The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP007206	Flavobacterium psychrophilum FPG101, complete genome	2835130	596574	625250	2835130	transposase	Bacillus_phage(22.22%)	22	NA	NA
WP_034100109.1|596574_597420_-|transposase	DDE transposase	transposase	NA	NA	NA	NA
WP_011964284.1|597525_597912_-	hypothetical protein	NA	NA	NA	NA	NA
WP_034100111.1|597951_598146_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016361990.1|599680_600883_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	46.5	6.9e-46
WP_011964274.1|601128_601947_-	phage protein	NA	S5Z6N6	Mycobacterium_phage	27.2	2.0e-17
WP_011964273.1|601948_602812_-	AAA family ATPase	NA	A0A220BZX1	Staphylococcus_phage	41.0	2.8e-49
WP_117601869.1|602989_603877_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	24.6	1.8e-14
WP_016361983.1|603885_604197_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_052193140.1|604284_604884_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011964271.1|604893_605037_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011964270.1|605126_605408_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011964269.1|605505_607599_+	hypothetical protein	NA	M1NXJ3	Cellulophaga_phage	40.0	2.4e-70
WP_038503318.1|608158_609895_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011964267.1|610026_611865_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_034100123.1|611864_613973_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_034100126.1|614301_615933_+	site-specific DNA-methyltransferase	NA	Q1MVP0	Enterobacteria_phage	31.7	7.6e-48
WP_034100128.1|615987_616986_+	virulence RhuM family protein	NA	Q9JMN3	Wolbachia_phage	46.8	9.9e-83
WP_011964263.1|617143_619837_+	type III restriction endonuclease	NA	NA	NA	NA	NA
WP_011964262.1|619914_622857_+	hypothetical protein	NA	A0A1B1IUG5	uncultured_Mediterranean_phage	21.7	3.3e-09
WP_011964261.1|623021_623780_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_016361983.1|624042_624354_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_117601869.1|624362_625250_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	24.6	1.8e-14
>prophage 2
NZ_CP007206	Flavobacterium psychrophilum FPG101, complete genome	2835130	1337804	1395977	2835130	protease,integrase,transposase	Bacillus_phage(60.0%)	39	1342688:1342709	1368201:1368222
WP_117601869.1|1337804_1338692_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	24.6	1.8e-14
WP_016361983.1|1338700_1339012_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_011963668.1|1339910_1340027_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011963667.1|1340174_1342190_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011963666.1|1342223_1343612_+	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
1342688:1342709	attL	AGATATTCCAAAAGAAAATATT	NA	NA	NA	NA
WP_011963665.1|1345065_1345488_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011963664.1|1345510_1345690_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011963663.1|1345771_1345924_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011963662.1|1345934_1346159_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011963661.1|1346169_1346565_-	hypothetical protein	NA	A0A1B1IQ01	uncultured_Mediterranean_phage	39.1	1.5e-10
WP_011963660.1|1346566_1347322_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011963659.1|1347604_1347808_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016362010.1|1348305_1349550_+|integrase	site-specific integrase	integrase	H7BUI8	unidentified_phage	34.1	9.3e-38
WP_011963658.1|1349590_1350430_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011963657.1|1350436_1351402_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011963656.1|1351499_1352657_+	FAD-dependent monooxygenase	NA	NA	NA	NA	NA
WP_011963655.1|1352668_1352836_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011963654.1|1352853_1354077_+	MFS transporter	NA	NA	NA	NA	NA
WP_011963653.1|1354538_1355387_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011963652.1|1355498_1355786_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011963651.1|1355793_1356654_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_011963650.1|1356739_1357366_+	ATPase	NA	NA	NA	NA	NA
WP_011963649.1|1358138_1361408_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011963648.1|1361591_1362392_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011963647.1|1362391_1363249_+	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_011963646.1|1363261_1365448_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_011963645.1|1365449_1366610_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011963644.1|1366611_1368606_+	hypothetical protein	NA	NA	NA	NA	NA
1368201:1368222	attR	AGATATTCCAAAAGAAAATATT	NA	NA	NA	NA
WP_011963643.1|1368624_1369965_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011963642.1|1369934_1370582_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051982533.1|1370578_1373818_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011963640.1|1373821_1374661_+	hypothetical protein	NA	NA	NA	NA	NA
WP_117601869.1|1374675_1375563_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	24.6	1.8e-14
WP_016361983.1|1375571_1375883_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_011963639.1|1378615_1378963_-	CRISPR-associated endonuclease Cas2	NA	NA	NA	NA	NA
WP_011963638.1|1378955_1379852_-	type II CRISPR-associated endonuclease Cas1	NA	NA	NA	NA	NA
WP_011963637.1|1380160_1384225_-	type II CRISPR RNA-guided endonuclease Cas9	NA	NA	NA	NA	NA
WP_011963636.1|1384886_1385576_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	31.9	4.1e-27
WP_011963053.1|1394669_1395977_-|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
>prophage 3
NZ_CP007206	Flavobacterium psychrophilum FPG101, complete genome	2835130	2389199	2397324	2835130		Enterobacteria_phage(16.67%)	6	NA	NA
WP_038503728.1|2389199_2390081_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	60.8	4.6e-100
WP_011963426.1|2390149_2391196_-	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	50.5	1.3e-85
WP_011963427.1|2391202_2392579_-	nucleotide sugar dehydrogenase	NA	A0A127AXI2	Bacillus_phage	31.6	4.7e-59
WP_011963428.1|2392610_2393882_-	nucleotide sugar dehydrogenase	NA	A7IWZ0	Paramecium_bursaria_Chlorella_virus	26.4	6.2e-21
WP_011963429.1|2393892_2394873_-	SDR family oxidoreductase	NA	A0A2K9L0I7	Tupanvirus	50.9	2.7e-85
WP_011963430.1|2394876_2397324_-	polysaccharide biosynthesis tyrosine autokinase	NA	A0A1X9I5D6	Streptococcus_phage	31.3	2.1e-17
