribonuclease I	NA	NA	NA	NA	NA
WP_017377630.1|226410_227466_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	34.7	5.1e-29
WP_017377631.1|227434_228112_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_017377632.1|228101_228950_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210080.1|229095_229389_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_036772063.1|229500_230313_-	trfA family protein	NA	NA	NA	NA	NA
WP_017377635.1|230611_231466_-	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
WP_017377636.1|231619_232669_-	nitronate monooxygenase	NA	NA	NA	NA	NA
WP_036772068.1|232714_233371_-	DedA family protein	NA	NA	NA	NA	NA
WP_017377638.1|233388_234669_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_017377639.1|234942_236304_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_036772069.1|236364_236916_+	paraquat-inducible protein A	NA	NA	NA	NA	NA
WP_017376225.1|242346_243618_+	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_017376226.1|243674_244658_+	biotin--[acetyl-CoA-carboxylase] ligase	NA	NA	NA	NA	NA
WP_027243088.1|244654_245440_+	type III pantothenate kinase	NA	NA	NA	NA	NA
WP_017376227.1|245747_246197_-	DUF1499 domain-containing protein	NA	NA	NA	NA	NA
WP_048876031.1|246290_247694_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376228.1|248131_249613_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.8	5.3e-48
WP_017376229.1|249668_250778_-	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	29.8	1.7e-35
WP_017376230.1|250885_251053_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376234.1|252350_252563_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_027243087.1|252603_253299_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275260.1|253562_255773_-	signal recognition particle-docking protein FtsY	NA	NA	NA	NA	NA
WP_017376236.1|255975_256542_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243085.1|256699_257260_+	YbfB/YjiJ family MFS transporter	NA	NA	NA	NA	NA
WP_053856766.1|257379_258783_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875886.1|258779_259136_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_017376838.1|259391_260216_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243084.1|260913_261438_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773116.1|261723_262698_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_027243083.1|262797_263349_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275261.1|263461_263974_-	YbfB/YjiJ family MFS transporter	NA	NA	NA	NA	NA
WP_144420594.1|264366_265824_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420595.1|265937_266417_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376842.1|266654_267260_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376843.1|267539_268655_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376844.1|268626_269280_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_027243079.1|269273_270251_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376846.1|270285_271449_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_027243078.1|271788_272013_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210632.1|272395_272683_-	DUF3579 domain-containing protein	NA	NA	NA	NA	NA
WP_017376847.1|272857_273613_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_036774056.1|273645_274077_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376849.1|274052_274529_+	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_017376850.1|274535_276113_+	peptide chain release factor 3	NA	A0A2K9L6L3	Tupanvirus	31.4	3.6e-10
WP_017376851.1|276115_276880_+	TatD family hydrolase	NA	NA	NA	NA	NA
WP_017376852.1|276933_277470_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376853.1|277466_278198_+|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	NA	NA	NA	NA
WP_027243077.1|278422_279184_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875887.1|279509_280385_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017378284.1|281787_281943_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963635.1|282136_283846_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_017375924.1|284499_284808_+	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_017375923.1|284840_287018_+	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	44.9	3.5e-141
WP_017375921.1|288186_288420_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375920.1|288654_289185_+	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_017375919.1|289189_289903_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_144420751.1|290530_291256_+	protein phosphatase 2C domain-containing protein	NA	NA	NA	NA	NA
WP_048875888.1|291264_293328_+	serine/threonine protein kinase	NA	A0A2H4UVE2	Bodo_saltans_virus	28.0	3.9e-17
WP_027243033.1|293507_293987_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062312049.1|294479_295847_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376531.1|296238_297036_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243034.1|297147_298437_-	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_144420597.1|298617_299604_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376534.1|299720_299900_+	rubredoxin	NA	NA	NA	NA	NA
WP_017376535.1|299911_300343_-	protoporphyrinogen oxidase HemJ	NA	NA	NA	NA	NA
WP_017376536.1|300555_300915_+	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	50.5	4.4e-25
WP_017376537.1|301084_302710_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080999962.1|303433_304861_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376538.1|305154_306336_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243035.1|308938_310237_-	MFS transporter	NA	NA	NA	NA	NA
WP_144420752.1|310592_311486_+	DNA polymerase III subunit delta'	NA	S5WKH4	Pseudomonas_phage	33.8	2.3e-14
WP_047927468.1|311482_311788_+	pilus assembly protein PilZ	NA	NA	NA	NA	NA
WP_017376543.1|311813_312593_+	TatD family hydrolase	NA	NA	NA	NA	NA
WP_144420598.1|312622_312853_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210862.1|313004_313250_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376547.1|313436_314228_+	3-hydroxybutyrate dehydrogenase	NA	NA	NA	NA	NA
WP_017376548.1|314927_315650_+	putative N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_017376549.1|315646_316528_+	ROK family protein	NA	NA	NA	NA	NA
WP_027243038.1|316551_318042_+	sodium:solute symporter	NA	A0A219Y9P9	Aeromonas_phage	23.8	8.0e-20
WP_027243039.1|318131_319019_+	N-acetylneuraminate lyase	NA	NA	NA	NA	NA
WP_016212130.1|319053_319230_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376551.1|319691_320183_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375625.1|320187_320415_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773116.1|320507_321482_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_069971669.1|321458_322697_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP012508	Piscirickettsia salmonis strain PM32597B1 chromosome, complete genome	3186149	330663	384077	3186149	transposase	Staphylococcus_phage(57.14%)	49	NA	NA
WP_053856767.1|330663_332067_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420600.1|332172_332358_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053856766.1|333056_334460_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_080999963.1|334550_335054_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771639.1|335093_336068_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_017376774.1|336064_336634_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	40.3	4.5e-32
WP_017376776.1|337120_337813_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420601.1|338420_339413_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376778.1|339402_341175_+	single-stranded-DNA-specific exonuclease RecJ	NA	NA	NA	NA	NA
WP_080963634.1|341175_341364_-	DUF4286 family protein	NA	NA	NA	NA	NA
WP_036774259.1|341401_342376_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_036815640.1|342434_342629_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375625.1|342695_342923_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069971671.1|343052_343928_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_155046623.1|344155_344305_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420602.1|344296_344563_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420603.1|344707_345607_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046619.1|345693_345951_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171824205.1|346551_347790_+	cysteine desulfurase-like protein	NA	NA	NA	NA	NA
WP_027243074.1|347879_348419_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243073.1|348540_349179_-	MFS transporter	NA	NA	NA	NA	NA
WP_075275265.1|349212_349701_-	VUT family protein	NA	NA	NA	NA	NA
WP_162038645.1|349947_350094_-	VUT family protein	NA	NA	NA	NA	NA
WP_036772686.1|350230_350719_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243072.1|351289_352528_-	MFS transporter	NA	NA	NA	NA	NA
WP_017378171.1|352704_352995_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_144420605.1|353033_355688_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243070.1|356401_356656_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026063658.1|356965_357694_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	1.3e-44
WP_017377650.1|358464_359649_+	fatty acid desaturase	NA	NA	NA	NA	NA
WP_017377649.1|359667_360612_-	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_027243069.1|360917_361703_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377647.1|361816_362185_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377646.1|362413_363991_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_144420753.1|364774_369199_+	autotransporter domain-containing protein	NA	NA	NA	NA	NA
WP_065653746.1|369335_370859_+	methyltransferase regulatory domain-containing protein	NA	NA	NA	NA	NA
WP_017377643.1|371063_371291_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377642.1|371435_371693_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772743.1|372260_373232_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_080999964.1|373156_373396_-|transposase	transposase zinc-binding domain-containing protein	transposase	NA	NA	NA	NA
WP_036772729.1|373528_373750_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|373869_374844_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_036771744.1|374897_375869_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771639.1|375948_376923_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_027242739.1|377283_379953_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	24.5	5.5e-19
WP_036774478.1|380123_381005_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378307.1|381015_381672_-	CoA transferase subunit B	NA	NA	NA	NA	NA
WP_017378308.1|381738_382443_-	CoA transferase subunit A	NA	NA	NA	NA	NA
WP_048876031.1|382673_384077_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP012508	Piscirickettsia salmonis strain PM32597B1 chromosome, complete genome	3186149	441074	563458	3186149	transposase,tRNA	Staphylococcus_phage(24.14%)	108	NA	NA
WP_048875895.1|441074_442238_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	32.0	3.8e-25
WP_144420756.1|442291_443293_-	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
WP_017378362.1|443374_443944_+	elongation factor P	NA	NA	NA	NA	NA
WP_017378363.1|444163_445129_+	elongation factor P--(R)-beta-lysine ligase	NA	A0A1V0SAC0	Catovirus	25.9	7.2e-22
WP_017378364.1|445140_446736_+	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_036772406.1|446756_447788_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_017378367.1|448119_449223_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_017378368.1|449334_450519_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_017378369.1|450596_452585_+	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_144420609.1|453744_455118_+	capsule biosynthesis protein	NA	NA	NA	NA	NA
WP_017378374.1|455135_456122_+	UDP-N-acetylglucosamine 4,6-dehydratase (inverting)	NA	K7Y9E1	Megavirus	34.2	2.2e-42
WP_080963622.1|456124_457279_+	UDP-4-amino-4, 6-dideoxy-N-acetyl-beta-L-altrosamine transaminase	NA	A0A2D2W2B8	Stenotrophomonas_phage	28.2	2.3e-14
WP_017378376.1|457275_457971_+	pseudaminic acid cytidylyltransferase	NA	A0A1B1IVD3	uncultured_Mediterranean_phage	32.3	8.6e-09
WP_017378377.1|458113_459604_+	UDP-2,4-diacetamido-2,4, 6-trideoxy-beta-L-altropyranose hydrolase	NA	NA	NA	NA	NA
WP_017378378.1|459624_460674_+	pseudaminic acid synthase	NA	NA	NA	NA	NA
WP_027242727.1|460740_462135_-	capsule biosynthesis protein	NA	NA	NA	NA	NA
WP_017378381.1|463067_464999_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	36.0	3.1e-117
WP_075273353.1|465003_465534_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.9	4.7e-15
WP_017378382.1|465568_465763_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_016210495.1|465805_466165_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_017378383.1|466296_467292_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2I2L4E3	Orpheovirus	36.5	3.2e-33
WP_017378384.1|467304_469686_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_016211707.1|469691_469979_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	33.7	3.0e-08
WP_080963621.1|470245_470452_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_017378388.1|472060_472834_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378389.1|472835_473777_-	hypothetical protein	NA	A0A068C8G6	Acinetobacter_phage	26.5	1.7e-20
WP_017378390.1|473910_475488_-	FMN-binding glutamate synthase family protein	NA	NA	NA	NA	NA
WP_017378391.1|475681_476638_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378393.1|477080_477287_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875897.1|478091_478736_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.2	2.7e-09
WP_069971672.1|478803_480060_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376600.1|480315_480495_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927402.1|480717_480945_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377704.1|482220_482979_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420757.1|483196_483760_+	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_017377702.1|483863_484412_+	DUF2058 family protein	NA	NA	NA	NA	NA
WP_157894716.1|484869_485007_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087910634.1|485008_486161_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.5	2.3e-59
WP_017377698.1|486506_486803_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420758.1|487062_487974_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377696.1|488208_488748_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146619481.1|489260_489857_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046620.1|489910_490048_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377694.1|490294_491023_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_017377686.1|491069_491678_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210764.1|492952_493213_-	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_017377283.1|493386_494925_+	murein biosynthesis integral membrane protein MurJ	NA	NA	NA	NA	NA
WP_017377282.1|495103_496030_+	bifunctional riboflavin kinase/FAD synthetase	NA	A0A1V0SJE1	Klosneuvirus	34.5	1.6e-10
WP_048875900.1|496134_497067_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.8	9.4e-27
WP_017377279.1|497563_500377_+|tRNA	isoleucine--tRNA ligase	tRNA	K7YVP8	Megavirus	26.8	1.0e-76
WP_017377278.1|500369_500879_+	lipoprotein signal peptidase	NA	NA	NA	NA	NA
WP_017377277.1|500882_501326_+	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_027243089.1|501421_502723_-	MFS transporter	NA	NA	NA	NA	NA
WP_017377276.1|502985_503354_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377275.1|503345_504068_-	aquaporin family protein	NA	M1H9L8	Acanthocystis_turfacea_Chlorella_virus	37.6	1.6e-26
WP_155052690.1|505150_506482_+	PAS domain-containing protein	NA	A0A1B0V854	Salmonella_phage	45.7	2.4e-36
WP_144420611.1|506514_506715_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875901.1|507249_508224_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.6	6.2e-29
WP_017377271.1|508634_508964_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377270.1|509349_509715_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377269.1|509838_510699_+	DUF692 domain-containing protein	NA	NA	NA	NA	NA
WP_017377268.1|510685_511465_+	putative DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_017377267.1|511540_512212_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_036771941.1|512384_512990_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377265.1|513206_513710_+	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_017377264.1|513911_514166_+	DUF2282 domain-containing protein	NA	NA	NA	NA	NA
WP_017377263.1|514667_515135_+	DoxX family protein	NA	NA	NA	NA	NA
WP_036771922.1|515701_516892_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|517726_519130_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_075275269.1|519436_520057_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048875903.1|520236_521211_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.6	6.2e-29
WP_017376501.1|521376_521643_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_144420759.1|521639_522140_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_048875904.1|522260_523136_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017375999.1|524795_525326_-	transcriptional repressor	NA	NA	NA	NA	NA
WP_017376000.1|525325_525850_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	58.4	1.5e-50
WP_017376001.1|526012_527128_-	DSD1 family PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_017376003.1|527364_528525_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	58.7	2.8e-121
WP_017376004.1|528976_530980_+	transketolase	NA	NA	NA	NA	NA
WP_017376005.1|531048_532056_+	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_017376006.1|532129_533314_+	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_017376007.1|533323_534778_+	pyruvate kinase	NA	NA	NA	NA	NA
WP_017376008.1|534808_535846_+	fructose-bisphosphate aldolase class II	NA	NA	NA	NA	NA
WP_017376009.1|536168_536459_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|537813_538788_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_155046691.1|538987_539584_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377794.1|540107_540359_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377795.1|540563_541727_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169834761.1|541749_542472_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_017377798.1|542586_543237_-	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_017377799.1|543337_543997_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875907.1|546058_546820_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377800.1|547238_547499_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377801.1|547584_548247_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_017377802.1|548363_549491_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377803.1|549866_550028_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420613.1|552159_552531_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243006.1|552810_554052_+	protein kinase family protein	NA	NA	NA	NA	NA
WP_075275272.1|554189_554420_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377811.1|554553_555438_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243005.1|555466_556093_-	ribonuclease T	NA	NA	NA	NA	NA
WP_036773165.1|556123_557323_-	Bcr/CflA family efflux MFS transporter	NA	NA	NA	NA	NA
WP_144420614.1|557561_558659_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	43.1	1.1e-05
WP_017377815.1|558812_560351_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.5	3.5e-87
WP_017375632.1|560671_561007_-|transposase	transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	51.5	2.3e-23
WP_171824212.1|561253_561862_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.7	7.3e-28
WP_017377700.1|561819_562113_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	6.4e-06
WP_036773116.1|562483_563458_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
>prophage 5
NZ_CP012508	Piscirickettsia salmonis strain PM32597B1 chromosome, complete genome	3186149	571955	679071	3186149	transposase,protease,tRNA	Acinetobacter_phage(19.35%)	111	NA	NA
WP_017377821.1|571955_572486_-|protease	ATP-dependent zinc protease	protease	NA	NA	NA	NA
WP_162038649.1|572644_573800_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.0	4.4e-50
WP_048875857.1|574057_575032_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	2.8e-29
WP_048876031.1|575455_576859_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420615.1|576892_577681_-	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_017376557.1|577811_578507_-	ATP-binding cassette domain-containing protein	NA	W5SAS9	Pithovirus	27.4	1.2e-10
WP_017376558.1|579011_579518_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242585.1|579611_580169_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_080999966.1|580466_581816_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155046619.1|581902_582160_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376564.1|582227_582938_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376565.1|583082_583331_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376566.1|583785_585045_-	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_017376567.1|585177_585651_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376568.1|585659_587042_+	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_026063542.1|587034_587649_+	UbiX family flavin prenyltransferase	NA	NA	NA	NA	NA
WP_017376570.1|587728_588445_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376571.1|588619_590944_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	49.7	7.6e-25
WP_036771330.1|591110_592085_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_144420616.1|593248_594757_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376574.1|594928_596020_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_017376575.1|596052_596691_-	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_017376576.1|596729_597002_-	DUF1315 family protein	NA	NA	NA	NA	NA
WP_017376577.1|597100_597364_-	BolA family transcriptional regulator	NA	NA	NA	NA	NA
WP_017376578.1|597360_597663_-	YciI family protein	NA	NA	NA	NA	NA
WP_017376579.1|597746_598289_-	septation protein A	NA	NA	NA	NA	NA
WP_016210074.1|598449_599076_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_017376580.1|599081_599921_+	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	24.2	4.2e-10
WP_017376581.1|599910_600561_+	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	33.5	3.9e-19
WP_026063543.1|600564_601398_+	pseudouridine synthase	NA	NA	NA	NA	NA
WP_017376583.1|601487_602615_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157894717.1|602881_603010_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047927249.1|603141_603336_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376585.1|603528_604179_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376586.1|604433_605525_-	anhydro-N-acetylmuramic acid kinase	NA	NA	NA	NA	NA
WP_017376587.1|605521_606886_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A088FRM7	Mycobacterium_phage	52.2	2.6e-17
WP_017376588.1|607010_608207_+|tRNA	tyrosine--tRNA ligase	tRNA	A0A2I2L594	Orpheovirus	24.8	2.8e-07
WP_144420764.1|608263_608827_+	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_017376590.1|609759_610428_-	Bax inhibitor-1 family protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	44.1	4.7e-28
WP_017376591.1|610574_611876_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376593.1|613366_613771_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243040.1|614004_615087_+	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.2	1.4e-18
WP_017376596.1|615071_615692_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_017376597.1|615756_616632_+	6-carboxytetrahydropterin synthase	NA	A0A140B3P3	Vibrio_phage	24.0	1.8e-11
WP_017376598.1|616709_617285_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_017377700.1|618093_618387_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	6.4e-06
WP_080999967.1|618503_618653_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_036771330.1|619981_620956_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_075275275.1|621128_621320_-|transposase	transposase zinc-binding domain-containing protein	transposase	NA	NA	NA	NA
WP_146619434.1|621489_621681_+	hypothetical protein	NA	A0A0P0I4A4	Acinetobacter_phage	51.7	8.1e-10
WP_157894718.1|621673_622093_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	48.5	6.7e-33
WP_026063680.1|622347_622572_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	46.2	1.2e-07
WP_144420618.1|622716_623538_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	42.9	1.2e-41
WP_017377700.1|623495_623789_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	6.4e-06
WP_162038639.1|624165_624657_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243138.1|625265_625553_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875909.1|626045_626816_-|transposase	IS982-like element ISPsa1 family transposase	transposase	NA	NA	NA	NA
WP_027243137.1|626885_628229_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087910635.1|628664_630035_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155046582.1|630031_630196_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377223.1|630255_630543_-|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_048875911.1|630572_631007_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377833.1|631574_632165_+	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_026063682.1|632291_633677_+	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_017377835.1|633774_633972_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243136.1|634064_634898_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420766.1|635435_635789_+	SEL1-like repeat protein	NA	NA	NA	NA	NA
WP_027243135.1|635801_636038_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243134.1|636037_636244_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377840.1|636405_637125_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_017377841.1|637213_638998_+	SLC13 family permease	NA	NA	NA	NA	NA
WP_155601396.1|639304_639460_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377842.1|639386_639641_+	DUF2282 domain-containing protein	NA	NA	NA	NA	NA
WP_027243133.1|639786_640608_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_157894719.1|640880_641015_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_048876031.1|641120_642524_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377200.1|643088_643277_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243131.1|643406_643673_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377198.1|644058_645699_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_017377197.1|645811_647161_+	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	37.0	3.0e-74
WP_027243130.1|647157_648027_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	47.2	9.3e-69
WP_017377194.1|648951_650265_+	ergothioneine biosynthesis protein EgtB	NA	NA	NA	NA	NA
WP_048875913.1|650261_651032_+	L-histidine N(alpha)-methyltransferase	NA	NA	NA	NA	NA
WP_017375625.1|651028_651256_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875914.1|651960_653121_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.1	8.4e-25
WP_069971647.1|653089_653686_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_162038649.1|653725_654881_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.0	4.4e-50
WP_048875916.1|655849_656254_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875923.1|656257_657253_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_157894720.1|657238_658411_-	MFS transporter	NA	NA	NA	NA	NA
WP_036774946.1|658367_658982_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	G9E4Q1	Emiliania_huxleyi_virus	35.1	3.8e-16
WP_155046615.1|659678_659840_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377737.1|660119_660665_+	inosine/xanthosine triphosphatase	NA	NA	NA	NA	NA
WP_017377736.1|660698_661364_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_027243185.1|661423_662380_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	31.6	6.3e-34
WP_144420767.1|662658_663336_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_048875918.1|663378_663960_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046614.1|664104_664776_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047927746.1|665378_665966_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162038649.1|666005_667161_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.0	4.4e-50
WP_036773915.1|667134_667530_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377727.1|667958_668774_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377726.1|668864_669851_+	transaldolase	NA	V5UTB0	Synechococcus_phage	33.5	1.3e-13
WP_017377725.1|670020_670542_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	43.8	1.8e-27
WP_017377724.1|670575_670827_+	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	57.6	3.9e-20
WP_017377723.1|670837_672115_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377722.1|672806_673334_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377721.1|673450_675763_-	RNA-binding transcriptional accessory protein	NA	NA	NA	NA	NA
WP_036773913.1|675891_676707_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_017377718.1|676963_677428_+	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_162038649.1|677915_679071_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.0	4.4e-50
>prophage 6
NZ_CP012508	Piscirickettsia salmonis strain PM32597B1 chromosome, complete genome	3186149	686427	758657	3186149	transposase,tRNA	Staphylococcus_phage(44.44%)	53	NA	NA
WP_048875919.1|686427_686745_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377706.1|686762_686975_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162038649.1|686999_688155_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.0	4.4e-50
WP_036771325.1|692265_693240_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_027242902.1|693364_694801_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_017376308.1|694880_696341_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_017376309.1|696461_696749_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_016210526.1|696946_697990_+	rod shape-determining protein	NA	NA	NA	NA	NA
WP_017376311.1|698005_698905_+	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_017376312.1|698901_699420_+	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_017376313.1|699489_700107_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_026063524.1|700116_701604_+	ribonuclease G	NA	NA	NA	NA	NA
WP_027242903.1|701613_705294_+	DUF3971 domain-containing protein	NA	NA	NA	NA	NA
WP_017376318.1|705367_706177_+	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_017376319.1|706176_706857_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_036773116.1|707481_708456_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_048875923.1|708498_709494_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036773116.1|709546_710521_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_017376224.1|710833_711718_-	DUF2608 domain-containing protein	NA	NA	NA	NA	NA
WP_017376223.1|711848_712670_-	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
WP_017376222.1|712671_713709_-	asparaginase	NA	NA	NA	NA	NA
WP_017376221.1|713712_716370_-	[protein-PII] uridylyltransferase	NA	NA	NA	NA	NA
WP_017376220.1|716447_717257_-	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_017376219.1|717663_718431_+	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_017376218.1|718595_719474_+	elongation factor Ts	NA	NA	NA	NA	NA
WP_017376217.1|719477_720215_+	UMP kinase	NA	NA	NA	NA	NA
WP_017376216.1|720218_720776_+	ribosome recycling factor	NA	NA	NA	NA	NA
WP_026063514.1|720783_721530_+	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	44.0	6.6e-23
WP_027242904.1|721537_722344_+	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_036771906.1|722432_723308_+	lysophospholipid acyltransferase family protein	NA	NA	NA	NA	NA
WP_144420622.1|723404_724982_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376212.1|725426_727337_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376211.1|727873_728413_-	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_017376210.1|728409_729438_-	diphosphomevalonate decarboxylase	NA	NA	NA	NA	NA
WP_017376209.1|729427_730492_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155069468.1|730479_732693_-	hydroxymethylglutaryl-CoA synthase	NA	NA	NA	NA	NA
WP_047927671.1|732694_733735_-	hydroxymethylglutaryl-CoA reductase	NA	NA	NA	NA	NA
WP_036771893.1|734046_736464_+	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_017376207.1|736544_737078_+	OmpH family outer membrane protein	NA	NA	NA	NA	NA
WP_017376206.1|737188_738238_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_026063513.1|738264_738702_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_017376204.1|738701_739475_+	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_027242907.1|739493_740648_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_017376201.1|740861_741431_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	43.4	3.4e-27
WP_017376200.1|741454_744961_+	DNA polymerase III subunit alpha	NA	A0A291AVA6	Streptomyces_phage	38.6	1.9e-192
WP_027242908.1|745038_745998_+	acetyl-CoA carboxylase carboxyltransferase subunit alpha	NA	NA	NA	NA	NA
WP_017376198.1|745972_747433_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_017376197.1|747468_748998_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	42.6	1.1e-85
WP_080999970.1|749031_750435_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420624.1|752346_754161_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|754245_755649_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048876031.1|755794_757198_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036771330.1|757682_758657_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
>prophage 7
NZ_CP012508	Piscirickettsia salmonis strain PM32597B1 chromosome, complete genome	3186149	771130	831354	3186149	transposase	Acinetobacter_phage(27.27%)	51	NA	NA
WP_048876012.1|771130_772534_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_082300719.1|772752_773178_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243151.1|773229_774717_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377221.1|775026_775566_-	superoxide dismutase family protein	NA	NA	NA	NA	NA
WP_162038653.1|775855_777012_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.9	2.0e-50
WP_017377224.1|777328_777904_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080999971.1|778017_779421_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377226.1|779417_779708_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377227.1|780075_780489_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052106211.1|781177_782965_+	protein kinase family protein	NA	NA	NA	NA	NA
WP_017377229.1|783131_783752_+	DUF2272 domain-containing protein	NA	NA	NA	NA	NA
WP_155046612.1|784098_784239_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377230.1|784258_786235_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377231.1|786607_788065_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	42.1	9.4e-98
WP_017377232.1|788133_789714_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	27.3	1.1e-16
WP_017377234.1|790354_794251_+	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	54.4	3.4e-118
WP_016210741.1|794257_794581_-	late competence development ComFB family protein	NA	NA	NA	NA	NA
WP_017377235.1|794654_795128_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772195.1|795159_796155_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420625.1|796457_798044_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087910659.1|798403_799351_+	RNA polymerase sigma factor RpoS	NA	F4YCU2	Synechococcus_phage	35.2	4.3e-35
WP_017377238.1|799669_800014_+	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_144420626.1|800107_800779_+	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_017377240.1|800819_801647_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_036772199.1|801733_802261_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243013.1|803146_803566_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052106212.1|803675_804257_+	HU family DNA-binding protein	NA	NA	NA	NA	NA
WP_017377245.1|804611_805892_+	outer membrane protein transport protein	NA	NA	NA	NA	NA
WP_017377246.1|806012_806876_-	polyamine aminopropyltransferase	NA	NA	NA	NA	NA
WP_017377247.1|806964_807759_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_036772212.1|807996_808983_+	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_027243014.1|808988_810515_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_144420771.1|810610_811855_+	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_017377251.1|811908_813288_+	leucyl aminopeptidase family protein	NA	Q6GYZ8	Mycoplasma_phage	35.8	2.4e-34
WP_026063614.1|813405_814191_+	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0N7HVJ8	Ostreococcus_lucimarinus_virus	33.3	3.7e-32
WP_016211687.1|814533_815178_+	UvrY/SirA/GacA family response regulator transcription factor	NA	NA	NA	NA	NA
WP_017377253.1|815212_817018_+	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_016211684.1|817041_817617_+	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_036771330.1|818666_819641_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_081377824.1|820524_820863_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_053093666.1|822177_822855_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	47.4	1.4e-48
WP_081000005.1|825455_825617_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_080999972.1|825553_826054_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017376821.1|826149_826578_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875928.1|826837_827287_+	hypothetical protein	NA	NA	NA	NA	NA
WP_146619452.1|827477_827774_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080999973.1|827750_828716_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	38.6	2.0e-48
WP_017377288.1|828934_829195_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_087910637.1|829289_830024_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.3	2.0e-24
WP_155046611.1|830052_830205_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875930.1|830409_831354_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 8
NZ_CP012508	Piscirickettsia salmonis strain PM32597B1 chromosome, complete genome	3186149	845017	893343	3186149	transposase,protease,integrase	Bacillus_virus(16.67%)	40	871096:871155	887253:887749
WP_017377305.1|845017_846319_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	57.3	6.5e-135
WP_017377306.1|846386_848819_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.7	1.2e-219
WP_016209655.1|848922_849195_+	HU family DNA-binding protein	NA	A4JWM7	Burkholderia_virus	62.9	2.0e-22
WP_075275280.1|849277_851176_+	SurA N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_017377308.1|851207_852092_+	hypothetical protein	NA	A0A1W6JP29	Morganella_phage	35.7	2.2e-41
WP_017377309.1|852100_852496_-	CrcB family protein	NA	NA	NA	NA	NA
WP_048875932.1|852919_855067_+	EAL domain-containing protein	NA	G3MA91	Bacillus_virus	36.2	3.1e-25
WP_017377313.1|855038_856388_-	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_017377314.1|856384_858505_-	ATP-binding cassette domain-containing protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	28.1	2.0e-16
WP_017377315.1|858501_860205_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	25.0	3.4e-22
WP_017377316.1|860339_861482_-	galactokinase	NA	NA	NA	NA	NA
WP_017377317.1|861538_862567_-	UDP-glucose--hexose-1-phosphate uridylyltransferase	NA	NA	NA	NA	NA
WP_026063623.1|862693_864208_+	D-alanyl-D-alanine carboxypeptidase	NA	NA	NA	NA	NA
WP_017377319.1|864314_864515_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420630.1|864659_864995_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275281.1|865139_865376_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420772.1|865646_866525_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875933.1|867161_868106_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_080999974.1|868379_869783_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420631.1|869787_870573_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	29.7	1.2e-06
WP_075275282.1|870963_871806_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
871096:871155	attL	TCTAATTACCGAAATTTTAAGATGTATTATCTTCATGTAATAAAAGGTAGCATGGTAAAA	NA	NA	NA	NA
WP_017377467.1|871802_872099_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_017377471.1|873580_874192_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377472.1|874260_875067_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|875370_876345_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_017377475.1|876516_878409_+	DNA topoisomerase IV subunit B	NA	A0A172JHT4	Bacillus_phage	32.3	3.6e-81
WP_144420632.1|878981_881297_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|881711_883115_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875935.1|883555_884035_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420633.1|884102_885359_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036772665.1|885505_886030_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_017376899.1|886434_886575_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051929562.1|886772_887477_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376902.1|888331_888643_-	hypothetical protein	NA	NA	NA	NA	NA
887253:887749	attR	TTTTACCATGCTACCTTTTATTACATGAAGATAATACATCTTAAAATTTCGGTAATTAGATTTGTGAAAATAAATCATAATTGTCATTATTTCACTTGTTGACATTTGTGAAGGCTTATTACGTTTTTTATTCGTATCTTCTAGCAAAATAGCATTCCATTGAGGTAATAACTCTTGGCAGAAATCATCTATTACACAAAAGAGAGAAATCAATGTTAAGTCCATTTTATTGCTTCTTTAGAACTAAATTTAGACTCTATTTAGCCGCAAAATCACTGGTTTTTCAAATACTTCTTATGTCGAACTCACGTTAGAATCACAAATGATTACTGATGAGGTGTTTTTATCATTTTGTCAAACAACTATCTTGACTATAACAAAAGTTATGAGTGATTTTTGTGTGGGTTATAAGGACTTTGAACATAAAGAAATTTGGCTGGAAGGCGTGAAAGATAAAATTCATCAGGGAGTAGACAAATTTTTTAATGCAGGAAATG	NA	NA	NA	NA
WP_017376903.1|888706_888886_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243159.1|889448_889631_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376905.1|889694_889922_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026063576.1|890129_890894_+	DNA/RNA non-specific endonuclease	NA	A0A2H4N7Z3	Lake_Baikal_phage	33.0	6.3e-29
WP_026063577.1|891120_891414_+	HU family DNA-binding protein	NA	A3E2K9	Sodalis_phage	52.8	4.7e-17
WP_048875878.1|891939_893343_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 9
NZ_CP012508	Piscirickettsia salmonis strain PM32597B1 chromosome, complete genome	3186149	902829	1045434	3186149	protease,transposase,tRNA	Staphylococcus_phage(19.23%)	118	NA	NA
WP_048875936.1|902829_903678_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.4	1.4e-16
WP_017375855.1|904272_904719_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026063481.1|905408_906830_-	sodium:proton antiporter NhaD	NA	NA	NA	NA	NA
WP_017375857.1|907212_908655_+	MFS transporter	NA	NA	NA	NA	NA
WP_144420634.1|909053_910385_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036771639.1|910489_911464_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_017377669.1|911513_912218_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420635.1|912658_913471_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420636.1|913529_916040_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036815620.1|916385_917561_+	outer membrane protein transport protein	NA	NA	NA	NA	NA
WP_144420637.1|918908_919133_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875940.1|919161_920325_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.1	8.4e-25
WP_036774146.1|922567_923713_-	competence/damage-inducible protein A	NA	NA	NA	NA	NA
WP_027243152.1|924305_925241_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875941.1|926738_927050_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375625.1|927901_928129_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377679.1|928444_928651_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243160.1|928748_929279_+	cytochrome b/b6 domain-containing protein	NA	NA	NA	NA	NA
WP_017377681.1|929566_930745_-	mandelate racemase/muconate lactonizing enzyme family protein	NA	Q6A202	Oenococcus_phage	31.6	7.7e-50
WP_027243161.1|930893_934730_-	bifunctional proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase PutA	NA	NA	NA	NA	NA
WP_017377683.1|934716_936219_-	sodium/proline symporter PutP	NA	NA	NA	NA	NA
WP_036773927.1|936770_937406_+	peroxiredoxin C	NA	NA	NA	NA	NA
WP_016211781.1|937917_939165_+	LbtU family siderophore porin	NA	NA	NA	NA	NA
WP_075275285.1|939387_940824_+	methyltransferase regulatory domain-containing protein	NA	NA	NA	NA	NA
WP_048875943.1|940999_942217_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_080999976.1|942678_943458_-	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_036771330.1|944464_945439_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_048875941.1|946484_946796_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375625.1|947647_947875_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046609.1|948185_948392_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243178.1|950112_951474_-	Do family serine endopeptidase	NA	A0A1B1IRD3	uncultured_Mediterranean_phage	35.5	4.3e-12
WP_017375734.1|951584_951956_-	DUF1043 family protein	NA	NA	NA	NA	NA
WP_017375735.1|952178_952829_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_017375736.1|952871_953954_+	cell division protein ZapE	NA	NA	NA	NA	NA
WP_069971648.1|954680_955655_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.6	4.7e-29
WP_157894723.1|959053_960487_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376859.1|961275_961512_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275287.1|961631_962675_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017375625.1|963095_963323_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774710.1|963496_964396_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875946.1|964790_966002_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.1	8.8e-25
WP_036771959.1|966012_966237_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046608.1|966558_966723_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|966815_968219_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027243219.1|968385_968694_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155052687.1|968978_969149_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875947.1|969777_970827_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_048875948.1|970895_971918_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.4	3.9e-135
WP_017378198.1|971963_972878_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162038649.1|972917_974073_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.0	4.4e-50
WP_017378197.1|974030_974900_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053093667.1|976337_977054_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376026.1|977498_979370_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	28.4	1.4e-34
WP_027243175.1|979461_981207_-	DNA primase	NA	A0A1S5RGL3	Helicobacter_phage	36.7	7.6e-46
WP_017376029.1|981286_981736_-	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	44.9	1.4e-20
WP_016211035.1|981788_982004_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_017376030.1|982250_983267_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	54.2	1.8e-100
WP_017376031.1|983315_983945_-	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_017376032.1|984285_985497_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_017375625.1|985529_985757_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420640.1|985845_986526_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376035.1|986802_987222_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157894724.1|987367_988168_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771639.1|988247_989222_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_144420641.1|989241_989877_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275290.1|990120_991122_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_017376037.1|991220_992429_-	MFS transporter	NA	NA	NA	NA	NA
WP_036771498.1|992418_994149_-	glycoside hydrolase family 32 protein	NA	NA	NA	NA	NA
WP_036771517.1|994332_995469_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875952.1|996213_996849_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376043.1|996963_998298_-	dihydroorotase	NA	NA	NA	NA	NA
WP_017376044.1|998426_999068_-	pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
WP_017376045.1|999373_999796_+	universal stress protein	NA	NA	NA	NA	NA
WP_017376046.1|1000073_1001036_+	formimidoylglutamase	NA	NA	NA	NA	NA
WP_075275404.1|1001074_1002250_+	imidazolonepropionase	NA	NA	NA	NA	NA
WP_087910638.1|1002338_1004039_+	urocanate hydratase	NA	NA	NA	NA	NA
WP_017376050.1|1004038_1005577_+	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	37.4	2.1e-71
WP_017376051.1|1005616_1007269_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210558.1|1007342_1008098_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026063502.1|1008284_1009160_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_144420642.1|1009424_1009619_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376053.1|1009763_1010393_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046586.1|1010506_1010680_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157894742.1|1010788_1012198_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376055.1|1012194_1012839_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772015.1|1013357_1014545_-	MFS transporter	NA	NA	NA	NA	NA
WP_036772012.1|1014677_1015367_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376060.1|1015440_1016790_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	E4ZFI6	Streptococcus_phage	27.6	7.5e-33
WP_048876123.1|1016893_1019074_+	GTP diphosphokinase	NA	NA	NA	NA	NA
WP_036772169.1|1019143_1020019_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376064.1|1020161_1020362_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376065.1|1020485_1020893_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420776.1|1020872_1021451_-	TIGR00730 family Rossman fold protein	NA	A0A1D8KUT5	Synechococcus_phage	34.3	6.9e-20
WP_017376067.1|1021873_1022536_+	adenylate kinase	NA	NA	NA	NA	NA
WP_016211263.1|1022566_1022935_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_171824206.1|1022945_1024259_-	MFS transporter	NA	NA	NA	NA	NA
WP_144420644.1|1024508_1025120_+	DedA family protein	NA	NA	NA	NA	NA
WP_017376070.1|1025222_1025375_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211261.1|1025545_1025839_-	cold shock domain-containing protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.5	5.8e-15
WP_036772670.1|1026079_1026382_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A218MMY6	uncultured_virus	40.0	7.5e-10
WP_017376072.1|1026436_1028710_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.3e-167
WP_016211259.1|1028769_1029015_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_048875954.1|1029139_1029895_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_048875955.1|1030003_1030978_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	4.3e-30
WP_036771709.1|1031185_1031947_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_017376076.1|1031930_1032887_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	43.7	1.6e-61
WP_017376077.1|1033149_1035648_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	42.9	2.4e-85
WP_017376078.1|1035651_1036392_+	outer-membrane lipoprotein carrier protein LolA	NA	NA	NA	NA	NA
WP_017376079.1|1036841_1037636_-	inositol monophosphatase	NA	NA	NA	NA	NA
WP_017376080.1|1037798_1038587_+|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
WP_017376081.1|1038583_1039795_+	IscS subfamily cysteine desulfurase	NA	NA	NA	NA	NA
WP_144420777.1|1039787_1040144_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376083.1|1040238_1040667_+	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	39.4	1.8e-17
WP_036771725.1|1040818_1041928_+	23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN	NA	NA	NA	NA	NA
WP_017376085.1|1041924_1042653_+	type IV pilus biogenesis/stability protein PilW	NA	NA	NA	NA	NA
WP_017376086.1|1042710_1043598_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_017376087.1|1043682_1044057_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376088.1|1044156_1045434_+|tRNA	histidine--tRNA ligase	tRNA	A0A2I2L577	Orpheovirus	24.8	3.6e-21
>prophage 10
NZ_CP012508	Piscirickettsia salmonis strain PM32597B1 chromosome, complete genome	3186149	1050646	1112271	3186149	protease,transposase,tRNA	Bacillus_phage(22.22%)	55	NA	NA
WP_075275292.1|1050646_1051477_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_155046605.1|1051704_1051854_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242840.1|1052048_1052870_+	ParA family protein	NA	H7BUL8	unidentified_phage	33.0	3.9e-16
WP_017375751.1|1052866_1053760_+	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_017375750.1|1053805_1054327_+	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_017375749.1|1054404_1054890_+	DUF2802 domain-containing protein	NA	NA	NA	NA	NA
WP_036771957.1|1056333_1057305_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048875958.1|1058389_1059253_-	chemotaxis protein CheX	NA	NA	NA	NA	NA
WP_017377897.1|1059279_1059699_-	response regulator	NA	W8CYM9	Bacillus_phage	29.4	1.2e-05
WP_017377896.1|1059751_1060708_-	23S rRNA pseudouridine(955/2504/2580) synthase RluC	NA	NA	NA	NA	NA
WP_027242839.1|1061190_1063863_+	Rne/Rng family ribonuclease	NA	NA	NA	NA	NA
WP_017377894.1|1063943_1064570_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_026063687.1|1064726_1066325_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_017377892.1|1066414_1067836_+|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_017377891.1|1067866_1068388_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	34.2	2.0e-10
WP_017377890.1|1068384_1068990_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_017377889.1|1069066_1070077_+	Holliday junction branch migration DNA helicase RuvB	NA	B3GAM6	uncultured_virus	30.8	6.9e-07
WP_017377888.1|1070189_1070894_+	protein TolQ	NA	NA	NA	NA	NA
WP_017377887.1|1070928_1071360_+	protein TolR	NA	NA	NA	NA	NA
WP_036771700.1|1071362_1072457_+	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_048875959.1|1072516_1073869_+	Tol-Pal system beta propeller repeat protein TolB	NA	NA	NA	NA	NA
WP_017377882.1|1073904_1074546_+	OmpA family protein	NA	NA	NA	NA	NA
WP_144420778.1|1074618_1075518_+	tol-pal system protein YbgF	NA	NA	NA	NA	NA
WP_027242836.1|1075520_1076168_+	7-carboxy-7-deazaguanine synthase QueE	NA	J9PV61	Bacillus_phage	38.6	1.6e-36
WP_027242835.1|1076218_1077022_-	PhoH family protein	NA	A0A0E3G5H5	Synechococcus_phage	43.1	6.8e-42
WP_017377879.1|1077203_1077419_+	SlyX family protein	NA	NA	NA	NA	NA
WP_017377878.1|1077422_1077656_-	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_017377877.1|1077717_1079310_-	exodeoxyribonuclease VII large subunit	NA	NA	NA	NA	NA
WP_017377875.1|1079512_1080442_+	ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	31.9	7.0e-14
WP_017377874.1|1080443_1081211_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_047927659.1|1081576_1082347_+	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_048875960.1|1082405_1083380_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017377870.1|1083487_1083850_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377869.1|1084019_1085729_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_048875961.1|1085969_1087373_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_146619530.1|1087424_1087682_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242834.1|1088430_1089738_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376710.1|1090022_1090193_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375625.1|1090197_1090425_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376708.1|1090719_1091121_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_048875964.1|1091685_1092465_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046604.1|1092532_1092673_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420647.1|1092873_1093071_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053093668.1|1093208_1093808_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420648.1|1093990_1095463_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378009.1|1095865_1097611_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243143.1|1098046_1098907_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378007.1|1099424_1101368_-	CHASE domain-containing protein	NA	NA	NA	NA	NA
WP_048875961.1|1101513_1102917_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017378006.1|1103036_1103666_-	response regulator	NA	NA	NA	NA	NA
WP_017378005.1|1103904_1104624_-	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_017378004.1|1104737_1108277_+	chromosome segregation protein SMC	NA	NA	NA	NA	NA
WP_017378003.1|1108343_1109174_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243144.1|1109190_1111200_+	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	40.9	5.4e-128
WP_027243145.1|1111215_1112271_+|protease	protease SohB	protease	NA	NA	NA	NA
>prophage 11
NZ_CP012508	Piscirickettsia salmonis strain PM32597B1 chromosome, complete genome	3186149	1119135	1153277	3186149	transposase	Acinetobacter_phage(33.33%)	30	NA	NA
WP_144420650.1|1119135_1120392_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376600.1|1120647_1120827_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169834762.1|1121009_1121162_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162038657.1|1121167_1121800_+|transposase	IS3 family transposase	transposase	A0A0N7C035	Escherichia_phage	33.1	5.6e-15
WP_157894725.1|1122097_1122331_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_080999971.1|1123102_1124506_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377761.1|1124676_1126047_+	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_144420780.1|1126093_1126993_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_017377763.1|1126973_1129778_-	response regulator	NA	A0A1V0SGX0	Hokovirus	31.8	6.9e-57
WP_017377764.1|1129857_1130454_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377765.1|1130867_1131623_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_162038649.1|1131712_1132869_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.0	4.4e-50
WP_027242898.1|1133056_1133698_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377768.1|1133967_1135293_+	acetyl-CoA C-acetyltransferase	NA	NA	NA	NA	NA
WP_047927230.1|1135289_1137347_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_017377771.1|1137324_1137897_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_144420781.1|1137979_1138312_+	DUF1820 family protein	NA	NA	NA	NA	NA
WP_017377773.1|1138376_1139411_+	beta-N-acetylhexosaminidase	NA	NA	NA	NA	NA
WP_027242897.1|1139398_1140520_+	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_017377777.1|1140613_1141591_-	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_027242896.1|1141753_1143421_+	AMP-binding protein	NA	A0A1V0SBX8	Catovirus	25.3	1.2e-19
WP_027242895.1|1143707_1144559_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377782.1|1144967_1147436_+	bifunctional aspartate kinase/homoserine dehydrogenase I	NA	NA	NA	NA	NA
WP_017377783.1|1147449_1148424_+	homoserine kinase	NA	NA	NA	NA	NA
WP_017377784.1|1148410_1149679_+	threonine synthase	NA	NA	NA	NA	NA
WP_027242894.1|1149712_1151461_-	PLD-like domain protein	NA	NA	NA	NA	NA
WP_017375591.1|1151640_1151844_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_144420652.1|1152062_1152740_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	38.8	2.6e-34
WP_169834764.1|1152877_1153042_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963567.1|1153022_1153277_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.8	5.3e-09
>prophage 12
NZ_CP012508	Piscirickettsia salmonis strain PM32597B1 chromosome, complete genome	3186149	1193753	1242139	3186149	transposase,tRNA	uncultured_Mediterranean_phage(28.57%)	41	NA	NA
WP_051929562.1|1193753_1194458_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_036771332.1|1194708_1195683_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	7.3e-30
WP_017376395.1|1196570_1199297_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773116.1|1199820_1200795_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_017376397.1|1200992_1202474_-	MFS transporter	NA	NA	NA	NA	NA
WP_016209947.1|1202933_1203596_+	carbonic anhydrase	NA	NA	NA	NA	NA
WP_017376398.1|1203837_1205070_-	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_017376399.1|1205226_1207998_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	39.4	6.9e-150
WP_017376400.1|1208066_1208510_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_017376401.1|1208662_1210135_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	30.2	1.8e-43
WP_017376402.1|1210246_1211308_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_027242800.1|1211304_1212339_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_017376405.1|1212341_1213382_+|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_026063528.1|1213566_1214682_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	49.2	2.2e-94
WP_017376407.1|1214720_1215074_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	46.5	1.1e-07
WP_017376408.1|1215094_1216963_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_017376409.1|1216984_1217929_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	35.2	2.4e-38
WP_017376410.1|1218162_1218441_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209938.1|1218803_1219442_-	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_017376411.1|1219416_1220841_-	aminodeoxychorismate synthase component I	NA	A0A0B5J984	Pandoravirus	33.4	3.9e-40
WP_017376412.1|1221041_1221719_+	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_027242801.1|1221839_1223114_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	50.9	1.7e-90
WP_017376414.1|1223181_1223937_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376415.1|1223988_1224906_+	TIGR01777 family protein	NA	NA	NA	NA	NA
WP_017376416.1|1225040_1225211_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420654.1|1225330_1226110_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017376231.1|1226162_1226450_+|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_051929627.1|1226509_1226860_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_155046603.1|1227053_1227206_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080999981.1|1227133_1227607_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	48.0	2.9e-32
WP_048875973.1|1227619_1228255_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036773947.1|1228766_1229642_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_036772615.1|1230428_1230752_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376433.1|1231248_1232607_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	26.0	3.9e-37
WP_026063530.1|1232830_1233019_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376430.1|1233032_1234166_-	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_048875975.1|1234366_1238239_+	cadherin-like domain-containing protein	NA	NA	NA	NA	NA
WP_017376428.1|1238273_1238999_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375910.1|1239388_1240117_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_017375910.1|1240519_1241248_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_075275409.1|1241311_1242139_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 13
NZ_CP012508	Piscirickettsia salmonis strain PM32597B1 chromosome, complete genome	3186149	1253036	1299666	3186149	transposase	uncultured_Caudovirales_phage(12.5%)	38	NA	NA
WP_048875923.1|1253036_1254032_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036772905.1|1255588_1255942_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242803.1|1256150_1257863_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.9	2.5e-25
WP_027242804.1|1258309_1260163_+	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	40.5	2.2e-43
WP_016209821.1|1260265_1260598_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_017377485.1|1260628_1261225_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_017377486.1|1261221_1262346_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377487.1|1262457_1263105_+	class I SAM-dependent methyltransferase	NA	W8CYT3	Bacillus_phage	30.8	1.4e-08
WP_017377488.1|1263156_1265070_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	38.6	1.8e-117
WP_017377489.1|1265274_1266312_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_027242805.1|1266370_1269697_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242806.1|1270403_1271372_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_027242807.1|1271501_1271990_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036777920.1|1272431_1272665_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036817939.1|1272974_1273163_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375667.1|1273651_1274137_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169834767.1|1274285_1274438_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275301.1|1274407_1274677_+	TSUP family transporter	NA	NA	NA	NA	NA
WP_017377496.1|1274711_1276037_-	ribonuclease HI	NA	G3MB70	Bacillus_virus	36.3	1.3e-37
WP_144420783.1|1276092_1276740_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_027242809.1|1276933_1278892_+	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	28.2	2.5e-45
WP_047927313.1|1279035_1281966_+	insulinase family protein	NA	NA	NA	NA	NA
WP_048875980.1|1282771_1284175_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017378296.1|1285615_1286401_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378295.1|1286491_1288141_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378294.1|1288285_1289131_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|1289244_1290648_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036774189.1|1291113_1292121_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_098082828.1|1292120_1292378_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_157894727.1|1292911_1293562_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_017378290.1|1293589_1294465_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275303.1|1294600_1295590_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_053093670.1|1295566_1296247_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.0	1.1e-43
WP_144420659.1|1296360_1297140_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048875973.1|1297416_1298052_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046582.1|1298048_1298213_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|1298411_1299386_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017378288.1|1299444_1299666_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
>prophage 14
NZ_CP012508	Piscirickettsia salmonis strain PM32597B1 chromosome, complete genome	3186149	1361899	1402305	3186149	transposase,tRNA	Tupanvirus(22.22%)	38	NA	NA
WP_017378228.1|1361899_1362820_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_155046600.1|1366983_1367127_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378223.1|1367736_1368555_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_016211418.1|1368662_1369124_-	YaiI/YqxD family protein	NA	NA	NA	NA	NA
WP_017378221.1|1369140_1370064_-	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_027242798.1|1370087_1371137_-	small ribosomal subunit biogenesis GTPase RsgA	NA	NA	NA	NA	NA
WP_047927040.1|1371274_1371868_+	oligoribonuclease	NA	A0A1B3B0T8	Gordonia_phage	29.6	1.2e-14
WP_017378219.1|1371890_1372361_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_144420785.1|1372470_1373721_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A067ZJB6	Vibrio_phage	27.4	1.7e-15
WP_016211840.1|1374409_1374874_+	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	32.9	4.7e-19
WP_017378214.1|1375312_1376785_+	catalase	NA	A0A2K9L572	Tupanvirus	46.5	3.3e-98
WP_017378213.1|1376901_1377354_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_155046599.1|1377478_1377634_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420662.1|1377778_1377982_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378212.1|1378172_1378571_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875983.1|1378756_1379362_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	49.5	6.3e-48
WP_017375549.1|1379370_1379667_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875984.1|1379671_1380208_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046598.1|1380352_1380922_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|1381001_1381976_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_048875986.1|1381972_1382470_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087910640.1|1382877_1383294_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053856767.1|1383361_1384765_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376440.1|1384761_1385379_-	MFS transporter	NA	NA	NA	NA	NA
WP_036773116.1|1385653_1386628_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_036773538.1|1386792_1387416_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_017376442.1|1387412_1389353_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	33.0	1.8e-72
WP_017376443.1|1389508_1390162_+	glutaredoxin 2	NA	NA	NA	NA	NA
WP_017376444.1|1390330_1391506_+	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_017376445.1|1391859_1393185_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376446.1|1393283_1394066_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_017376447.1|1394167_1395040_+	acetyl-CoA carboxylase carboxyltransferase subunit beta	NA	NA	NA	NA	NA
WP_017376448.1|1395226_1396489_+	bifunctional tetrahydrofolate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_017376449.1|1396562_1397093_+	CvpA family protein	NA	NA	NA	NA	NA
WP_017376450.1|1397114_1398620_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	40.4	7.7e-87
WP_017376451.1|1398632_1399298_+|tRNA	tRNA-(ms[2]io[6]A)-hydroxylase	tRNA	NA	NA	NA	NA
WP_017376452.1|1399391_1401152_+	gamma-glutamyltransferase	NA	NA	NA	NA	NA
WP_036773947.1|1401429_1402305_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 16
NZ_CP012508	Piscirickettsia salmonis strain PM32597B1 chromosome, complete genome	3186149	1568534	1584105	3186149	transposase	unidentified_phage(25.0%)	14	NA	NA
WP_048876002.1|1568534_1569518_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	32.0	4.5e-27
WP_087910642.1|1570317_1571471_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	6.8e-59
WP_048876004.1|1571592_1572285_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242833.1|1572293_1573481_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	34.3	5.2e-22
WP_017376484.1|1573630_1574257_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	41.3	1.2e-33
WP_017376485.1|1574302_1575532_+	hypothetical protein	NA	B2YG43	Musca_hytrovirus	21.9	2.6e-08
WP_144420789.1|1575726_1576173_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376487.1|1576364_1577723_+	dGTPase	NA	NA	NA	NA	NA
WP_048876005.1|1578691_1579609_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	32.4	4.6e-26
WP_053093673.1|1579950_1580610_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_144420674.1|1580690_1581194_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.7	3.0e-19
WP_017376491.1|1581166_1581454_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771628.1|1581746_1582868_-	calcium:proton antiporter	NA	NA	NA	NA	NA
WP_036771330.1|1583130_1584105_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
>prophage 17
NZ_CP012508	Piscirickettsia salmonis strain PM32597B1 chromosome, complete genome	3186149	1599092	1652358	3186149	transposase,protease,integrase	Staphylococcus_phage(33.33%)	54	1600160:1600219	1658726:1659266
WP_036771330.1|1599092_1600067_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017375992.1|1600142_1600418_-|transposase	transposase	transposase	NA	NA	NA	NA
1600160:1600219	attL	ACTTAATGAGCTGCATGGTCGCTAGGGCTTTGTGGTGCTTCATGATTACTGACAAGCGTT	NA	NA	NA	NA
WP_027243029.1|1601565_1602534_-	threonine/serine dehydratase	NA	NA	NA	NA	NA
WP_027243028.1|1602743_1604156_-	MFS transporter	NA	NA	NA	NA	NA
WP_017375994.1|1604343_1605057_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	1.7e-36
WP_017375995.1|1605077_1605491_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375996.1|1605591_1606665_-	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
WP_027243027.1|1606801_1607701_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772860.1|1607956_1608208_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243025.1|1608256_1608892_+	chorismate mutase	NA	NA	NA	NA	NA
WP_036772872.1|1609016_1609874_+	SEL1-like repeat protein	NA	NA	NA	NA	NA
WP_053856766.1|1610061_1611465_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_047927520.1|1611640_1612144_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377328.1|1612220_1613522_-	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	37.3	8.2e-29
WP_027243024.1|1613690_1614791_+	carbohydrate kinase family protein	NA	NA	NA	NA	NA
WP_027243023.1|1615141_1615384_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772851.1|1615377_1615695_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162038662.1|1615988_1617144_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.5	2.2e-49
WP_036774927.1|1617755_1618226_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212018.1|1618448_1618748_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_047927838.1|1618744_1618990_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420676.1|1619282_1620239_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.5	1.8e-49
WP_017375591.1|1620523_1620727_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_065653736.1|1620857_1621886_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_047927336.1|1622249_1622495_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069971648.1|1622857_1623832_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.6	4.7e-29
WP_075275420.1|1625303_1627010_+	cation:proton antiporter	NA	NA	NA	NA	NA
WP_036773893.1|1627055_1627907_-	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_146619459.1|1628109_1630566_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420677.1|1631085_1631487_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771639.1|1632073_1633048_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_017378512.1|1633088_1634417_-	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_016211143.1|1634680_1635250_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	39.5	7.3e-30
WP_017378513.1|1635265_1635577_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378514.1|1635586_1636555_-	ferrochelatase	NA	NA	NA	NA	NA
WP_016211147.1|1636667_1637021_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378515.1|1637024_1638089_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_017378516.1|1638089_1639829_-	lipid A export permease/ATP-binding protein MsbA	NA	W8CYL7	Bacillus_phage	31.2	5.8e-54
WP_017378517.1|1639835_1640258_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_017378518.1|1640241_1640871_-	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_075275322.1|1641106_1641205_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_047927346.1|1641237_1643109_+	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
WP_048876007.1|1643256_1644231_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	2.1e-29
WP_155046591.1|1644310_1644454_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_027243017.1|1644627_1645971_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420678.1|1646469_1646748_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420679.1|1647015_1647972_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.0	3.6e-50
WP_017375696.1|1648298_1648682_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162038663.1|1648697_1649498_-	DNA internalization-related competence protein ComEC/Rec2	NA	NA	NA	NA	NA
WP_162038664.1|1649424_1649643_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036774017.1|1649933_1650809_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_155046590.1|1650810_1650975_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420681.1|1651154_1651340_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876008.1|1651383_1652358_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.6	8.1e-29
1658726:1659266	attR	AACGCTTGTCAGTAATCATGAAGCACCACAAAGCCCTAGCGACCATGCAGCTCATTAAGTTCTAACAGGAGCAGTCCGTCTATAATCAGGTTTTAAGCCTATTTTTAGCTGCTTTATCGATTATTGGCACCTGCACTTCGAATACTGGGAGTAATTTTTAGTCGAATTATCACAATTTCACAATATGGCTGATTTTCAGAATATTGTATTACCTAAGCGCAGATTTAGTTATTTAACTATTAAAATGAAAATCGGGATAACGCACTGTAGCCCGCTTTCTTTATTTAGACCGACACAGTTGAGGCCTTCGACGTTTTCGGCCTGGCTGCTGCTGACTATTACGATGATCTTCCCTGCGTTTTCCTTGCATGCTGCCTCCCAAGCGCTGCCCTCCCTGATGTTCGATTTCTGGTTTTTTAGGCGCTTTTGATCTGCGATCTAAACTAGAAACAGGTACATCATGCACTGGCTCAAATCCATCAACGAGTTTACGGGCTAATAACTGTCCGATTAAATGTTCAATATCAGATAATTGTTTGAT	NA	NA	NA	NA
>prophage 18
NZ_CP012508	Piscirickettsia salmonis strain PM32597B1 chromosome, complete genome	3186149	1674718	1793213	3186149	transposase,tRNA	Acinetobacter_phage(14.81%)	100	NA	NA
WP_017376809.1|1674718_1676488_-|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L0E9	Tupanvirus	40.7	4.9e-08
WP_048876146.1|1676712_1677846_-	MFS transporter	NA	S4TR35	Salmonella_phage	23.0	2.6e-15
WP_026063564.1|1678695_1681515_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	55.3	5.2e-312
WP_017376814.1|1681889_1682615_+	single-stranded DNA-binding protein	NA	A0A2I7QWB5	Vibrio_phage	65.6	6.2e-42
WP_169834769.1|1685209_1685866_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	47.2	1.9e-37
WP_051929542.1|1685974_1686307_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017376231.1|1686366_1686654_-|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_048876009.1|1687306_1688332_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_036771330.1|1688459_1689434_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_027243041.1|1689628_1690582_-	chemotaxis protein CheV	NA	NA	NA	NA	NA
WP_144420684.1|1690751_1691000_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420792.1|1691182_1691707_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376827.1|1692161_1692989_+	thioredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_144420685.1|1693057_1693243_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376828.1|1693443_1693902_+	amino acid permease	NA	NA	NA	NA	NA
WP_017376829.1|1694042_1694270_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876010.1|1694434_1695820_-	protein kinase family protein	NA	A0A1M7XTW9	Cedratvirus	27.7	1.4e-05
WP_017376830.1|1696115_1696430_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243043.1|1696538_1698164_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	25.3	3.9e-28
WP_017376832.1|1698576_1699566_-	rhodanese-related sulfurtransferase	NA	NA	NA	NA	NA
WP_016212182.1|1699887_1700073_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376833.1|1700462_1702418_+	transglycosylase SLT domain-containing protein	NA	K4NWI2	Pseudomonas_phage	39.7	9.2e-16
WP_080963614.1|1702489_1702612_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_036771330.1|1702654_1703629_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017378302.1|1703851_1704313_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378301.1|1704697_1705495_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772310.1|1705960_1707766_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	34.9	5.8e-57
WP_027243044.1|1707853_1709200_-	cation:dicarboxylase symporter family transporter	NA	NA	NA	NA	NA
WP_075275422.1|1711837_1712269_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772316.1|1712420_1713164_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377201.1|1714811_1715282_-	DUF1289 domain-containing protein	NA	NA	NA	NA	NA
WP_017377202.1|1715843_1716446_+	short chain dehydrogenase	NA	NA	NA	NA	NA
WP_171824209.1|1717227_1717857_+	FHA domain-containing protein	NA	NA	NA	NA	NA
WP_017377205.1|1718219_1718702_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377206.1|1718763_1720221_+	hypothetical protein	NA	A0A1C3NFI8	Phage_NCTB	24.8	4.3e-10
WP_065653751.1|1720257_1720722_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243049.1|1720749_1721328_-	nucleoside deaminase	NA	A0A0B5J096	Pandoravirus	37.7	2.3e-15
WP_017377209.1|1721598_1723416_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876011.1|1723392_1724442_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036772296.1|1724641_1725019_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376231.1|1726208_1726496_+|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_036773200.1|1726555_1726852_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420686.1|1726996_1727653_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	46.8	4.7e-41
WP_017377324.1|1727892_1728273_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|1728924_1730328_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_087910660.1|1730324_1730606_-	peptide-methionine (R)-S-oxide reductase	NA	NA	NA	NA	NA
WP_048876013.1|1731000_1731465_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927610.1|1731645_1732239_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876007.1|1732424_1733399_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	2.1e-29
WP_051929845.1|1733802_1734627_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_027243222.1|1734701_1735850_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_027243221.1|1735865_1737494_-	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_169834770.1|1737436_1737577_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375698.1|1737837_1739031_-	fatty acid desaturase	NA	NA	NA	NA	NA
WP_026063486.1|1745145_1745646_+	WbuC family cupin fold metalloprotein	NA	NA	NA	NA	NA
WP_155046587.1|1746059_1746200_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772592.1|1746322_1747783_-	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	33.4	2.3e-56
WP_026063485.1|1747860_1748343_-	YiiD C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_017375881.1|1748501_1749767_+	sodium:proton antiporter	NA	A0A2H4J178	uncultured_Caudovirales_phage	42.8	1.2e-48
WP_027243180.1|1749851_1751111_+	metallophosphoesterase	NA	NA	NA	NA	NA
WP_017375878.1|1751182_1751455_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876014.1|1751792_1752128_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155069586.1|1752353_1752737_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876016.1|1753007_1753418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875984.1|1753562_1754099_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420687.1|1754109_1754295_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376772.1|1754730_1755702_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_027243181.1|1755683_1756655_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_144420793.1|1756768_1757542_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_146619432.1|1757950_1758142_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876149.1|1758397_1758916_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_162038666.1|1758968_1760125_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.0	4.4e-50
WP_075275326.1|1760177_1761029_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_051929549.1|1761244_1761622_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_048876011.1|1762181_1763231_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017376108.1|1763544_1764930_-|tRNA	cysteine--tRNA ligase	tRNA	A0A2K9L6B7	Tupanvirus	29.7	3.4e-49
WP_017376107.1|1764936_1766475_-|tRNA	glutamate--tRNA ligase	tRNA	A0A2K9L594	Tupanvirus	22.4	2.6e-05
WP_017376106.1|1766517_1767243_+	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_017376105.1|1767413_1768646_+	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	27.2	8.9e-33
WP_017376104.1|1768845_1769667_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_017376103.1|1769716_1770526_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876018.1|1770681_1774548_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SBU4	Catovirus	26.5	1.6e-51
WP_017376100.1|1774713_1775589_+	ParA family protein	NA	NA	NA	NA	NA
WP_075275424.1|1775653_1775932_+	nitronate monooxygenase	NA	NA	NA	NA	NA
WP_144420689.1|1776076_1776652_+	nitronate monooxygenase	NA	NA	NA	NA	NA
WP_017376099.1|1776700_1776859_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051929528.1|1777607_1778324_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_026063521.1|1779452_1779869_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420690.1|1780783_1781713_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.9	2.2e-60
WP_017376276.1|1781991_1782306_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	6.9e-06
WP_026063520.1|1783215_1784199_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	32.7	1.3e-34
WP_017376274.1|1784349_1784697_+	arsenate reductase (glutaredoxin)	NA	NA	NA	NA	NA
WP_017376273.1|1784696_1785296_+	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_075275328.1|1785670_1786009_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376272.1|1785959_1786217_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_048876152.1|1786220_1787165_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420693.1|1787152_1787296_+	phosphatase	NA	NA	NA	NA	NA
WP_075275332.1|1790882_1791884_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157894731.1|1792040_1792421_+	copper chaperone PCu(A)C	NA	NA	NA	NA	NA
WP_081329473.1|1792793_1793213_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 19
NZ_CP012508	Piscirickettsia salmonis strain PM32597B1 chromosome, complete genome	3186149	1799630	1846356	3186149	plate,transposase,tRNA	Acinetobacter_phage(50.0%)	39	NA	NA
WP_027242911.1|1799630_1800647_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_017376669.1|1800755_1801154_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376668.1|1801193_1803017_+	BamA/TamA family outer membrane protein	NA	NA	NA	NA	NA
WP_027242912.1|1803013_1806316_+	translocation/assembly module TamB domain-containing protein	NA	NA	NA	NA	NA
WP_036772026.1|1806420_1807296_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376663.1|1807333_1808248_+	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_027242913.1|1808312_1808942_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_017376662.1|1808986_1809421_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376661.1|1809401_1810142_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376660.1|1810155_1811553_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242914.1|1811555_1814504_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772028.1|1814503_1816225_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242917.1|1816239_1816644_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376655.1|1816644_1819524_-	DUF4280 domain-containing protein	NA	NA	NA	NA	NA
WP_075275426.1|1819526_1820249_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242919.1|1820610_1822503_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376650.1|1822534_1825075_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162287773.1|1825106_1826213_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_027242921.1|1826275_1826899_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242922.1|1826913_1828413_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_036772036.1|1828429_1828936_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_075275427.1|1830191_1830263_+	SEC-C domain-containing protein	NA	NA	NA	NA	NA
WP_075275333.1|1830445_1830628_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169834772.1|1831524_1831692_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069971656.1|1831829_1832102_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420695.1|1832117_1833551_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420696.1|1833695_1834961_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242924.1|1835246_1836998_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157894733.1|1837010_1838102_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_144420697.1|1838177_1838474_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162038649.1|1838513_1839670_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.0	4.4e-50
WP_036771639.1|1840609_1841584_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_081000010.1|1841642_1841906_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_157894742.1|1841915_1843325_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155046586.1|1843433_1843607_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420794.1|1843674_1843818_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_027243218.1|1843836_1844034_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772025.1|1844051_1844558_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_036772663.1|1845480_1846356_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 20
NZ_CP012508	Piscirickettsia salmonis strain PM32597B1 chromosome, complete genome	3186149	1876111	1989612	3186149	transposase,tRNA	Staphylococcus_phage(28.57%)	97	NA	NA
WP_048876022.1|1876111_1876963_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_087910645.1|1877375_1878529_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	8.9e-59
WP_048876023.1|1878619_1879723_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.1	8.0e-25
WP_017375861.1|1880062_1880563_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211829.1|1881259_1881613_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375862.1|1881913_1883641_-	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_047927270.1|1883744_1884470_-	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	38.7	6.4e-31
WP_017375864.1|1884462_1885701_-	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_017375865.1|1885838_1886876_+	agmatine deiminase family protein	NA	NA	NA	NA	NA
WP_026063482.1|1886957_1887833_+	acyltransferase	NA	M1HCD5	Acanthocystis_turfacea_Chlorella_virus	40.7	3.1e-56
WP_017375867.1|1887942_1889196_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242968.1|1889253_1892745_+	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_144420795.1|1892861_1893539_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375871.1|1893666_1894215_+	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_017375873.1|1896085_1896247_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051929533.1|1896635_1896965_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026063558.1|1897438_1898005_-	dCTP deaminase	NA	S5VM63	Pseudomonas_phage	77.8	2.8e-74
WP_087910646.1|1898007_1899132_-	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_026063557.1|1899216_1900035_-	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_027242970.1|1900165_1902145_+	cation:proton antiporter	NA	NA	NA	NA	NA
WP_017376714.1|1902204_1902858_-	tyrosine-protein phosphatase	NA	NA	NA	NA	NA
WP_080999995.1|1903542_1904913_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376707.1|1906628_1907276_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017376706.1|1907313_1907706_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_017376705.1|1907958_1908705_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_027243123.1|1909303_1910209_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|1910324_1911299_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017376701.1|1911444_1912173_-	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
WP_017376700.1|1912292_1912874_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243124.1|1912896_1915737_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376696.1|1917779_1918730_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_017376695.1|1918812_1919595_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_027243125.1|1919693_1919987_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376693.1|1920509_1921154_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376692.1|1921187_1921832_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376691.1|1921880_1922735_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376690.1|1922872_1923385_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_107517381.1|1923452_1923647_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376688.1|1923860_1924214_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|1925422_1926397_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017376683.1|1927144_1927846_-	cyclase family protein	NA	NA	NA	NA	NA
WP_027243126.1|1927920_1928550_-	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_026063554.1|1928717_1929974_+	YihY family inner membrane protein	NA	NA	NA	NA	NA
WP_017376681.1|1930248_1930911_+	HAD-IB family phosphatase	NA	NA	NA	NA	NA
WP_017376680.1|1930900_1932133_+	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	47.3	8.2e-95
WP_027243127.1|1932264_1932882_+	VOC family protein	NA	NA	NA	NA	NA
WP_036773258.1|1932959_1933466_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162038649.1|1933476_1934633_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.0	4.4e-50
WP_157894734.1|1934986_1935229_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_048876027.1|1935389_1936601_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017375625.1|1936853_1937081_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051929523.1|1937091_1937505_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375562.1|1938713_1938878_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772169.1|1938914_1939790_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_162038642.1|1942624_1942864_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375899.1|1942920_1944120_-	trans-2-enoyl-CoA reductase family protein	NA	NA	NA	NA	NA
WP_017375900.1|1944373_1944655_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927375.1|1944710_1946702_-	TRAP transporter permease	NA	NA	NA	NA	NA
WP_026063491.1|1946775_1947753_-	TAXI family TRAP transporter solute-binding subunit	NA	NA	NA	NA	NA
WP_027242984.1|1947888_1948671_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774087.1|1948827_1949151_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876030.1|1949218_1950322_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036772169.1|1950391_1951267_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017375625.1|1951380_1951608_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275338.1|1951629_1952079_+	murein L,D-transpeptidase catalytic domain family protein	NA	NA	NA	NA	NA
WP_027242985.1|1952092_1953484_-	flagellar hook-associated protein FlgL	NA	NA	NA	NA	NA
WP_027242986.1|1953525_1956513_-	flagellar hook-associated protein FlgK	NA	NA	NA	NA	NA
WP_027242987.1|1956582_1957416_-	rod-binding protein	NA	NA	NA	NA	NA
WP_087910648.1|1957470_1958658_-	flagellar basal body P-ring protein FlgI	NA	NA	NA	NA	NA
WP_027242989.1|1958645_1959350_-	flagellar basal body L-ring protein FlgH	NA	NA	NA	NA	NA
WP_027242990.1|1959395_1960181_-	flagellar basal-body rod protein FlgG	NA	NA	NA	NA	NA
WP_027242991.1|1960208_1960946_-	flagellar basal body rod protein FlgF	NA	NA	NA	NA	NA
WP_016210285.1|1961050_1963246_-	flagellar hook-basal body complex protein	NA	NA	NA	NA	NA
WP_027242992.1|1963320_1964004_-	flagellar hook assembly protein FlgD	NA	NA	NA	NA	NA
WP_027242993.1|1964014_1964446_-	flagellar basal body rod protein FlgC	NA	NA	NA	NA	NA
WP_027242994.1|1964491_1964890_-	flagellar basal body rod protein FlgB	NA	NA	NA	NA	NA
WP_027242995.1|1965266_1965974_+	flagellar basal body P-ring formation protein FlgA	NA	NA	NA	NA	NA
WP_027242996.1|1966038_1966335_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242997.1|1966376_1966853_+	flagellar protein FlgN	NA	NA	NA	NA	NA
WP_027242998.1|1966906_1967428_-	peptidylprolyl isomerase	NA	A0A1V0SCU1	Indivirus	53.4	3.8e-25
WP_027242999.1|1967509_1968604_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_048876031.1|1969570_1970974_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017375890.1|1971143_1971707_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375891.1|1971842_1973318_-	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_017375892.1|1973324_1973531_-	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_017375893.1|1973588_1974659_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_027243001.1|1974856_1976827_-	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	36.9	7.2e-77
WP_017375757.1|1977187_1978747_+	APC family permease	NA	NA	NA	NA	NA
WP_144420701.1|1979343_1979700_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243002.1|1980540_1981200_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_027243003.1|1981295_1982657_+	two-component sensor histidine kinase	NA	NA	NA	NA	NA
WP_162038649.1|1982798_1983955_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.0	4.4e-50
WP_017375762.1|1984077_1985418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080963648.1|1986068_1986230_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_157894735.1|1987510_1988350_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	33.3	1.3e-19
WP_036771330.1|1988429_1989404_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_047927692.1|1989423_1989612_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 21
NZ_CP012508	Piscirickettsia salmonis strain PM32597B1 chromosome, complete genome	3186149	2007114	2074403	3186149	transposase	Acinetobacter_phage(22.22%)	49	NA	NA
WP_048876034.1|2007114_2007807_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017375561.1|2007803_2007947_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_162038649.1|2009290_2010447_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.0	4.4e-50
WP_017375766.1|2010824_2012855_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375767.1|2012921_2013947_-	FUSC family protein	NA	NA	NA	NA	NA
WP_027242772.1|2013939_2014986_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771312.1|2015126_2016122_+	glycosyl hydrolase family 17	NA	NA	NA	NA	NA
WP_048876036.1|2016419_2017058_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.7	2.1e-09
WP_017375978.1|2017771_2018959_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375977.1|2019124_2020078_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_036771316.1|2020100_2022119_+	DEAD/DEAH box helicase family protein	NA	NA	NA	NA	NA
WP_017375975.1|2022207_2022531_-	YqcC family protein	NA	NA	NA	NA	NA
WP_155046584.1|2022779_2022956_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053093677.1|2023183_2023903_+|transposase	IS982-like element ISPsa1 family transposase	transposase	NA	NA	NA	NA
WP_016209463.1|2024518_2024902_-	HU family DNA-binding protein	NA	NA	NA	NA	NA
WP_048876037.1|2025546_2026020_-	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_027242774.1|2026125_2027496_-	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_048876038.1|2027611_2028343_+	glucosaminidase domain-containing protein	NA	M1IDP9	Pelagibacter_phage	35.8	9.1e-09
WP_027242775.1|2028367_2029465_-	alanine racemase	NA	NA	NA	NA	NA
WP_048876039.1|2029500_2030919_-	replicative DNA helicase	NA	A0A077SK18	Escherichia_phage	62.1	2.0e-153
WP_027242777.1|2031128_2031581_-	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_016209480.1|2031592_2031820_-	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_027242778.1|2031869_2032196_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_027242779.1|2032399_2033089_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_036771340.1|2033237_2033726_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_036771342.1|2033766_2034867_-	3-dehydroquinate synthase	NA	NA	NA	NA	NA
WP_027242782.1|2034912_2035995_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	42.4	4.5e-73
WP_157894738.1|2035987_2036518_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771345.1|2036538_2037843_-	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_048876041.1|2037896_2038919_-	chorismate mutase	NA	NA	NA	NA	NA
WP_027242785.1|2038943_2039960_-	3-deoxy-7-phosphoheptulonate synthase	NA	NA	NA	NA	NA
WP_051929892.1|2040392_2043515_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051929877.1|2043911_2044535_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378208.1|2045317_2046868_-	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_017378207.1|2047162_2047918_+	ZIP family metal transporter	NA	NA	NA	NA	NA
WP_036771639.1|2048626_2049601_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_017378201.1|2052509_2053181_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875961.1|2054259_2055663_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027242788.1|2057250_2060652_-	UvrD-helicase domain-containing protein	NA	S5M596	Bacillus_phage	23.3	4.5e-10
WP_017378193.1|2060648_2063342_-	PD-(D/E)XK nuclease family protein	NA	NA	NA	NA	NA
WP_017378192.1|2063645_2065145_+	sugar porter family MFS transporter	NA	O13311	Aichi_virus	28.1	2.2e-33
WP_027242789.1|2065811_2066633_-	DUF1338 domain-containing protein	NA	NA	NA	NA	NA
WP_146619408.1|2066704_2067190_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|2067338_2068742_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017378188.1|2068738_2069809_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242790.1|2070054_2072229_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378184.1|2072251_2072932_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_144420705.1|2072960_2073161_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162038666.1|2073246_2074403_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.0	4.4e-50
>prophage 22
NZ_CP012508	Piscirickettsia salmonis strain PM32597B1 chromosome, complete genome	3186149	2084510	2135609	3186149	transposase	Acinetobacter_phage(27.27%)	48	NA	NA
WP_075275340.1|2084510_2085119_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048875904.1|2085649_2086525_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_051929548.1|2086765_2087440_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_080999996.1|2087468_2087957_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	30.9	7.4e-15
WP_080999997.1|2089002_2089437_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|2089642_2091046_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_047927811.1|2091293_2092805_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876046.1|2093765_2094059_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.4	4.1e-05
WP_144420706.1|2094016_2094595_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.8	1.1e-28
WP_048876047.1|2094680_2095556_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017378015.1|2095548_2095905_+|transposase	transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	52.0	3.5e-22
WP_017378014.1|2095913_2096309_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_169834775.1|2096809_2096968_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082300708.1|2097633_2098194_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048876048.1|2099316_2101206_-	SpoIIE family protein phosphatase	NA	NA	NA	NA	NA
WP_027243106.1|2101240_2102446_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420707.1|2102448_2103747_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243104.1|2103727_2104951_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243103.1|2105000_2105801_-	TauD/TfdA family dioxygenase	NA	NA	NA	NA	NA
WP_017377848.1|2105797_2106196_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_027243102.1|2106192_2106501_-	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_017377694.1|2106894_2107623_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_017377851.1|2107663_2108308_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_017377852.1|2108320_2108788_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_036771330.1|2108842_2109817_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017377854.1|2109846_2110446_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_017377855.1|2110442_2110904_-	DUF4381 domain-containing protein	NA	NA	NA	NA	NA
WP_017377856.1|2110947_2111883_-	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_017377857.1|2111910_2112906_-	MoxR family ATPase	NA	NA	NA	NA	NA
WP_017377858.1|2113149_2114112_-	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_169834776.1|2115155_2115305_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377694.1|2115539_2116268_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_080963626.1|2116318_2117953_+	BatD family protein	NA	NA	NA	NA	NA
WP_017377862.1|2118223_2119411_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377863.1|2120012_2120450_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377865.1|2122983_2123256_+	metal/formaldehyde-sensitive transcriptional repressor	NA	NA	NA	NA	NA
WP_036772457.1|2123331_2123640_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772454.1|2126115_2126433_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|2126589_2127564_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_048876051.1|2127560_2127917_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876052.1|2128030_2128777_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375910.1|2128745_2129474_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_017377223.1|2130218_2130506_+|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_155046582.1|2130565_2130730_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876053.1|2130726_2132130_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_053093670.1|2132243_2132924_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.0	1.1e-43
WP_017376296.1|2133209_2133926_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876055.1|2134703_2135609_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 23
NZ_CP012508	Piscirickettsia salmonis strain PM32597B1 chromosome, complete genome	3186149	2150772	2212557	3186149	transposase,protease,tRNA	Acinetobacter_phage(20.0%)	56	NA	NA
WP_036771957.1|2150772_2151744_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_157894741.1|2153967_2155098_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162038643.1|2155066_2155210_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377033.1|2155437_2155749_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420710.1|2156226_2156532_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242870.1|2156853_2157384_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377031.1|2157830_2158760_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	30.6	2.2e-31
WP_144420711.1|2158916_2159342_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375625.1|2159458_2159686_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|2159839_2160814_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_080999998.1|2161080_2161350_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_048876057.1|2161494_2162544_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377028.1|2162611_2163517_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_027242871.1|2163833_2164595_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_016211971.1|2164796_2165408_-	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_051929560.1|2165428_2166628_-	site-specific DNA-methyltransferase	NA	A0A2L1IZ21	Streptomyces_phage	33.2	2.7e-42
WP_017377024.1|2166722_2166863_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377023.1|2166875_2167280_-	SufE family protein	NA	NA	NA	NA	NA
WP_017377022.1|2167510_2168080_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377021.1|2168146_2169187_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162038649.1|2169213_2170370_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.0	4.4e-50
WP_027242872.1|2170491_2171349_-	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	NA	NA	NA	NA
WP_144420712.1|2171345_2172107_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242873.1|2172191_2174921_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875904.1|2175054_2175930_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_065653747.1|2176194_2177535_-	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_016209885.1|2177597_2178311_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_027242875.1|2178479_2178971_+	Spy/CpxP family protein refolding chaperone	NA	NA	NA	NA	NA
WP_017377014.1|2179110_2179602_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242876.1|2179804_2180695_+	Rossmann-like and DUF2520 domain-containing protein	NA	NA	NA	NA	NA
WP_026063591.1|2181079_2181664_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_027242877.1|2181744_2182683_-	signal peptide peptidase SppA	NA	A0A2I6UGK8	Salinibacter_virus	30.1	4.9e-15
WP_036771855.1|2182734_2183829_-	FUSC family protein	NA	NA	NA	NA	NA
WP_047927528.1|2183953_2185276_+	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	39.9	7.3e-65
WP_053856760.1|2185323_2190210_-	NAD-glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_017377007.1|2190304_2190607_-	DUF2835 family protein	NA	NA	NA	NA	NA
WP_027242879.1|2190717_2192640_+	PrkA family serine protein kinase	NA	NA	NA	NA	NA
WP_027242880.1|2192661_2193957_+	YeaH/YhbH family protein	NA	A0A219UQP6	Bacillus_phage	32.8	1.2e-06
WP_017377006.1|2193953_2195564_+	SpoVR family protein	NA	NA	NA	NA	NA
WP_052106204.1|2195670_2196564_-	thiol:disulfide interchange protein DsbG	NA	NA	NA	NA	NA
WP_017377003.1|2196673_2197297_+|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_017377001.1|2198003_2198702_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_017377000.1|2198845_2199415_-	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_026063589.1|2199730_2200357_-	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_017376998.1|2200553_2201300_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376997.1|2201395_2202235_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	I6XGV6	Vibriophage	35.3	1.0e-32
WP_016210463.1|2202285_2202633_-	phosphomannose isomerase type II C-terminal cupin domain	NA	A0A1V0SH58	Hokovirus	42.1	9.2e-20
WP_017376996.1|2202823_2203711_+	ROK family protein	NA	NA	NA	NA	NA
WP_017376995.1|2203825_2204428_-	HAD family phosphatase	NA	NA	NA	NA	NA
WP_017376994.1|2204424_2205144_-	TIGR00266 family protein	NA	NA	NA	NA	NA
WP_080963631.1|2205212_2206925_-	ABC transporter ATP-binding protein/permease	NA	NA	NA	NA	NA
WP_017376991.1|2207072_2209010_+	AsmA family protein	NA	NA	NA	NA	NA
WP_027242882.1|2209122_2210172_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_017376990.1|2210171_2210447_+	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_017376989.1|2210527_2211076_+	DUF2147 domain-containing protein	NA	NA	NA	NA	NA
WP_162038666.1|2211400_2212557_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.0	4.4e-50
>prophage 24
NZ_CP012508	Piscirickettsia salmonis strain PM32597B1 chromosome, complete genome	3186149	2236522	2280803	3186149	transposase,integrase	Staphylococcus_phage(45.45%)	41	2237956:2238015	2280759:2282300
WP_036771330.1|2236522_2237497_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_155046579.1|2237812_2237974_+	hypothetical protein	NA	NA	NA	NA	NA
2237956:2238015	attL	GCTAATGGCACTACCTTAAGGAGCGGATGAACATTTTTTATTGCTATTTTTCTTCATTCT	NA	NA	NA	NA
WP_048876031.1|2237970_2239374_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377823.1|2239487_2240255_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|2240613_2242017_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_080963604.1|2242837_2243038_-	zf-TFIIB domain-containing protein	NA	NA	NA	NA	NA
WP_017377826.1|2243278_2244724_+	MFS transporter	NA	NA	NA	NA	NA
WP_048875904.1|2245919_2246795_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_027243174.1|2248246_2248528_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047927196.1|2249085_2250105_-	thiamine-phosphate kinase	NA	NA	NA	NA	NA
WP_017376520.1|2250091_2250514_-	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_017376521.1|2250515_2250989_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	43.4	2.4e-26
WP_017376522.1|2251114_2251771_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	44.2	6.8e-40
WP_017376523.1|2251767_2252442_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	37.7	6.0e-31
WP_017376524.1|2252447_2253596_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	34.8	4.7e-44
WP_017376525.1|2253592_2254054_-	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_017376526.1|2254129_2255380_-	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	54.4	2.4e-102
WP_017376527.1|2255506_2257186_+	energy-dependent translational throttle protein EttA	NA	A0A2K9L3Z8	Tupanvirus	26.6	3.0e-39
WP_027243172.1|2257297_2258179_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772261.1|2259266_2259860_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_017375619.1|2261007_2261532_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A0P0I4A4	Acinetobacter_phage	29.0	1.4e-11
WP_017375618.1|2261676_2261961_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_169834777.1|2261989_2262127_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420804.1|2262510_2262786_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771330.1|2263158_2264133_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_027242983.1|2264289_2264928_-	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_017377745.1|2265009_2265408_-	VOC family protein	NA	NA	NA	NA	NA
WP_017377746.1|2265560_2265878_-	helix-hairpin-helix domain-containing protein	NA	NA	NA	NA	NA
WP_017377747.1|2265956_2266211_-	LapA family protein	NA	NA	NA	NA	NA
WP_017377748.1|2266363_2268025_-	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_017377749.1|2268085_2268769_-	(d)CMP kinase	NA	NA	NA	NA	NA
WP_036773645.1|2268768_2269854_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	43.3	9.8e-76
WP_036773644.1|2269895_2272532_-	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	32.6	1.5e-98
WP_155051395.1|2273511_2273655_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377754.1|2274336_2275656_+	TRZ/ATZ family hydrolase	NA	NA	NA	NA	NA
WP_017377755.1|2275659_2276376_+	bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG	NA	NA	NA	NA	NA
WP_017377756.1|2276372_2277014_+	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_144420715.1|2277006_2277141_+	VOC family protein	NA	NA	NA	NA	NA
WP_027242981.1|2277389_2277845_-	VOC family protein	NA	NA	NA	NA	NA
WP_027242980.1|2277936_2278281_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_048876031.1|2279399_2280803_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
2280759:2282300	attR	AGAATGAAGAAAAATAGCAATAAAAAATGTTCATCCGCTCCTTAAGGTAGTGCCATTAGCCAATAAACTGACTACTGCCAGGCAAATAATAGCCAATAAGCAAACCCGTAGCAATTGCTACAAATATCCACACGGTTAAGTAACGATCTAAAAAGCCTAAACTCTTCAACAATAACTCCGATATATATCAATATATTTATATATACCAATGTAACAATATAATTATTCATTTACAAGGTTGATACAGACAATCGTTATTGTGTTATATAAAATAACCTGCAAAAAACTCAATTGAGCATAAAAAATAAAACCAAATCAGATAAATATCAAGCAATATTAAAGGCCACTTCCTTGTACAAAGAGATCTATGAAAAAATAGAACACTTTTTATGTAGAAAAAAAATATTTTTTGCATTAGAATAGGTAAAAATACATTTACAAACTCACTAAGTCATAGGCGGCTCTAATCATCGGCCAGCCCAATATATCCGCATTTTAAAAGAGAATATGTTACAATACTTTAAATTTGAAACTGTTTTTATAAAAACAGCCTTTATTGCTATAATCTCACTCATTTTTGCTGTGACAAACTTTGTGCATGCGAGTGAGTTTACCTTTCAACAAGATGATGGCTTAATTAATGGTGACTGGGTCCGTCTTGTACAACCCAGCCTGCCTCTTGGTACTCAAATCAACTCACTTGCCTTAACACAAGCAGGCGACACTCTATATATCAACACTCAATCTGTCGGTAGTTTCCTTTGTCAAGGAGATATCTGTAATCAACTAAAGCACACCTTGCCACAATTTAATCACTCTTCTCACATTAATTTTATTGCAATGTTGCAAAAATCGAACCTTATAAAAATTATTAAAGAATTACCTACTGATGTAAGTATATTTTCAGCGAGAGTTATTCACAGCACAAAAAAAATATTTGTTGGCACACGCGCTCATAGTGCCTATCTCTATGATAAAGGAGCTTGGCAACACCTCAGTGCGTCAACAAAATCACCATCATTGCCTAAAAATTCATGGGTCTACACCATAGCAAGTTCTCACAATGGCGATAAAGTACTTATTGGTACAATGAACCATGGCGCTTATCTATGGAGAAATAACCACTGGAAGCATTTAACCATTGCTACAGAACATCCACTGACTAAATATAGCTGGATTTACAAGAGCAGCATTTCAAAAGATGGCAGTACAATCGTTATCGCCACCCACAGTAATGGTGTCTTTCTTTACCAAAATAAACATTGGCAACATTTAGATAACCCTAATCAATCAGGCCTACAAAAAAACACACTTGTTAACTCTATTTCCATGTCAGACAATGGTAAAACCATTTTATTAGGTACATTACTAGGCGCTTACCTTTATCAACAAGGCCAGTGGTCACGCATCCACAAGCATCACCATAACCTTAAACTCAAAACGATCACAGCTACCTATGTTTCTCCAAACGGAAAAACCATGCTTATCGGTACTCAACTTGGGGCTATTTATATCCGCCAACTAGAACTATTCAACTAAAAT	NA	NA	NA	NA
>prophage 25
NZ_CP012508	Piscirickettsia salmonis strain PM32597B1 chromosome, complete genome	3186149	2335721	2388301	3186149	transposase,tRNA	Synechococcus_phage(14.29%)	45	NA	NA
WP_048875859.1|2335721_2336516_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_036773621.1|2336805_2337729_-	EamA family transporter RarD	NA	NA	NA	NA	NA
WP_017377984.1|2337996_2338290_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377983.1|2339492_2340416_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377982.1|2340551_2341394_-	isopenicillin N synthase family oxygenase	NA	NA	NA	NA	NA
WP_017377981.1|2341481_2342132_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	34.6	2.7e-20
WP_026063695.1|2342145_2343204_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SR00	Cyanophage	45.3	3.0e-69
WP_036773623.1|2343308_2344394_+	DUF2066 domain-containing protein	NA	NA	NA	NA	NA
WP_027243121.1|2344420_2345530_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_017377976.1|2345834_2346152_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_017377975.1|2346148_2346508_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_017377974.1|2346610_2349343_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052106250.1|2350832_2351357_-	LD-carboxypeptidase	NA	NA	NA	NA	NA
WP_036773260.1|2351636_2351975_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420716.1|2352119_2353328_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_065653755.1|2353755_2355213_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375695.1|2356048_2356324_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036773050.1|2359027_2359207_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026063690.1|2359203_2359575_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375625.1|2359585_2359813_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169834778.1|2361181_2361349_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275437.1|2361871_2362090_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212534.1|2362580_2362847_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243154.1|2364811_2366062_+	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_036773486.1|2366050_2366908_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_017377906.1|2366924_2368010_-	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.2	4.3e-07
WP_017377907.1|2368006_2369266_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_017377908.1|2369434_2370094_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065653730.1|2370264_2370927_+	outer membrane lipoprotein LolB	NA	NA	NA	NA	NA
WP_026063691.1|2371273_2372221_+	ribose-phosphate pyrophosphokinase	NA	A0A1V0SHF7	Hokovirus	34.3	3.4e-40
WP_017377911.1|2372317_2372944_+	50S ribosomal protein L25/general stress protein Ctc	NA	NA	NA	NA	NA
WP_017377912.1|2372949_2373531_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_017377913.1|2373602_2374694_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_017377914.1|2374783_2375497_+	5'-methylthioadenosine/adenosylhomocysteine nucleosidase	NA	NA	NA	NA	NA
WP_027243155.1|2375590_2376415_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_144420808.1|2376648_2377326_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377920.1|2379003_2379261_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|2379661_2380636_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_048876067.1|2380810_2381455_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420720.1|2381628_2382429_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036774583.1|2383127_2383778_+	LexA family transcriptional regulator	NA	NA	NA	NA	NA
WP_047927392.1|2384027_2384879_+	queuosine precursor transporter	NA	NA	NA	NA	NA
WP_017377925.1|2385170_2385563_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047927390.1|2386064_2387156_-	hypothetical protein	NA	A0A0P0IY73	Acinetobacter_phage	31.7	3.4e-36
WP_087910651.1|2388124_2388301_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	46.2	5.5e-05
>prophage 26
NZ_CP012508	Piscirickettsia salmonis strain PM32597B1 chromosome, complete genome	3186149	2405923	2424403	3186149	transposase,protease	Staphylococcus_phage(28.57%)	15	NA	NA
WP_017377942.1|2405923_2406430_+|protease	protease inhibitor I42 family protein	protease	NA	NA	NA	NA
WP_027243059.1|2406475_2409427_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_017377945.1|2409448_2409781_+	GIY-YIG nuclease family protein	NA	D7F5V9	Apocheima_cinerarium_nucleopolyhedrovirus	34.2	4.7e-05
WP_047927125.1|2409898_2410408_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774650.1|2412171_2413338_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377687.1|2413482_2414235_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|2414590_2415565_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_016209908.1|2415697_2416408_+	winged helix-turn-helix domain-containing protein	NA	W8CYM9	Bacillus_phage	34.8	2.2e-31
WP_017377690.1|2416404_2417439_+	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	34.2	1.3e-32
WP_017377691.1|2417542_2417884_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876071.1|2418394_2419555_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	32.0	3.8e-25
WP_069971647.1|2419523_2420120_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046570.1|2421088_2421259_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|2421255_2422230_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_087910645.1|2423249_2424403_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	8.9e-59
>prophage 27
NZ_CP012508	Piscirickettsia salmonis strain PM32597B1 chromosome, complete genome	3186149	2457885	2505300	3186149	plate,transposase,tRNA	Staphylococcus_phage(40.0%)	44	NA	NA
WP_027242850.1|2457885_2458842_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_027242851.1|2458823_2460512_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_017376356.1|2460508_2460907_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_017376355.1|2460906_2462379_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_027242852.1|2462384_2462873_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_027242853.1|2462865_2464335_-	type VI secretion system domain-containing protein	NA	NA	NA	NA	NA
WP_027242854.1|2464339_2465032_-	DUF3540 domain-containing protein	NA	NA	NA	NA	NA
WP_027242855.1|2465009_2466038_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_027242856.1|2466031_2467258_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_027242857.1|2467263_2468775_-	DUF2169 domain-containing protein	NA	NA	NA	NA	NA
WP_017376343.1|2469035_2469473_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_027242858.1|2469549_2470857_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_027242859.1|2470861_2471572_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_027242860.1|2471584_2474755_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242861.1|2474821_2475958_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169834779.1|2476505_2476676_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376336.1|2476820_2477678_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376335.1|2477819_2478620_-	adenosylmethionine decarboxylase	NA	NA	NA	NA	NA
WP_017376334.1|2478718_2479294_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	50.0	3.2e-57
WP_027242862.1|2479376_2480048_-	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_027242863.1|2480093_2480993_+	DUF3530 family protein	NA	NA	NA	NA	NA
WP_017376331.1|2481027_2481411_-	response regulator	NA	NA	NA	NA	NA
WP_017376330.1|2481560_2482325_-	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_017376329.1|2482315_2483026_-	nucleotidyltransferase family protein	NA	NA	NA	NA	NA
WP_017376328.1|2483022_2484048_-	phosphotransferase	NA	NA	NA	NA	NA
WP_048876074.1|2484178_2486683_+	LPS-assembly protein LptD	NA	NA	NA	NA	NA
WP_017376325.1|2486689_2487958_+	peptidyl-prolyl cis-trans isomerase SurA	NA	NA	NA	NA	NA
WP_017376324.1|2487959_2488943_+	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_017376323.1|2488955_2489777_+	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_017376322.1|2489821_2490214_+	Co2+/Mg2+ efflux protein ApaG	NA	NA	NA	NA	NA
WP_017376321.1|2490288_2491095_+	symmetrical bis(5'-nucleosyl)-tetraphosphatase	NA	NA	NA	NA	NA
WP_036774104.1|2491282_2491711_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|2491769_2492744_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017375660.1|2492767_2493205_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|2493239_2494643_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376011.1|2495223_2495385_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376015.1|2496605_2496977_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242569.1|2497084_2498635_-	apolipoprotein N-acyltransferase	NA	NA	NA	NA	NA
WP_017376017.1|2498667_2499507_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_017376018.1|2499503_2500019_-	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_017376019.1|2500022_2501015_-	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	45.1	9.3e-49
WP_017376020.1|2501393_2502764_-|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_027242570.1|2502972_2504112_+	hypothetical protein	NA	A0A0F6YPT7	Sinorhizobium_phage	41.7	9.3e-61
WP_075275355.1|2504325_2505300_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	4.3e-30
>prophage 28
NZ_CP012508	Piscirickettsia salmonis strain PM32597B1 chromosome, complete genome	3186149	2530600	2575168	3186149	transposase,tRNA	Escherichia_phage(12.5%)	37	NA	NA
WP_026063546.1|2530600_2531275_+|tRNA	tRNA (guanosine(18)-2'-O)-methyltransferase TrmH	tRNA	NA	NA	NA	NA
WP_017376619.1|2531303_2531708_+	RidA family protein	NA	NA	NA	NA	NA
WP_027243116.1|2531732_2532692_-	response regulator	NA	NA	NA	NA	NA
WP_017376616.1|2532824_2533607_-	MFS transporter	NA	NA	NA	NA	NA
WP_075275357.1|2533708_2534668_+|transposase	IS3 family transposase	transposase	A0A0N7C035	Escherichia_phage	34.3	1.2e-13
WP_017376613.1|2534812_2535160_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017376611.1|2536372_2536909_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376610.1|2537716_2538727_+	DUF475 domain-containing protein	NA	A0A172Q0Y5	Acinetobacter_phage	40.6	9.5e-57
WP_053856763.1|2539068_2540079_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875883.1|2540223_2540760_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_051929685.1|2541019_2541922_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_017376607.1|2542911_2543901_+	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G9BWD6	Planktothrix_phage	32.4	4.5e-19
WP_017376606.1|2544069_2544408_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376605.1|2544404_2544980_+	ribonuclease HI	NA	M4QMN0	Micromonas_pusilla_virus	55.1	1.1e-33
WP_017376604.1|2545028_2545244_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376603.1|2545430_2546270_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	43.6	1.4e-45
WP_017376601.1|2549966_2550875_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875882.1|2551005_2551662_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_053856764.1|2551770_2552697_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036772137.1|2553015_2553576_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377036.1|2554045_2555365_+	LbtU family siderophore porin	NA	NA	NA	NA	NA
WP_017377037.1|2555432_2556299_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.1	6.3e-25
WP_036772169.1|2556291_2557167_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017377039.1|2557225_2557444_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377041.1|2558844_2559174_-	Grx4 family monothiol glutaredoxin	NA	NA	NA	NA	NA
WP_026063593.1|2559408_2560113_+	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_017377043.1|2560093_2562322_-	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	34.8	1.7e-82
WP_017377044.1|2562584_2563598_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_017377045.1|2563706_2563928_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377046.1|2563932_2565570_-	NAD+ synthase	NA	A0A2L0UZF5	Agrobacterium_phage	37.8	3.4e-88
WP_017377047.1|2565708_2566242_+	type II transport protein GspH	NA	NA	NA	NA	NA
WP_017377048.1|2566362_2567481_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_162038676.1|2567539_2568796_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772661.1|2568782_2569919_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377052.1|2570149_2570575_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242609.1|2573904_2574258_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772169.1|2574292_2575168_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 29
NZ_CP012508	Piscirickettsia salmonis strain PM32597B1 chromosome, complete genome	3186149	2634725	2687818	3186149	transposase	Staphylococcus_phage(22.22%)	49	NA	NA
WP_036773116.1|2634725_2635700_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_069971661.1|2635696_2636134_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875878.1|2636308_2637712_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377105.1|2637722_2637998_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377106.1|2638275_2638746_-	Hsp20 family protein	NA	A0A1B1IW69	uncultured_Mediterranean_phage	36.6	6.0e-22
WP_017377107.1|2639048_2640419_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	45.1	1.5e-110
WP_075275363.1|2640748_2641216_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_017377110.1|2641228_2642239_-	DUF481 domain-containing protein	NA	NA	NA	NA	NA
WP_053856766.1|2642440_2643844_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_169834780.1|2643907_2644048_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242632.1|2644270_2645059_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_171824211.1|2645045_2646068_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.0	1.4e-15
WP_017377113.1|2646051_2646456_-	glycine-rich domain-containing protein-like	NA	NA	NA	NA	NA
WP_017377115.1|2646683_2648651_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_017377116.1|2648846_2649338_+	copper chaperone PCu(A)C	NA	NA	NA	NA	NA
WP_026063598.1|2649372_2650215_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_017377118.1|2650260_2650713_-	Spy/CpxP family protein refolding chaperone	NA	NA	NA	NA	NA
WP_017377119.1|2651002_2651635_+	LysE family translocator	NA	NA	NA	NA	NA
WP_017377120.1|2651635_2652886_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	46.4	2.7e-93
WP_027242633.1|2652919_2654017_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	34.9	3.5e-49
WP_017375625.1|2654346_2654574_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053856767.1|2658444_2659848_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017375801.1|2659844_2660885_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047927106.1|2661277_2661673_+	YchJ family protein	NA	NA	NA	NA	NA
WP_144420816.1|2661669_2662458_-	DUF45 domain-containing protein	NA	NA	NA	NA	NA
WP_017375804.1|2662643_2663369_-	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_017375805.1|2663613_2664801_+	S-methyl-5-thioribose kinase	NA	NA	NA	NA	NA
WP_017375806.1|2665093_2665636_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375807.1|2665632_2666319_-	acireductone synthase	NA	NA	NA	NA	NA
WP_017375808.1|2666322_2666934_-	methylthioribulose 1-phosphate dehydratase	NA	NA	NA	NA	NA
WP_017375809.1|2666980_2668000_-	S-methyl-5-thioribose-1-phosphate isomerase	NA	NA	NA	NA	NA
WP_017375810.1|2668102_2668897_-	thymidylate synthase	NA	A0A2R4A1R4	Microbacterium_phage	69.0	1.1e-103
WP_017375811.1|2668910_2669711_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_017375812.1|2669789_2670839_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_026063478.1|2671014_2672295_+	inorganic phosphate transporter	NA	E5ESL8	Bathycoccus_sp._RCC1105_virus	34.7	4.6e-24
WP_027242634.1|2672340_2673018_+	TIGR00153 family protein	NA	NA	NA	NA	NA
WP_017375815.1|2673103_2673385_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_075275366.1|2673476_2674331_-	MFS transporter	NA	NA	NA	NA	NA
WP_162287775.1|2674270_2674666_-	MFS transporter	NA	S4TR35	Salmonella_phage	31.4	1.2e-07
WP_027242636.1|2675196_2676138_+	DMT family transporter	NA	NA	NA	NA	NA
WP_017375821.1|2676856_2677078_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875923.1|2677074_2678070_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036773936.1|2679919_2680675_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375825.1|2680869_2682363_-	amino acid permease	NA	NA	NA	NA	NA
WP_129556626.1|2682809_2684198_-	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_017375827.1|2684629_2685067_+	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_027242638.1|2685314_2685743_+	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_047927246.1|2685863_2686301_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875873.1|2686414_2687818_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 30
NZ_CP012508	Piscirickettsia salmonis strain PM32597B1 chromosome, complete genome	3186149	2730778	2790902	3186149	transposase	Staphylococcus_phage(18.18%)	56	NA	NA
WP_048876031.1|2730778_2732182_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420729.1|2732301_2732940_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036774259.1|2733287_2734262_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_027242659.1|2734570_2735596_-	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	76.9	2.0e-17
WP_017377361.1|2735703_2736909_-	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	26.6	1.7e-36
WP_017377360.1|2737143_2737557_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377358.1|2738058_2738628_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377357.1|2738630_2738969_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377356.1|2738961_2739495_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377355.1|2739513_2739804_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242660.1|2739890_2741522_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377353.1|2742074_2742578_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A167R6J9	Powai_lake_megavirus	41.2	1.9e-13
WP_017377352.1|2742540_2743248_-	dethiobiotin synthase	NA	NA	NA	NA	NA
WP_017377351.1|2743312_2744173_-	malonyl-ACP O-methyltransferase BioC	NA	NA	NA	NA	NA
WP_017377350.1|2744153_2744927_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_017377349.1|2744957_2746196_-	8-amino-7-oxononanoate synthase	NA	NA	NA	NA	NA
WP_036773024.1|2746195_2747158_-	biotin synthase BioB	NA	NA	NA	NA	NA
WP_017377348.1|2747201_2747954_+	ComF family protein	NA	NA	NA	NA	NA
WP_017377345.1|2750482_2750719_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420819.1|2750737_2751187_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377343.1|2751407_2752832_+	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	M4QSA2	Synechococcus_phage	42.3	1.0e-16
WP_027242661.1|2752896_2753934_-	UDP-N-acetylmuramate dehydrogenase	NA	NA	NA	NA	NA
WP_036818827.1|2754236_2754968_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420730.1|2754998_2755889_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377336.1|2757231_2760042_+	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
WP_048875864.1|2760334_2761360_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_027242662.1|2761773_2762601_+	HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_017377694.1|2762770_2763499_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_048876012.1|2763699_2765103_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376920.1|2765248_2765746_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376921.1|2766975_2767308_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772950.1|2767369_2767906_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376923.1|2768004_2769171_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	26.7	1.3e-25
WP_017376924.1|2769476_2772275_+	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2H4P767	Pseudomonas_phage	45.1	1.1e-179
WP_017376925.1|2772333_2773554_+	ribonucleotide-diphosphate reductase subunit beta	NA	A0A1V0EEL7	Caulobacter_phage	28.7	4.2e-35
WP_017376927.1|2774059_2774197_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376929.1|2774623_2774911_+	4a-hydroxytetrahydrobiopterin dehydratase	NA	NA	NA	NA	NA
WP_017376930.1|2775067_2775397_+	integration host factor subunit beta	NA	NA	NA	NA	NA
WP_017376931.1|2775431_2777069_-	response regulator	NA	NA	NA	NA	NA
WP_017376932.1|2777170_2778220_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376933.1|2778292_2778937_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026063581.1|2778933_2780187_-	UbiH/UbiF/VisC/COQ6 family ubiquinone biosynthesis hydroxylase	NA	NA	NA	NA	NA
WP_017376935.1|2780204_2781476_-	FAD-dependent monooxygenase	NA	NA	NA	NA	NA
WP_017376936.1|2781500_2782091_-	UPF0149 family protein	NA	NA	NA	NA	NA
WP_017376937.1|2782235_2782460_+	TIGR02449 family protein	NA	NA	NA	NA	NA
WP_016209991.1|2782440_2782770_+	cell division protein ZapA	NA	NA	NA	NA	NA
WP_026063582.1|2782996_2783560_+	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
WP_017376939.1|2783596_2784058_+	EVE domain-containing protein	NA	NA	NA	NA	NA
WP_017376940.1|2784135_2785821_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.6	2.9e-26
WP_026063583.1|2785870_2786698_-	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_016210000.1|2786697_2787246_-	ADP compounds hydrolase NudE	NA	NA	NA	NA	NA
WP_017376942.1|2787375_2787768_+	ribosome-associated heat shock protein Hsp15	NA	NA	NA	NA	NA
WP_017376943.1|2788018_2788276_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087910653.1|2789088_2789304_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046563.1|2789320_2789458_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069971662.1|2789927_2790902_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	9.5e-30
>prophage 31
NZ_CP012508	Piscirickettsia salmonis strain PM32597B1 chromosome, complete genome	3186149	2794555	2833887	3186149	protease,transposase,tRNA	Staphylococcus_phage(33.33%)	43	NA	NA
WP_048875861.1|2794555_2795425_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_026063584.1|2795946_2796906_-	lipoyl synthase	NA	NA	NA	NA	NA
WP_017376953.1|2796902_2797550_-	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
WP_017376954.1|2797578_2798430_-	D-amino acid aminotransferase	NA	NA	NA	NA	NA
WP_017376955.1|2798444_2799722_-	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	39.0	2.8e-66
WP_017376956.1|2799762_2800278_-	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_017376957.1|2800355_2801417_-	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_036818645.1|2801438_2802527_-	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_017376959.1|2802571_2804407_-	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_016210381.1|2804449_2804920_-	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_016210374.1|2804956_2805292_-	ribosome silencing factor	NA	NA	NA	NA	NA
WP_027242665.1|2805304_2805961_-	nicotinate-nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_036772771.1|2805957_2806998_-	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_017376963.1|2806970_2807450_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376964.1|2807536_2810017_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	43.8	3.8e-192
WP_036772765.1|2810079_2810511_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376966.1|2810711_2811002_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242666.1|2811061_2812660_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	30.1	7.1e-06
WP_017376969.1|2812824_2813160_-	histidine triad nucleotide-binding protein	NA	NA	NA	NA	NA
WP_017376970.1|2813188_2814853_-	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	E5ERK4	Ostreococcus_lucimarinus_virus	28.8	6.4e-34
WP_027242667.1|2814852_2815494_-	SCP2 sterol-binding domain-containing protein	NA	NA	NA	NA	NA
WP_017376972.1|2815493_2816237_-	bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE	NA	NA	NA	NA	NA
WP_017376973.1|2816295_2816532_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376974.1|2816682_2818050_-|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A173GFL6	Erwinia_phage	29.9	1.6e-43
WP_017376975.1|2818060_2818612_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_065653729.1|2818692_2819796_-	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_017376977.1|2819797_2821555_-|tRNA	arginine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_062312189.1|2821777_2822401_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_016210574.1|2822455_2822875_-	TraR/DksA C4-type zinc finger protein	NA	NA	NA	NA	NA
WP_047927116.1|2823015_2823630_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081000001.1|2823687_2824473_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_017376980.1|2825104_2826121_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_144420820.1|2826123_2826636_+	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_017376982.1|2826677_2827151_-|tRNA	tRNA (uridine(34)/cytosine(34)/5- carboxymethylaminomethyluridine(34)-2'-O)- methyltransferase TrmL	tRNA	NA	NA	NA	NA
WP_048875860.1|2827206_2827992_-	DUF21 domain-containing protein	NA	NA	NA	NA	NA
WP_036771653.1|2828035_2828776_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	1.9e-09
WP_017376985.1|2828865_2829114_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087910654.1|2829489_2830143_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_144420733.1|2830111_2830291_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053856770.1|2830688_2831903_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875859.1|2832211_2833006_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017375625.1|2833138_2833366_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772490.1|2833608_2833887_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 32
NZ_CP012508	Piscirickettsia salmonis strain PM32597B1 chromosome, complete genome	3186149	2917548	3028386	3186149	protease,transposase,tRNA	Staphylococcus_phage(13.33%)	102	NA	NA
WP_017378106.1|2917548_2918493_-|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_017378107.1|2918492_2918846_-	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_017378108.1|2918894_2921570_-	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	24.1	1.3e-25
WP_017378109.1|2921586_2923104_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_016209273.1|2923180_2923633_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_017378110.1|2923851_2925291_-	NADH-quinone oxidoreductase subunit NuoN	NA	NA	NA	NA	NA
WP_017378111.1|2925290_2926829_-	NADH-quinone oxidoreductase subunit M	NA	NA	NA	NA	NA
WP_017378112.1|2926843_2928814_-	NADH-quinone oxidoreductase subunit L	NA	NA	NA	NA	NA
WP_016209309.1|2928817_2929123_-	NADH-quinone oxidoreductase subunit NuoK	NA	NA	NA	NA	NA
WP_017378113.1|2929146_2929770_-	NADH-quinone oxidoreductase subunit J	NA	NA	NA	NA	NA
WP_017378114.1|2929789_2930278_-	NADH-quinone oxidoreductase subunit NuoI	NA	NA	NA	NA	NA
WP_027242679.1|2930291_2931317_-	NADH-quinone oxidoreductase subunit NuoH	NA	NA	NA	NA	NA
WP_017378117.1|2931321_2933715_-	NADH-quinone oxidoreductase subunit G	NA	NA	NA	NA	NA
WP_016209307.1|2933764_2935054_-	NADH-quinone oxidoreductase subunit NuoF	NA	NA	NA	NA	NA
WP_017378118.1|2935060_2935561_-	NAD(P)H-dependent oxidoreductase subunit E	NA	NA	NA	NA	NA
WP_017378119.1|2935560_2936814_-	NADH-quinone oxidoreductase subunit D	NA	NA	NA	NA	NA
WP_017378120.1|2936815_2937493_-	NADH-quinone oxidoreductase subunit C	NA	NA	NA	NA	NA
WP_016209262.1|2937510_2937996_-	NADH-quinone oxidoreductase subunit B	NA	NA	NA	NA	NA
WP_016209283.1|2937986_2938355_-	NADH-quinone oxidoreductase subunit A	NA	NA	NA	NA	NA
WP_017378122.1|2939033_2939396_-	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_017378123.1|2939409_2940171_-	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_017378124.1|2940472_2941819_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771461.1|2941915_2942458_-	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	NA	NA	NA	NA
WP_017378126.1|2942573_2943407_+	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
WP_027242680.1|2943428_2944022_+	thymidine kinase	NA	A0A0B7MRR0	Enterobacteria_phage	53.6	6.4e-53
WP_048875856.1|2944197_2945217_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017375625.1|2945661_2945889_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378129.1|2945899_2946223_-	DUF423 domain-containing protein	NA	NA	NA	NA	NA
WP_065653735.1|2946246_2947257_-	lipase	NA	NA	NA	NA	NA
WP_017378132.1|2947323_2948172_-|protease	zinc metalloprotease HtpX	protease	NA	NA	NA	NA
WP_026063707.1|2948288_2949200_-	Nudix family hydrolase	NA	NA	NA	NA	NA
WP_036772169.1|2949966_2950842_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_026063708.1|2950900_2951281_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026063709.1|2951427_2951664_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378135.1|2951960_2952431_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_017378136.1|2952485_2953340_-	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_017378137.1|2953811_2954030_+	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_017378138.1|2954132_2955383_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242681.1|2955438_2955921_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242682.1|2956157_2956586_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773116.1|2956921_2957896_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_017378141.1|2957954_2959007_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378142.1|2959325_2960291_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378143.1|2960593_2961418_-	phenylalanine 4-monooxygenase	NA	NA	NA	NA	NA
WP_017378144.1|2961619_2962696_+	4-hydroxyphenylpyruvate dioxygenase	NA	NA	NA	NA	NA
WP_017378145.1|2962780_2963767_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_017378146.1|2963785_2964430_+	maleylacetoacetate isomerase	NA	NA	NA	NA	NA
WP_027242684.1|2964441_2965551_+	histidinol-phosphate transaminase	NA	A0A142C026	Faustovirus	23.5	1.6e-17
WP_027242685.1|2965617_2966280_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242686.1|2966539_2968423_-	phosphomethylpyrimidine synthase ThiC	NA	NA	NA	NA	NA
WP_017378149.1|2968736_2970236_+	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_017378150.1|2970326_2971109_+	exodeoxyribonuclease III	NA	E3T4M6	Cafeteria_roenbergensis_virus	33.0	1.8e-31
WP_017378151.1|2971236_2972157_+	SPFH/Band 7/PHB domain protein	NA	J3IZE5	Acanthamoeba_polyphaga_lentillevirus	27.5	2.2e-20
WP_017378152.1|2972180_2972639_+	NfeD family protein	NA	NA	NA	NA	NA
WP_048875854.1|2972760_2973636_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017378154.1|2973669_2974935_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772169.1|2975122_2975998_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_048875853.1|2976196_2976388_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875852.1|2976592_2977888_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_075275379.1|2978207_2978426_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375941.1|2978462_2979842_-	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	30.9	3.0e-53
WP_017375942.1|2979869_2980328_-	dUTP diphosphatase	NA	G0YQD9	Erwinia_phage	68.0	3.5e-51
WP_036773720.1|2980305_2981523_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	34.3	6.3e-39
WP_017375944.1|2981715_2981952_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_016210730.1|2981965_2982121_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_017375945.1|2982201_2983164_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_017375947.1|2983323_2984640_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_017375948.1|2984649_2985318_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375949.1|2985728_2987543_+	translational GTPase TypA	NA	A0A1S5SF82	Streptococcus_phage	45.1	3.8e-24
WP_144420736.1|2988258_2988444_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375951.1|2988625_2989084_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036772169.1|2989802_2990678_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_144420737.1|2990909_2991308_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081000012.1|2991311_2991554_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017375794.1|2992443_2994195_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_017375795.1|2994205_2995006_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	39.1	3.4e-33
WP_017375796.1|2995108_2995597_-	dihydrofolate reductase	NA	A0A1B2IDT7	Erwinia_phage	43.1	4.5e-28
WP_047927156.1|2996096_2997020_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_017375799.1|2997116_2997461_+	DMT family protein	NA	NA	NA	NA	NA
WP_017377528.1|3003155_3004118_-	hypothetical protein	NA	M1HUT5	Acanthocystis_turfacea_Chlorella_virus	28.1	7.0e-17
WP_036772663.1|3004156_3005032_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_026063646.1|3005291_3006551_-	transcription termination factor Rho	NA	NA	NA	NA	NA
WP_016210045.1|3006773_3007100_-	thioredoxin TrxA	NA	A0A1J0GW78	Streptomyces_phage	46.2	1.5e-16
WP_048875850.1|3007294_3008245_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242725.1|3008302_3010369_-	polyphosphate kinase 1	NA	NA	NA	NA	NA
WP_017377534.1|3010374_3011370_-	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_027242724.1|3012118_3013699_+	APC family permease	NA	NA	NA	NA	NA
WP_016210041.1|3013846_3015256_-	glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_017377536.1|3015315_3016449_-	cation transporter	NA	NA	NA	NA	NA
WP_017377537.1|3016587_3017412_-	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_017377539.1|3017935_3018148_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046561.1|3018161_3018299_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155052673.1|3018436_3018661_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169834782.1|3019222_3019363_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210044.1|3019721_3020093_-	isochorismatase	NA	NA	NA	NA	NA
WP_017377542.1|3020403_3020691_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377543.1|3020842_3021691_+	pantoate--beta-alanine ligase	NA	NA	NA	NA	NA
WP_048875849.1|3021813_3022785_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377545.1|3022887_3023928_+	succinylglutamate desuccinylase	NA	NA	NA	NA	NA
WP_017377550.1|3026466_3026757_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377551.1|3027024_3027285_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|3027411_3028386_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
>prophage 33
NZ_CP012508	Piscirickettsia salmonis strain PM32597B1 chromosome, complete genome	3186149	3061380	3122848	3186149	transposase,tRNA	Acinetobacter_phage(33.33%)	56	NA	NA
WP_053093682.1|3061380_3062124_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_162039070.1|3063464_3063887_+	biotin/lipoyl-binding protein	NA	NA	NA	NA	NA
WP_017377391.1|3064157_3064736_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_017377386.1|3069258_3070764_-	YifB family Mg chelatase-like AAA ATPase	NA	NA	NA	NA	NA
WP_017377385.1|3070791_3071073_-	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_016209709.1|3071221_3071563_+	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_017377384.1|3071683_3073588_+	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
WP_047927397.1|3073720_3075292_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053856771.1|3075309_3076539_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_017377379.1|3076660_3077659_-	3-deoxy-7-phosphoheptulonate synthase	NA	NA	NA	NA	NA
WP_144420826.1|3077662_3078421_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_017377377.1|3078422_3079622_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_162287776.1|3079605_3080244_-	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_017377375.1|3080298_3081075_-	indole-3-glycerol-phosphate synthase	NA	A0A0P0IR83	Acinetobacter_phage	31.1	2.0e-22
WP_017377374.1|3081078_3082077_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	32.4	2.7e-40
WP_017377373.1|3082078_3082657_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	44.5	1.1e-44
WP_017377372.1|3082653_3084123_-	anthranilate synthase component I family protein	NA	NA	NA	NA	NA
WP_016209719.1|3084166_3084454_-	trp operon repressor	NA	NA	NA	NA	NA
WP_026063627.1|3084654_3085575_+	DMT family transporter	NA	NA	NA	NA	NA
WP_017377369.1|3085690_3086245_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377368.1|3086360_3086786_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771981.1|3087056_3087407_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242711.1|3087600_3088140_+	peroxiredoxin	NA	NA	NA	NA	NA
WP_017377365.1|3088224_3088761_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_027242710.1|3089420_3089723_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242709.1|3090171_3090741_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242708.1|3090809_3091154_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376171.1|3091332_3092307_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_155046560.1|3092573_3092747_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|3092852_3094256_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875844.1|3094260_3095280_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_075275373.1|3095896_3096226_+	VUT family protein	NA	NA	NA	NA	NA
WP_017378398.1|3096451_3096850_-	DUF3135 domain-containing protein	NA	NA	NA	NA	NA
WP_017378399.1|3097717_3098668_+|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_017378400.1|3098667_3100746_+|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_017378401.1|3100887_3101403_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_017378402.1|3101411_3101975_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_017378403.1|3101955_3102702_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_017378404.1|3102840_3103293_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927132.1|3103428_3104265_+	sterol desaturase family protein	NA	NA	NA	NA	NA
WP_027242707.1|3104261_3105158_+	DMT family transporter	NA	NA	NA	NA	NA
WP_017378407.1|3105190_3106258_+	4-oxalomesaconate tautomerase	NA	NA	NA	NA	NA
WP_080963575.1|3106958_3108410_-	potassium transporter	NA	NA	NA	NA	NA
WP_017378410.1|3108416_3109796_-	Trk system potassium transporter TrkA	NA	NA	NA	NA	NA
WP_036773239.1|3109836_3111150_-	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_026063734.1|3111139_3112114_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.9	1.3e-10
WP_017378413.1|3112207_3112711_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	37.1	5.4e-13
WP_017378414.1|3112845_3113997_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_016210342.1|3113993_3114473_+	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_027242705.1|3114619_3116941_+	type I DNA topoisomerase	NA	A0A1V0SCS0	Indivirus	35.9	7.9e-99
WP_080963576.1|3116885_3117512_+	Sua5/YciO/YrdC/YwlC family protein	NA	NA	NA	NA	NA
WP_017378416.1|3117516_3118416_+	oxygen-dependent coproporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_036773242.1|3118603_3119158_+	DUF4823 domain-containing protein	NA	NA	NA	NA	NA
WP_036771330.1|3119197_3120172_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017378420.1|3120761_3121139_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|3121873_3122848_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
>prophage 1
NZ_CP012510	Piscirickettsia salmonis strain PM32597B1 plasmid pPSB1-2, complete sequence	51575	26126	37376	51575	tail,transposase,head	Moraxella_phage(25.0%)	14	NA	NA
WP_017375778.1|26126_26438_+|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	30.8	5.6e-08
WP_017375780.1|27038_27434_+	HK97 gp10 family phage protein	NA	Q6UAX1	Klebsiella_phage	39.6	4.3e-05
WP_017375781.1|27430_27781_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_017375782.1|27780_28203_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375783.1|28204_28528_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375784.1|28584_28851_+	DUF4035 domain-containing protein	NA	NA	NA	NA	NA
WP_036771950.1|28854_30933_+|tail	phage tail tape measure protein	tail	A0A1J0GWA6	Alteromonas_phage	31.2	1.6e-50
WP_017375786.1|30925_31267_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_017375787.1|31263_31935_+|tail	phage minor tail protein L	tail	W6EC15	Rhizobium_phage	33.6	1.4e-27
WP_144420832.1|31864_32650_+	C40 family peptidase	NA	A0A0R6PHF9	Moraxella_phage	41.1	5.1e-42
WP_017375789.1|32639_33197_+|tail	tail assembly protein	tail	K7PM97	Enterobacterial_phage	35.6	2.7e-21
WP_027242568.1|33193_35884_+	host specificity protein J	NA	A0A0R6PIC9	Moraxella_phage	32.9	6.1e-111
WP_017375652.1|35942_36371_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771347.1|36398_37376_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
>prophage 1
NZ_CP012511	Piscirickettsia salmonis strain PM32597B1 plasmid pPSB1-3, complete sequence	181035	0	130296	181035	integrase,transposase,portal	Streptococcus_phage(44.23%)	120	18329:18388	70723:71237
WP_036771347.1|0_978_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_036771347.1|1458_2436_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_155046636.1|2450_2612_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243211.1|2829_3084_+	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	NA	NA	NA	NA
WP_048876199.1|3073_3364_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	52.6	1.3e-11
WP_036771347.1|3350_4328_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_053093683.1|5328_5541_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771347.1|5698_6676_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_053856780.1|6690_7275_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771347.1|7393_8371_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_053856781.1|8478_9879_-	DUF1561 family protein	NA	NA	NA	NA	NA
WP_169834791.1|9877_10030_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927782.1|10674_11064_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771347.1|10979_11957_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_048876196.1|11986_13135_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243215.1|14948_15971_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774350.1|16453_17182_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	6.4e-39
18329:18388	attL	CGTATAGCGAAAATCTCGGGGGATTGCCCCCGTGATGGGCATTGTGGTTCTGTCGCAATT	NA	NA	NA	NA
WP_048876194.1|18421_18955_+|portal	phage portal protein	portal	Q8W629	Enterobacteria_phage	33.3	1.1e-19
WP_080963665.1|19135_19477_+|portal	phage portal protein	portal	A0A2K5B287	Erysipelothrix_phage	54.3	4.3e-22
WP_080963664.1|19657_19924_+|portal	phage portal protein	portal	G0ZT36	Aeromonas_phage	46.7	2.5e-09
WP_027243206.1|19996_21862_-	RecX family transcriptional regulator	NA	V5K3E8	Pseudomonas_phage	32.7	7.9e-57
WP_146619416.1|22167_22314_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375910.1|22657_23386_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_155046637.1|23467_23959_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162038693.1|24691_25848_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.5	2.2e-49
WP_048876191.1|26470_26899_+	nucleotidyltransferase substrate binding protein	NA	NA	NA	NA	NA
WP_048876190.1|26891_27221_+	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_017377694.1|27250_27979_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	7.1e-38
WP_017375663.1|27990_28140_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377694.1|28386_29115_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	7.1e-38
WP_027242593.1|30492_31443_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_027242592.1|31478_31808_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036774385.1|31874_32915_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_036774378.1|33324_33894_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036774316.1|33936_34236_-	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_155046638.1|34232_34697_-	nucleotidyltransferase substrate binding protein	NA	NA	NA	NA	NA
WP_036774373.1|34970_35699_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	3.2e-38
WP_027243202.1|37359_38295_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375910.1|38569_39298_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_027243201.1|39463_39703_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051929623.1|39766_43108_+	DEAD/DEAH box helicase	NA	C3VNU0	Bombyx_mandarina_nucleopolyhedrovirus	28.7	2.6e-50
WP_036772541.1|43265_43994_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	5.4e-38
WP_036815648.1|44735_45464_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	7.1e-38
WP_036772541.1|45947_46676_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	5.4e-38
WP_027243197.1|46846_47416_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.1	2.2e-26
WP_027243198.1|47420_48116_-	Fic family protein	NA	NA	NA	NA	NA
WP_036772541.1|48255_48984_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	5.4e-38
WP_080963627.1|49002_49221_-	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_036774644.1|50200_51262_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047927488.1|51770_52517_+	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	29.9	4.9e-18
WP_027243200.1|52517_52922_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|53228_54203_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_036771293.1|54742_55009_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_171824214.1|55304_57077_-	DUF1561 family protein	NA	NA	NA	NA	NA
WP_048876182.1|57558_59454_+	DUF1561 family protein	NA	NA	NA	NA	NA
WP_017375632.1|60153_60489_+|transposase	transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	51.5	2.3e-23
WP_017375836.1|60683_60887_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243203.1|60980_61775_+	DNA/RNA non-specific endonuclease	NA	A0A2H4N7Z3	Lake_Baikal_phage	35.9	2.5e-36
WP_080999971.1|65951_67355_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_081000017.1|67619_67871_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_048875857.1|68271_69246_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.5	2.2e-26
WP_075278737.1|69856_70096_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876221.1|70233_70689_-|portal	phage portal protein	portal	Q8W629	Enterobacteria_phage	34.8	4.3e-17
WP_016212398.1|70783_71245_-	hypothetical protein	NA	NA	NA	NA	NA
70723:71237	attR	AATTGCGACAGAACCACAATGCCCATCACGGGGGCAATCCCCCGAGATTTTCGCTATACGGTTAAAAAATAATTTTTTCTTTAGAAAAGAAATTATTATTGCTAACTACTCTAAAGTCATAATAATGACCGTACATTCCTCCACCATTATCTCCCTGTCTATGAGCTAAATATGCAGGATCTTCTGCTTTTGCACTTTTATCGATTTTTTGACATATTTTATCAATAGCGTTCATTTGACTTTGACTAACATCATAATAGTTATCTTTGCCTCCAACATTATTTATATAAATAACATTTACAAGGCGAGCTGGATGATATGCACATGTGAAGCCTTCAGGTGCTTGTCCATCAGAACATCGCGCTGAATAATAAGATGTTTGATCAAAAGGATCTCCTCCTCCTTCAGGATAGACTTTATGCGTTGCTCCTCCACAAACAATCCAAGGACTCCAGGCAACTGCCCAGCCACTTGATATAACACTTAACACAATCACTCCAATAGTTTTTTTTATA	NA	NA	NA	NA
WP_036773695.1|73305_75378_+	S9 family peptidase	NA	NA	NA	NA	NA
WP_017377509.1|75407_76136_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	3.2e-38
WP_144420837.1|76277_77210_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377511.1|77239_77968_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_017377512.1|77970_78243_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_017377511.1|79093_79822_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_144420838.1|79877_80498_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_017375910.1|81646_82375_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_162038694.1|82594_83497_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377667.1|84166_84337_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377666.1|84481_84739_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036815609.1|86639_87095_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036816769.1|87338_87737_-	putative toxin-antitoxin system toxin component, PIN family	NA	NA	NA	NA	NA
WP_047927763.1|87733_87997_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_027243210.1|88410_89145_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	3.9e-36
WP_157894756.1|90884_91025_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377525.1|91024_91822_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_075275471.1|92362_93337_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.2	1.3e-26
WP_048876214.1|94108_94837_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.1e-38
WP_017377521.1|95345_95699_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375910.1|96626_97355_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_157894750.1|97997_101282_+	autotransporter domain-containing protein	NA	NA	NA	NA	NA
WP_048876213.1|101590_102481_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_075275473.1|103719_103896_+	carbon storage regulator	NA	A0A2I7RT00	Vibrio_phage	46.0	1.7e-06
WP_027243191.1|104012_104720_+	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	40.0	1.2e-34
WP_048876212.1|104673_105552_+	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_144420840.1|105582_106014_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876211.1|106396_107101_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.7	7.9e-10
WP_036772541.1|107112_107841_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	5.4e-38
WP_051929563.1|107870_108260_-	recombinase family protein	NA	A0A219Y912	Aeromonas_phage	40.0	1.1e-10
WP_017375910.1|108282_109011_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_036815979.1|109013_109622_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	34.6	8.9e-10
WP_162287778.1|110068_110218_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243184.1|110210_110549_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052133264.1|110562_110967_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375840.1|111011_111230_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157894754.1|112216_113311_+	RepB family plasmid replication initiator protein	NA	A0A218MNI2	uncultured_virus	29.8	3.6e-25
WP_017377655.1|113652_113898_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_017377656.1|113894_114281_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_036772434.1|114368_115097_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	9.3e-38
WP_080963659.1|115075_115696_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_017377658.1|116041_116728_+	Fic family protein	NA	NA	NA	NA	NA
WP_082304501.1|117677_118040_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212146.1|118042_119782_-	PLD-like domain protein	NA	NA	NA	NA	NA
WP_155046629.1|120183_120336_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051929558.1|120363_121047_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	33.3	5.1e-22
WP_036771347.1|121128_122106_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_081000019.1|122181_122352_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048876210.1|122392_123121_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	4.6e-37
WP_036771293.1|123666_123933_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_171824214.1|124228_126001_-	DUF1561 family protein	NA	NA	NA	NA	NA
WP_017377694.1|126548_127277_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	7.1e-38
WP_082884401.1|127374_127497_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_155046630.1|127913_128078_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375754.1|128098_129385_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771359.1|129567_130296_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	41.7	3.5e-37
>prophage 2
NZ_CP012511	Piscirickettsia salmonis strain PM32597B1 plasmid pPSB1-3, complete sequence	181035	166313	171244	181035	portal,transposase,terminase	Streptococcus_phage(42.86%)	7	NA	NA
WP_027242929.1|166313_166697_+	HNH endonuclease	NA	A0A2D1GNP5	Pseudomonas_phage	45.5	9.5e-26
WP_075278733.1|166783_167266_+|terminase	P27 family phage terminase small subunit	terminase	Q9B019	Phage_GMSE-1	33.3	8.1e-14
WP_048876205.1|167268_168600_+|terminase	terminase large subunit	terminase	A0A1W6JP18	Morganella_phage	46.3	6.1e-112
WP_157894751.1|168882_169239_+	hypothetical protein	NA	A0A1X9I6B3	Streptococcus_phage	49.6	2.6e-25
WP_087910668.1|169325_169712_+|portal	phage portal protein	portal	Q6DMU2	Streptococcus_phage	50.0	2.1e-25
WP_036771649.1|169749_170484_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.9e-38
WP_048876202.1|170530_171244_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.2	3.2e-11
>prophage 1
NZ_CP012512	Piscirickettsia salmonis strain PM32597B1 plasmid pPSB1-4, complete sequence	33488	21561	31760	33488	head,transposase,tail,capsid,terminase	unidentified_phage(37.5%)	15	NA	NA
WP_027242943.1|21561_21978_-	hypothetical protein	NA	A0A2R3UA88	Siphoviridae_environmental_samples	41.7	2.2e-20
WP_027242944.1|21974_22532_-|tail	tail assembly protein	tail	K7PGY0	Enterobacteria_phage	36.2	7.9e-21
WP_027242945.1|22877_23393_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171824220.1|24195_24441_-|head,tail	phage head-tail connector protein	head,tail	NA	NA	NA	NA
WP_036771330.1|24484_25459_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_168183246.1|25516_25672_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242946.1|25839_26421_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275490.1|26456_26849_-|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	45.0	7.0e-24
WP_036771330.1|26945_27920_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_027242948.1|27939_28125_-	hypothetical protein	NA	A0A1J0GUY5	Halomonas_phage	47.3	9.0e-06
WP_053856795.1|28127_28520_-|terminase	phage terminase small subunit P27 family	terminase	NA	NA	NA	NA
WP_027242950.1|28697_29081_-	HNH endonuclease	NA	A0A2D1GNP5	Pseudomonas_phage	46.3	4.3e-26
WP_027242951.1|29293_30160_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169834793.1|30407_30554_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|30785_31760_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
