The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP008777	Burkholderia pseudomallei 576 chromosome 1, complete sequence	4021786	180768	209412	4021786	transposase	Burkholderia_virus(25.0%)	24	NA	NA
WP_004525957.1|180768_181278_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_004556679.1|181315_181417_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038723871.1|182189_182531_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038723678.1|182649_182874_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004543934.1|183530_184079_+	hypothetical protein	NA	A4JWV5	Burkholderia_virus	78.7	9.3e-75
WP_004543898.1|184075_184837_+	nuclease	NA	A4JWV4	Burkholderia_virus	54.1	2.1e-56
WP_004543876.1|184842_185952_+	DUF3396 domain-containing protein	NA	A4JWV3	Burkholderia_virus	58.0	1.2e-124
WP_038730680.1|186389_187625_-	hypothetical protein	NA	NA	NA	NA	NA
WP_111994465.1|188517_188790_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_004543854.1|189541_191104_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	52.5	2.2e-145
WP_004543818.1|191133_191481_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	72.9	1.6e-40
WP_144399337.1|191859_192618_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	49.5	3.8e-50
WP_004546200.1|193517_194774_+|transposase	IS21 family transposase	transposase	U5N3F9	Enterobacteria_phage	33.0	3.8e-47
WP_004545554.1|194770_195637_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	44.5	1.6e-49
WP_052107457.1|195663_196542_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100086167.1|196544_198380_-	AAA domain-containing protein	NA	K4I1H4	Acidithiobacillus_phage	33.8	5.8e-28
WP_004545947.1|198450_199179_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_004545946.1|199175_202262_-	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	27.4	3.9e-53
WP_144399338.1|202271_203531_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038731785.1|203521_205924_-	N-6 DNA methylase	NA	A0A2H4PQP4	Staphylococcus_phage	37.0	2.1e-70
WP_004545941.1|205995_206247_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004545945.1|206910_207105_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004545935.1|207305_208094_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085962187.1|208178_209412_+|transposase	IS3-like element ISButh1 family transposase	transposase	A0A1B0Z042	Pseudomonas_phage	65.2	3.1e-102
>prophage 2
NZ_CP008777	Burkholderia pseudomallei 576 chromosome 1, complete sequence	4021786	862172	890650	4021786	protease,plate,tail,integrase	Burkholderia_phage(44.44%)	31	862745:862783	878223:878261
WP_004527881.1|862172_862694_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	51.0	1.9e-21
862745:862783	attL	ATTTGTAATCATCAGGTGGCGGGTTCGAGTCCTGCAGCC	NA	NA	NA	NA
WP_004542707.1|862887_863934_+|integrase	site-specific integrase	integrase	W6MYA3	Pseudomonas_phage	38.7	3.9e-53
WP_004542657.1|865696_865951_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004542680.1|865964_866615_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020850759.1|866626_867019_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004542725.1|867011_867860_+	type IV secretion system protein	NA	NA	NA	NA	NA
WP_143291333.1|867919_868171_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004542660.1|868323_868605_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004542720.1|869023_871999_+	conjugative relaxase	NA	V5UQN3	Mycobacterium_phage	28.8	4.5e-06
WP_020850657.1|872024_872276_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076847806.1|872750_873197_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004542662.1|873193_873463_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144399340.1|873479_874139_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004545614.1|874251_875166_-	three-Cys-motif partner protein TcmP	NA	NA	NA	NA	NA
WP_076847687.1|875177_876020_-	phage Gp37/Gp68 family protein	NA	Q8W6R4	Burkholderia_virus	43.3	2.9e-67
WP_076847807.1|876315_876954_+	DUF4433 domain-containing protein	NA	NA	NA	NA	NA
WP_020850538.1|876968_878030_+	macro domain-containing protein	NA	B3FJ30	Pseudomonas_phage	36.5	3.1e-18
WP_004545634.1|878870_879197_+	hypothetical protein	NA	K4NZR5	Burkholderia_phage	97.2	4.3e-51
878223:878261	attR	ATTTGTAATCATCAGGTGGCGGGTTCGAGTCCTGCAGCC	NA	NA	NA	NA
WP_004527843.1|879189_879603_+|tail	phage tail protein I	tail	K4NXA0	Burkholderia_phage	100.0	8.0e-71
WP_076852297.1|879500_880103_+	site-specific DNA-methyltransferase	NA	K4NZW3	Burkholderia_phage	89.1	4.3e-81
WP_111952238.1|880496_881087_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004527840.1|881190_881556_-	phage virion morphogenesis protein	NA	K4NZQ8	Burkholderia_phage	88.4	2.5e-52
WP_004521948.1|881657_882443_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_004521949.1|882439_883786_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_004521950.1|883894_884509_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_004531875.1|884882_885554_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_004521952.1|885590_886109_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_004521953.1|886125_887616_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_004527837.1|887688_888192_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_004204912.1|888249_888732_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_004527836.1|888811_890650_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
>prophage 3
NZ_CP008777	Burkholderia pseudomallei 576 chromosome 1, complete sequence	4021786	1216327	1229644	4021786	transposase	Hokovirus(12.5%)	11	NA	NA
WP_004194034.1|1216327_1218280_+	molecular chaperone DnaK	NA	A0A1V0SH73	Hokovirus	49.2	2.7e-148
WP_004522147.1|1218548_1219679_+	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	27.6	1.7e-22
WP_004544052.1|1219712_1221719_+	bifunctional anthranilate synthase component I family protein/class IV aminotransferase	NA	S4VT78	Pandoravirus	35.0	1.3e-52
WP_004194137.1|1221902_1222718_-	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0N7HVJ8	Ostreococcus_lucimarinus_virus	33.3	8.8e-37
WP_004532195.1|1222782_1223466_-	deoxynucleoside kinase	NA	A0A249XZR7	Enterococcus_phage	26.0	2.0e-05
WP_004194373.1|1223462_1223990_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_004522151.1|1224026_1225574_-	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	31.2	4.3e-24
WP_004194213.1|1225570_1226257_-	HAD-IB family hydrolase	NA	NA	NA	NA	NA
WP_004196484.1|1226278_1227004_-	DnaA regulatory inactivator Hda	NA	NA	NA	NA	NA
WP_004527676.1|1227302_1228358_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SEW4	Cyanophage	44.4	6.4e-72
WP_004531014.1|1228423_1229644_-|transposase	ISL3-like element ISBma1 family transposase	transposase	A9YX10	Burkholderia_phage	100.0	1.1e-240
>prophage 4
NZ_CP008777	Burkholderia pseudomallei 576 chromosome 1, complete sequence	4021786	1592541	1601390	4021786		Bacillus_phage(16.67%)	8	NA	NA
WP_004527508.1|1592541_1593942_+	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	38.5	1.1e-79
WP_009921652.1|1593973_1594897_+	D-glycero-beta-D-manno-heptose-7-phosphate kinase	NA	A0A2H4N7X4	Lake_Baikal_phage	27.1	1.3e-15
WP_004544120.1|1594955_1595948_+	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	30.9	9.1e-28
WP_004189725.1|1596019_1596337_+	competence protein ComE	NA	NA	NA	NA	NA
WP_004532363.1|1596678_1597581_+	cysteine synthase CysM	NA	A0A1X9I5F1	Streptococcus_phage	39.9	1.9e-53
WP_004544022.1|1597807_1599103_-	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_004544116.1|1599281_1600205_+	histone deacetylase family protein	NA	A0A2K9KZC4	Tupanvirus	35.9	3.2e-43
WP_004544106.1|1600547_1601390_-	alpha/beta hydrolase	NA	A7XCB7	Tanapox_virus	27.0	1.2e-17
>prophage 5
NZ_CP008777	Burkholderia pseudomallei 576 chromosome 1, complete sequence	4021786	2119500	2123984	4021786		Burkholderia_virus(57.14%)	9	NA	NA
WP_004196630.1|2119500_2119764_+	hypothetical protein	NA	Q8W6S4	Burkholderia_virus	85.5	2.2e-26
WP_071897863.1|2119747_2119933_+	hypothetical protein	NA	Q8W6S4	Burkholderia_virus	85.2	4.4e-21
WP_004534826.1|2119953_2120679_-	hypothetical protein	NA	A4PE26	Ralstonia_virus	43.5	1.7e-31
WP_038763587.1|2120685_2121288_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004521248.1|2121629_2122136_-	DUF4123 domain-containing protein	NA	A4PE24	Ralstonia_virus	39.4	6.7e-19
WP_004521249.1|2122132_2122558_-	PAAR domain-containing protein	NA	A4JWV5	Burkholderia_virus	47.0	1.1e-14
WP_004557051.1|2122838_2123234_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004531416.1|2123487_2123715_+	hypothetical protein	NA	Q8W6S4	Burkholderia_virus	75.8	3.8e-22
WP_011851785.1|2123750_2123984_-	hypothetical protein	NA	A4PE26	Ralstonia_virus	59.1	2.1e-12
>prophage 6
NZ_CP008777	Burkholderia pseudomallei 576 chromosome 1, complete sequence	4021786	2422862	2464448	4021786	transposase	Enterobacteria_phage(25.0%)	23	NA	NA
WP_038802950.1|2422862_2423983_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_050808995.1|2424587_2425043_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_004556997.1|2425597_2426431_+	OmpA family protein	NA	NA	NA	NA	NA
WP_004544416.1|2426613_2428359_+	TolC family protein	NA	NA	NA	NA	NA
WP_004544388.1|2428544_2438159_+	hemolysin	NA	NA	NA	NA	NA
WP_004531323.1|2438305_2438764_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004521465.1|2438760_2439636_+	sulfotransferase	NA	NA	NA	NA	NA
WP_004544341.1|2439670_2441962_+	ATP-binding cassette domain-containing protein	NA	A0A1V0SE00	Indivirus	28.9	1.6e-19
WP_004521467.1|2441958_2443368_+	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_004527044.1|2443487_2447843_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_038730896.1|2447884_2449510_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004527043.1|2449787_2450393_+	adenylyl-sulfate kinase	NA	A0A1B0XTK9	Freshwater_phage	36.0	4.1e-07
WP_004534880.1|2451406_2452120_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_085952178.1|2453158_2454269_+|transposase	IS3-like element ISBp1 family transposase	transposase	NA	NA	NA	NA
WP_004544383.1|2454847_2454997_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004546200.1|2455105_2456362_+|transposase	IS21 family transposase	transposase	U5N3F9	Enterobacteria_phage	33.0	3.8e-47
WP_004545554.1|2456358_2457225_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	44.5	1.6e-49
WP_085962191.1|2458105_2459304_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.6	2.3e-49
WP_004544407.1|2459882_2460176_+|transposase	transposase	transposase	A0A1P8CWQ3	Bacillus_phage	41.8	1.4e-05
WP_144399342.1|2460748_2461030_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038730902.1|2461502_2461742_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_038730957.1|2461750_2462329_-	DUF2975 domain-containing protein	NA	NA	NA	NA	NA
WP_085962191.1|2463249_2464448_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.6	2.3e-49
>prophage 7
NZ_CP008777	Burkholderia pseudomallei 576 chromosome 1, complete sequence	4021786	2467781	2510417	4021786	transposase,integrase	Burkholderia_virus(25.0%)	33	2487428:2487446	2511135:2511153
WP_004544382.1|2467781_2468912_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_050809000.1|2470085_2471171_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_004544308.1|2471200_2472184_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080011410.1|2474461_2474680_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144399344.1|2474815_2476138_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004544423.1|2476265_2477213_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_004544466.1|2477215_2479159_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_004544333.1|2479155_2479815_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085952178.1|2480636_2481748_-|transposase	IS3-like element ISBp1 family transposase	transposase	NA	NA	NA	NA
WP_004534625.1|2482005_2483256_+	DUF3443 family protein	NA	NA	NA	NA	NA
WP_004544504.1|2484259_2485360_-	porin	NA	NA	NA	NA	NA
WP_080292750.1|2485650_2486112_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_004531312.1|2486225_2487860_-	aromatic amino acid lyase	NA	NA	NA	NA	NA
2487428:2487446	attL	GCACGCCGGCGCCGCCGTC	NA	NA	NA	NA
WP_004521480.1|2487877_2489200_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	42.2	9.1e-84
WP_004521481.1|2489236_2490877_-	urocanate hydratase	NA	NA	NA	NA	NA
WP_004544364.1|2490895_2491987_-	DUF917 domain-containing protein	NA	NA	NA	NA	NA
WP_004521483.1|2492167_2493058_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004544395.1|2493157_2494543_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_004521485.1|2494539_2495820_+	Zn-dependent hydrolase	NA	NA	NA	NA	NA
WP_004544441.1|2495872_2496196_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_004527029.1|2497575_2498121_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_004527028.1|2498117_2498759_+	DUF1109 domain-containing protein	NA	NA	NA	NA	NA
WP_009973415.1|2498777_2499419_-	DUF1109 domain-containing protein	NA	NA	NA	NA	NA
WP_004544348.1|2499484_2499988_-	DoxX family protein	NA	NA	NA	NA	NA
WP_004521491.1|2499993_2500773_-	DUF2063 domain-containing protein	NA	NA	NA	NA	NA
WP_004534478.1|2500762_2501674_-	DUF692 domain-containing protein	NA	NA	NA	NA	NA
WP_004521493.1|2501707_2502019_-	DUF2282 domain-containing protein	NA	NA	NA	NA	NA
WP_004521494.1|2502586_2502967_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.9	3.4e-15
WP_004556978.1|2503155_2503566_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_085955809.1|2503655_2504790_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	31.4	6.5e-22
WP_004521496.1|2505064_2505733_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_085962187.1|2508083_2509317_+|transposase	IS3-like element ISButh1 family transposase	transposase	A0A1B0Z042	Pseudomonas_phage	65.2	3.1e-102
WP_004544380.1|2510018_2510417_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
2511135:2511153	attR	GCACGCCGGCGCCGCCGTC	NA	NA	NA	NA
>prophage 8
NZ_CP008777	Burkholderia pseudomallei 576 chromosome 1, complete sequence	4021786	2926668	2975925	4021786	coat,transposase,tRNA	Klosneuvirus(16.67%)	40	NA	NA
WP_004204967.1|2926668_2929293_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	39.2	5.5e-80
WP_004531186.1|2929834_2931055_+	CoA transferase	NA	NA	NA	NA	NA
WP_004534928.1|2931394_2931604_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004545247.1|2931883_2933593_+|tRNA	glutamine--tRNA ligase/YqeY domain fusion protein	tRNA	A0A222YZ70	Escherichia_phage	57.3	7.4e-187
WP_004545254.1|2933924_2934407_-	NUDIX hydrolase	NA	A0A0G2SS60	Proteus_phage	42.0	1.5e-20
WP_004545113.1|2934425_2934812_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004545161.1|2935099_2937199_-	glycoside hydrolase family 3 protein	NA	NA	NA	NA	NA
WP_004521727.1|2937124_2937304_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004545120.1|2937300_2938161_+	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_004545219.1|2938196_2939603_-	cytochrome-c peroxidase	NA	NA	NA	NA	NA
WP_004193177.1|2939836_2941420_+	acid phosphatase	NA	NA	NA	NA	NA
WP_045591085.1|2941531_2942995_-|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.3	1.2e-79
WP_004538373.1|2943203_2944397_+	trans-2-enoyl-CoA reductase family protein	NA	NA	NA	NA	NA
WP_004531180.1|2945020_2946208_+	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_004545235.1|2946380_2948000_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_004545213.1|2948001_2949693_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_004192810.1|2949996_2950629_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_004545138.1|2950629_2952711_-	response regulator	NA	A0A1V0SGR3	Hokovirus	26.3	3.9e-12
WP_004196717.1|2953121_2954087_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_004545118.1|2954102_2956514_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_004526784.1|2956558_2957398_-	molecular chaperone	NA	NA	NA	NA	NA
WP_004526783.1|2957415_2957940_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_004526782.1|2958016_2958577_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_004538378.1|2958629_2959175_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_004534686.1|2959161_2959350_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004531175.1|2959435_2959657_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004196705.1|2959994_2960888_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004538381.1|2961304_2962591_+	MFS transporter	NA	NA	NA	NA	NA
WP_004526776.1|2962635_2963619_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_004193855.1|2964086_2964368_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_004191144.1|2964630_2964900_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004526773.1|2965794_2967108_-	divalent metal cation transporter	NA	NA	NA	NA	NA
WP_038731356.1|2967367_2968288_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153260188.1|2968945_2969371_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052139777.1|2970514_2970961_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038723406.1|2971242_2971503_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009951519.1|2971717_2971885_+	hypothetical protein	NA	A0A0P0ZBS5	Stx2-converting_phage	50.0	9.5e-07
WP_076851597.1|2972457_2973171_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076851599.1|2974093_2974387_-	hypothetical protein	NA	NA	NA	NA	NA
WP_111963064.1|2975016_2975925_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
>prophage 9
NZ_CP008777	Burkholderia pseudomallei 576 chromosome 1, complete sequence	4021786	3600339	3611297	4021786	protease	Agrobacterium_phage(16.67%)	10	NA	NA
WP_004196461.1|3600339_3602640_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.1	5.1e-167
WP_004194131.1|3602636_3602951_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A218MMY6	uncultured_virus	44.6	4.4e-13
WP_004196460.1|3603483_3603687_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	81.8	6.8e-23
WP_004543858.1|3603816_3605427_-	multicopper oxidase family protein	NA	NA	NA	NA	NA
WP_004189626.1|3605439_3605622_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004189552.1|3605594_3606854_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	63.0	5.2e-12
WP_004189780.1|3607121_3607700_+	pseudouridine synthase	NA	NA	NA	NA	NA
WP_071810810.1|3607962_3608181_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004530837.1|3608372_3608882_+	DUF192 domain-containing protein	NA	A0A1B1IUW8	uncultured_Mediterranean_phage	41.2	5.5e-13
WP_004197486.1|3609182_3611297_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	26.7	5.8e-56
>prophage 1
NZ_CP008778	Burkholderia pseudomallei 576 chromosome 2, complete sequence	3244818	799761	851790	3244818	plate,transposase	Ralstonia_phage(25.0%)	35	NA	NA
WP_004190585.1|799761_801165_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_004529328.1|801180_802497_+	DotU family type VI secretion system protein	NA	NA	NA	NA	NA
WP_004524806.1|802499_806129_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_162478379.1|806110_807067_+	type VI secretion system-associated protein TagF	NA	NA	NA	NA	NA
WP_004529325.1|807051_807279_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004544825.1|807277_809869_+	serine/threonine protein kinase	NA	M1I231	Acanthocystis_turfacea_Chlorella_virus	26.6	5.0e-09
WP_004190988.1|809921_811001_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_004524810.1|811063_811642_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_004190849.1|811634_813143_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_004190698.1|813202_813694_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_009935240.1|813712_814261_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_004524812.1|814265_816137_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_100086149.1|816133_817591_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_004533146.1|817603_820270_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.6	5.2e-78
WP_038731030.1|820266_822471_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	29.7	2.8e-45
WP_038731121.1|822486_823197_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004544731.1|823126_825139_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	50.4	2.7e-31
WP_157801140.1|826182_826434_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076838791.1|826444_827596_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004544694.1|831878_832280_+	VENN motif pre-toxin domain-containing protein	NA	NA	NA	NA	NA
WP_071811399.1|832283_832538_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076838784.1|832539_833106_+	suppressor of fused domain protein	NA	NA	NA	NA	NA
WP_162478380.1|834920_835718_+	DUF746 domain-containing protein	NA	NA	NA	NA	NA
WP_162478385.1|835393_835900_-	recombinase family protein	NA	A0JC18	Ralstonia_phage	52.8	3.3e-18
WP_009960547.1|835865_836021_-	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	67.6	2.0e-06
WP_004524822.1|836449_837190_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004536893.1|838532_839687_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_004557920.1|841459_842098_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004524825.1|842140_843385_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	32.8	7.1e-22
WP_004524827.1|843420_844662_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_004524828.1|844724_845648_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_004524829.1|845648_846500_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_004544761.1|846504_848676_+	alpha-galactosidase	NA	NA	NA	NA	NA
WP_004544789.1|848916_850950_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004555373.1|851382_851790_+|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	36.5	4.9e-12
>prophage 2
NZ_CP008778	Burkholderia pseudomallei 576 chromosome 2, complete sequence	3244818	2915945	2983822	3244818	plate,holin	Aeromonas_phage(25.0%)	50	NA	NA
WP_004530063.1|2915945_2916896_-|holin	choline ABC transporter substrate-binding protein	holin	NA	NA	NA	NA
WP_004523149.1|2917163_2918108_+	GlxA family transcriptional regulator	NA	NA	NA	NA	NA
WP_004530060.1|2918579_2920283_+	thermolysin metallopeptidase	NA	NA	NA	NA	NA
WP_004545903.1|2920400_2921627_+	M20/M25/M40 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_004200640.1|2921681_2922824_-	porin	NA	NA	NA	NA	NA
WP_004198249.1|2922932_2923055_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004530058.1|2923051_2924089_-|holin	choline ABC transporter substrate-binding protein	holin	NA	NA	NA	NA
WP_004186939.1|2924085_2925639_-|holin	choline-sulfatase	holin	NA	NA	NA	NA
WP_004554841.1|2925801_2926674_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004186920.1|2926817_2927693_+	formyltetrahydrofolate deformylase	NA	NA	NA	NA	NA
WP_004530057.1|2927779_2929435_-	APC family permease	NA	NA	NA	NA	NA
WP_004186918.1|2929615_2930479_-	glycine betaine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004530056.1|2930588_2931734_-	hybrid-cluster NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_004535147.1|2931754_2932996_-	aromatic ring-hydroxylating dioxygenase subunit alpha	NA	NA	NA	NA	NA
WP_004530055.1|2933047_2933833_-	drug:proton antiporter	NA	NA	NA	NA	NA
WP_004523138.1|2933829_2935002_-	electron transfer flavoprotein subunit alpha/FixB family protein	NA	NA	NA	NA	NA
WP_004538949.1|2935006_2936932_-	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_004523137.1|2936934_2938998_-	NADH:flavin oxidoreductase	NA	NA	NA	NA	NA
WP_004186987.1|2939058_2939592_-	4-vinyl reductase	NA	NA	NA	NA	NA
WP_004186989.1|2939742_2940714_-	membrane dipeptidase	NA	NA	NA	NA	NA
WP_004545861.1|2940786_2942061_-	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	54.1	5.3e-105
WP_009933096.1|2942072_2942324_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004198247.1|2942493_2943519_+	GlxA family transcriptional regulator	NA	NA	NA	NA	NA
WP_004523135.1|2943696_2944896_-	formaldehyde dehydrogenase, glutathione-independent	NA	A0A2K9L7I1	Tupanvirus	27.2	8.4e-12
WP_004530800.1|2945489_2946506_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_004546670.1|2946694_2948260_+	glycoside hydrolase 68 family protein	NA	NA	NA	NA	NA
WP_004545881.1|2948392_2950057_+	glycoside hydrolase family 32 protein	NA	F8WPR5	Bacillus_phage	31.4	1.6e-56
WP_004528656.1|2952548_2954132_-	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_076847054.1|2954128_2954311_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009927659.1|2954436_2955432_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_004542407.1|2955683_2957267_-	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_038731734.1|2957263_2958583_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_004547901.1|2958472_2958775_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004524288.1|2958816_2959716_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_004536812.1|2960266_2960542_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004545583.1|2960862_2961294_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004190863.1|2961316_2961676_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004545523.1|2961734_2965238_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_004525553.1|2965234_2966893_-	OmpA family protein	NA	NA	NA	NA	NA
WP_004525552.1|2966975_2968337_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_004530042.1|2968333_2968927_-	type VI secretion lipoprotein TssJ	NA	NA	NA	NA	NA
WP_004190606.1|2968932_2969322_-	DUF4150 domain-containing protein	NA	NA	NA	NA	NA
WP_004530790.1|2969364_2970081_-	DUF3540 domain-containing protein	NA	NA	NA	NA	NA
WP_004525550.1|2970083_2971154_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_038731551.1|2971153_2973370_-	DUF2169 domain-containing protein	NA	NA	NA	NA	NA
WP_004545596.1|2973373_2975662_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_004545502.1|2975827_2978119_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_004545559.1|2978109_2980971_-	type VI secretion system ATPase TssH	NA	A0A2I7REQ1	Vibrio_phage	27.2	2.3e-60
WP_004190851.1|2980973_2981963_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_004545527.1|2981959_2983822_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
>prophage 3
NZ_CP008778	Burkholderia pseudomallei 576 chromosome 2, complete sequence	3244818	3140529	3165249	3244818	transposase,integrase	Burkholderia_virus(46.15%)	25	3124992:3125007	3156986:3157001
3124992:3125007	attL	CGCCGGTGGACGTGAA	NA	NA	NA	NA
WP_111963057.1|3140529_3141225_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_009932882.1|3141668_3142601_-	glycerophosphoryl diester phosphodiesterase	NA	NA	NA	NA	NA
WP_100086160.1|3142785_3144021_-	c-type cytochrome	NA	NA	NA	NA	NA
WP_004545516.1|3144179_3145640_-	ser/threonine protein phosphatase	NA	NA	NA	NA	NA
WP_004525420.1|3147650_3147935_-	BrnA antitoxin family protein	NA	K4NZP3	Burkholderia_phage	50.0	1.4e-10
WP_004549731.1|3147918_3148188_-	BrnT family toxin	NA	NA	NA	NA	NA
WP_004537565.1|3148757_3149033_+	bacteriophage protein Gp49	NA	Q6JIH4	Burkholderia_virus	95.6	5.2e-42
WP_009923452.1|3149042_3149174_+	bacteriophage protein Gp48	NA	Q8W6Q2	Burkholderia_virus	97.7	2.6e-15
WP_004545584.1|3149311_3149554_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004552392.1|3149756_3149975_+	hypothetical protein	NA	Q6JIH9	Burkholderia_virus	98.6	9.8e-36
WP_004545536.1|3150160_3150814_-	hypothetical protein	NA	Q8W6Q5	Burkholderia_virus	99.5	6.7e-112
WP_041286571.1|3151099_3152320_+|transposase	ISL3 family transposase	transposase	A9YX10	Burkholderia_phage	99.3	8.6e-238
WP_004537646.1|3152377_3152527_+	bacteriophage protein Gp44	NA	Q8W6Q6	Burkholderia_virus	100.0	3.3e-19
WP_004542585.1|3152523_3153723_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A4JX31	Burkholderia_virus	99.5	1.1e-224
WP_004545504.1|3154130_3155897_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085955809.1|3156064_3157200_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	31.4	6.5e-22
3156986:3157001	attR	TTCACGTCCACCGGCG	NA	NA	NA	NA
WP_038731574.1|3157253_3157544_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004545553.1|3157748_3158342_-	recombinase family protein	NA	A0A219Y912	Aeromonas_phage	38.6	5.2e-23
WP_050809013.1|3158537_3159062_-	DUF2971 domain-containing protein	NA	NA	NA	NA	NA
WP_004546200.1|3159217_3160474_+|transposase	IS21 family transposase	transposase	U5N3F9	Enterobacteria_phage	33.0	3.8e-47
WP_004545554.1|3160470_3161337_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	44.5	1.6e-49
WP_144399358.1|3161337_3161748_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038731576.1|3161880_3162249_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144399359.1|3162809_3163979_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085962187.1|3164015_3165249_+|transposase	IS3-like element ISButh1 family transposase	transposase	A0A1B0Z042	Pseudomonas_phage	65.2	3.1e-102
