The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP009273	Escherichia coli BW25113 strain K-12 chromosome, complete genome	4631469	244123	292807	4631469	transposase,integrase	Streptococcus_phage(20.0%)	49	258609:258668	292917:292976
WP_000006255.1|244123_244621_+|transposase	REP-associated tyrosine transposase RayT	transposase	NA	NA	NA	NA
WP_001334802.1|244844_246584_-	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
WP_000207552.1|246528_247314_+	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_001226164.1|247384_248440_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_000554758.1|248491_248785_+	type I toxin-antitoxin system antitoxin YafN	NA	NA	NA	NA	NA
WP_001263489.1|248787_249186_+	type II toxin-antitoxin system mRNA interferase toxin YafO	NA	NA	NA	NA	NA
WP_001059892.1|249195_249648_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001295202.1|249953_250220_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001326471.1|250152_250689_+	peptide chain release factor H	NA	NA	NA	NA	NA
WP_001292994.1|250745_252203_-	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_001291990.1|252463_252922_+	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000189532.1|253013_254258_+	esterase FrsA	NA	NA	NA	NA	NA
WP_000174689.1|254315_254717_+	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000749863.1|254755_255811_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	61.1	9.1e-119
WP_001285288.1|256098_257202_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000893278.1|257213_258467_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	9.8e-96
258609:258668	attL	CGCATTCGTAATGCGAAGGTCGTAGGTTCGACTCCTATTATCGGCACCATTAAAATCAAA	NA	NA	NA	NA
WP_000854672.1|259038_259380_-	type IV toxin-antitoxin system toxin YkfI	NA	NA	NA	NA	NA
WP_000070395.1|259400_259718_-	type IV toxin-antitoxin system antitoxin YafW	NA	NA	NA	NA	NA
WP_000691994.1|259736_259958_-	DUF987 domain-containing protein	NA	NA	NA	NA	NA
WP_000811693.1|259966_260443_-	RadC family protein	NA	NA	NA	NA	NA
WP_000211838.1|260458_260917_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	32.8	2.0e-14
WP_000194654.1|261014_261254_-	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_001547765.1|261330_261798_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000824223.1|261820_262264_-	lipoprotein, inner membrane; degP regulator; CP4-6 prophage	NA	NA	NA	NA	NA
WP_001548158.1|262263_262491_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000197389.1|262894_263716_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.4	7.2e-47
WP_001065553.1|263807_264671_-	GTPase family protein	NA	NA	NA	NA	NA
WP_000770246.1|264999_265893_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001254938.1|266313_267465_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.9	8.9e-43
WP_010723085.1|269811_270828_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
WP_001393629.1|271035_272439_+	S-methylmethionine permease	NA	NA	NA	NA	NA
WP_000081352.1|272425_273358_+	homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_000192349.1|273466_274513_-	ferric ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.7	1.5e-33
WP_000015532.1|275734_276073_-|transposase	transposase	transposase	U5P4I9	Shigella_phage	91.2	2.7e-32
WP_001030800.1|276095_276446_-	type IV toxin-antitoxin system antitoxin YagB	NA	NA	NA	NA	NA
WP_010723086.1|276539_277694_-|transposase	IS481-like element ISEc19 family transposase	transposase	NA	NA	NA	NA
WP_001136613.1|277988_278897_+	2-keto-3-deoxygluconate aldolase	NA	NA	NA	NA	NA
WP_000151261.1|278911_280879_+	xylonate dehydratase YagF	NA	NA	NA	NA	NA
WP_000192863.1|281105_282488_+	MFS transporter	NA	NA	NA	NA	NA
WP_000406871.1|282499_284110_+	glycoside hydrolase family 43 protein	NA	NA	NA	NA	NA
WP_001121657.1|284114_284873_-	DNA-binding transcriptional repressor XynR	NA	NA	NA	NA	NA
WP_001281825.1|285011_286016_-	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_000388269.1|287210_287942_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000860996.1|288032_288659_-	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_001214248.1|288930_289629_-	recombinase family protein	NA	NA	NA	NA	NA
WP_000072039.1|289655_290510_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001272156.1|290628_290853_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000224818.1|290849_291290_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001407714.1|291406_292807_-|integrase	integrase family protein	integrase	A0A221SAN4	Ralstonia_phage	28.4	9.5e-07
292917:292976	attR	CGCATTCGTAATGCGAAGGTCGTAGGTTCGACTCCTATTATCGGCACCATTAAAATCAAA	NA	NA	NA	NA
>prophage 2
NZ_CP009273	Escherichia coli BW25113 strain K-12 chromosome, complete genome	4631469	311001	378034	4631469	transposase,holin	Staphylococcus_phage(15.38%)	59	NA	NA
WP_000169527.1|311001_311301_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000878218.1|311297_312164_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.3e-51
WP_001299021.1|313436_314030_-	reactive chlorine species resistance protein RclC	NA	NA	NA	NA	NA
WP_000474084.1|314041_314278_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001046307.1|314386_315712_-	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.6	2.5e-113
WP_000339594.1|315937_316792_+	DNA-binding transcriptional regulator RclR	NA	NA	NA	NA	NA
WP_001102108.1|317318_318038_+	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_000023927.1|318048_319476_+	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_000370307.1|319468_320164_+	lactate utilization protein C	NA	NA	NA	NA	NA
WP_001209100.1|320406_321075_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001159094.1|321287_322958_-|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.2	4.7e-61
WP_000089110.1|322971_324444_-	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001335745.1|324457_325045_-	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_000131044.1|325173_327207_+|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
WP_120795374.1|327512_327587_+	protein YahV	NA	NA	NA	NA	NA
WP_001301264.1|328081_329170_+	DNA-binding transcriptional activator/c-di-GMP phosphodiesterase PdeL	NA	NA	NA	NA	NA
WP_001084394.1|329211_330144_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001013892.1|330235_330733_-	DUF1097 domain-containing protein	NA	NA	NA	NA	NA
WP_000023635.1|330990_331596_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_001310582.1|331635_332499_+	DUF2877 domain-containing protein	NA	NA	NA	NA	NA
WP_000111836.1|332488_334036_+	acyl-CoA synthetase FdrA	NA	NA	NA	NA	NA
WP_000083429.1|334035_335454_+	DUF1116 domain-containing protein	NA	NA	NA	NA	NA
WP_001295687.1|335503_335800_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000661672.1|335875_336826_+	carbamate kinase family protein	NA	NA	NA	NA	NA
WP_000665120.1|336835_338218_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_000692754.1|338594_339644_+	NADPH-dependent aldehyde reductase YahK	NA	A0A0G2YAX3	Acanthamoeba_polyphaga_mimivirus	42.6	2.8e-72
WP_001301260.1|339886_340702_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000290616.1|341114_341360_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000983410.1|341376_342048_-	LysE family transporter	NA	NA	NA	NA	NA
WP_000691956.1|342194_342470_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_000941041.1|342567_344154_-	propionate catabolism operon regulatory protein PrpR	NA	NA	NA	NA	NA
WP_000052206.1|344392_345283_+	methylisocitrate lyase	NA	NA	NA	NA	NA
WP_001285927.1|345722_346892_+	2-methylcitrate synthase	NA	NA	NA	NA	NA
WP_001275859.1|346925_348377_+	2-methylcitrate dehydratase	NA	NA	NA	NA	NA
WP_000010288.1|348416_350303_+	propionate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	29.4	7.0e-53
WP_000076233.1|350632_351892_+	cytosine permease	NA	NA	NA	NA	NA
WP_001301240.1|351881_353165_+	cytosine/isoguanine deaminase	NA	NA	NA	NA	NA
WP_000952503.1|353501_354401_-	transcriptional regulator CynR	NA	A0A2P0ZL89	Lactobacillus_phage	27.3	4.2e-16
WP_000658652.1|354509_355169_+	carbonic anhydrase CynT	NA	NA	NA	NA	NA
WP_000616243.1|355199_355670_+	cyanase	NA	NA	NA	NA	NA
WP_001301263.1|355675_356857_+	cyanate transporter CynX	NA	NA	NA	NA	NA
WP_001335915.1|356959_357571_-	galactoside O-acetyltransferase	NA	NA	NA	NA	NA
WP_000291549.1|357636_358890_-	lactose permease	NA	NA	NA	NA	NA
WP_071843335.1|360660_361743_-	DNA-binding transcriptional repressor LacI	NA	C6ZCU4	Enterobacteria_phage	99.7	2.2e-192
WP_001310587.1|361819_362767_-	DNA-binding transcriptional activator MhpR	NA	NA	NA	NA	NA
WP_001007407.1|362843_364508_+	bifunctional 3-(3-hydroxy-phenyl)propionate/3-hydroxycinnamic acid hydroxylase	NA	NA	NA	NA	NA
WP_000543457.1|364509_365454_+	3-carboxyethylcatechol 2,3-dioxygenase	NA	NA	NA	NA	NA
WP_001254932.1|366054_367206_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_000160710.1|367570_368380_+	2-keto-4-pentenoate hydratase	NA	NA	NA	NA	NA
WP_000044314.1|368376_369327_+	acetaldehyde dehydrogenase	NA	G9E526	Ostreococcus_lucimarinus_virus	35.2	8.7e-36
WP_001013499.1|369323_370337_+	4-hydroxy-2-oxovalerate aldolase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	31.1	1.2e-43
WP_000107627.1|370914_372126_+	3-(3-hydroxy-phenyl)propionate transporter	NA	NA	NA	NA	NA
WP_001096705.1|372227_372767_+	DUF2058 domain-containing protein	NA	NA	NA	NA	NA
WP_000419081.1|372990_373824_-	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000842106.1|373917_375027_-	S-(hydroxymethyl)glutathione dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	28.6	8.9e-32
WP_001141271.1|375061_375337_-	formaldehyde-responsive transcriptional repressor FrmR	NA	NA	NA	NA	NA
WP_000596084.1|375524_376298_-	YaiO family outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_000012218.1|376299_376743_-	transferase	NA	NA	NA	NA	NA
WP_085947917.1|376761_378034_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
>prophage 3
NZ_CP009273	Escherichia coli BW25113 strain K-12 chromosome, complete genome	4631469	514594	577553	4631469	integrase,tRNA,transposase,lysis,protease,terminase	Enterobacteria_phage(50.0%)	66	560211:560257	581513:581559
WP_001295836.1|514594_515218_-|protease	multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1	protease	NA	NA	NA	NA
WP_001110573.1|515188_515875_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.6	2.9e-33
WP_000561872.1|515871_518286_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000014739.1|518716_522997_+	rhs element protein RhsD	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.1	1.7e-22
WP_000877768.1|523036_523405_+	immunity protein	NA	NA	NA	NA	NA
WP_001320180.1|524095_524356_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001157938.1|525587_526682_-|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
WP_000460145.1|526750_527677_-	HTH-type transcriptional activator AllS	NA	NA	NA	NA	NA
WP_000776377.1|527906_528389_+	ureidoglycolate lyase	NA	NA	NA	NA	NA
WP_000141275.1|528466_529282_+	HTH-type transcriptional repressor AllR	NA	NA	NA	NA	NA
WP_001096881.1|529371_531153_+	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	27.0	3.5e-38
WP_000943544.1|531165_531942_+	hydroxypyruvate isomerase	NA	NA	NA	NA	NA
WP_000765839.1|532041_532920_+	2-hydroxy-3-oxopropionate reductase	NA	NA	NA	NA	NA
WP_000401100.1|533088_534543_+	putative allantoin permease	NA	NA	NA	NA	NA
WP_000006900.1|534602_535964_+	allantoinase AllB	NA	NA	NA	NA	NA
WP_001302767.1|536020_537322_+	uracil/xanthine transporter	NA	NA	NA	NA	NA
WP_001333621.1|537343_538489_+	glycerate 3-kinase	NA	W6LM47	Streptococcus_phage	41.6	9.1e-48
WP_000540997.1|538716_539502_-	(S)-ureidoglycine aminohydrolase	NA	NA	NA	NA	NA
WP_001310618.1|539512_540748_-	allantoate deiminase	NA	NA	NA	NA	NA
WP_000703900.1|540769_541819_-	ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
WP_000580829.1|542135_543803_+	acyl-CoA synthetase FdrA	NA	NA	NA	NA	NA
WP_000495367.1|543812_545072_+	DUF1116 domain-containing protein	NA	NA	NA	NA	NA
WP_000152519.1|545082_545898_+	DUF2877 domain-containing protein	NA	NA	NA	NA	NA
WP_000855379.1|545894_546788_+	carbamate kinase	NA	NA	NA	NA	NA
WP_000815571.1|546982_548050_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_001295318.1|548046_548556_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
WP_000212247.1|548673_549396_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_000255997.1|549398_549893_-	peptidylprolyl isomerase B	NA	NA	NA	NA	NA
WP_000912385.1|550066_551452_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.5	6.7e-45
WP_001143542.1|551487_552009_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190288.1|552116_552329_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729160.1|552330_553197_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000776555.1|553667_554210_+	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_000988364.1|554429_555122_+	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_001333622.1|555152_557756_+	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_001350487.1|557734_558775_+	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
WP_001255230.1|558785_559301_+	fimbria assembly protein	NA	NA	NA	NA	NA
WP_000805428.1|559303_559936_-	fimbria biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
560211:560257	attL	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_001350488.1|560270_561434_-|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.6	8.9e-200
WP_000672150.1|561553_561817_-	exonuclease	NA	B6DZ61	Enterobacteria_phage	97.7	1.8e-44
WP_000145909.1|562139_562235_+	hypothetical protein	NA	M1FPD5	Enterobacteria_phage	100.0	1.5e-09
WP_000169527.1|562297_562597_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000878218.1|562593_563460_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.3e-51
WP_001070439.1|563770_564103_+	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_001372443.1|564150_564300_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000709082.1|564357_565884_+	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	27.8	7.9e-31
WP_001306955.1|566348_566900_+	Raf kinase inhibitor-like protein YbcL	NA	NA	NA	NA	NA
WP_000881075.1|566909_567707_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001303586.1|567823_567925_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001054340.1|567921_568377_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.9	4.1e-60
WP_000224915.1|568376_568547_+	protein NinE from lambdoid prophage DLP12	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_000774486.1|568539_568830_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	93.8	3.3e-47
WP_001099712.1|568826_569189_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000971055.1|569185_569326_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
WP_001204791.1|569411_569795_+	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	4.4e-55
WP_010723085.1|570192_571209_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
WP_000737282.1|571213_572281_-	porin	NA	Q1MVN1	Enterobacteria_phage	77.9	2.0e-150
WP_000839596.1|572853_573069_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_001135281.1|573068_573566_+	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	98.2	1.1e-90
WP_001228697.1|573782_573965_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	78.3	1.4e-16
WP_000738500.1|574055_574349_-	serum resistance lipoprotein Bor	NA	A0A2R2X2B2	Escherichia_phage	97.9	5.7e-47
WP_000079503.1|574639_575050_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	1.2e-71
WP_001031427.1|575335_575542_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_001421937.1|575706_575901_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	100.0	8.7e-28
WP_000453566.1|576289_576835_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	4.0e-94
WP_001027248.1|576809_577553_+|terminase	phage terminase large subunit family protein	terminase	K7PMH7	Enterobacteria_phage	93.1	4.1e-73
581513:581559	attR	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
>prophage 4
NZ_CP009273	Escherichia coli BW25113 strain K-12 chromosome, complete genome	4631469	1188122	1209515	4631469	integrase,tRNA,portal,plate,tail	Shigella_phage(25.0%)	32	1180117:1180131	1216218:1216232
1180117:1180131	attL	CTTCAGCGTGGTTGT	NA	NA	NA	NA
WP_001297484.1|1188122_1189229_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000476093.1|1189282_1189744_-	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001248691.1|1189753_1190407_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000444484.1|1190578_1191829_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	96.3	1.9e-22
WP_000241967.1|1192322_1192988_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_010723094.1|1192988_1193693_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001257372.1|1194150_1195044_+	cell death peptidase Lit	NA	NA	NA	NA	NA
WP_000741310.1|1195134_1196262_-|integrase	tyrosine-type recombinase/integrase	integrase	O21925	Phage_21	61.5	7.2e-122
WP_000939945.1|1196242_1196488_-	excisionase-like protein from lambdoid prophage 14	NA	NA	NA	NA	NA
WP_011443584.1|1196524_1196836_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010723095.1|1196952_1197294_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001005353.1|1197231_1197540_-	hypothetical protein	NA	I6PDF6	Cronobacter_phage	80.0	3.8e-09
WP_000848748.1|1197714_1198389_-	LexA family transcriptional repressor	NA	U5P0T5	Shigella_phage	100.0	1.2e-132
WP_000649480.1|1198479_1198680_+	transcriptional regulator	NA	U5P445	Shigella_phage	98.5	1.9e-30
WP_000515837.1|1198723_1199281_+	protein YmfL	NA	S5FXP0	Shigella_phage	95.7	7.4e-96
WP_001250269.1|1199456_1199636_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000104929.1|1199625_1200993_+	GntR family transcriptional regulator	NA	A0A1C9IIA1	Salmonella_phage	99.2	5.1e-223
WP_000605606.1|1201004_1201187_+	hypothetical protein	NA	S5FXQ9	Shigella_phage	100.0	1.7e-25
WP_001350502.1|1201186_1201660_+|portal	phage portal protein	portal	A0A1B5FP95	Escherichia_phage	100.0	3.6e-75
WP_001350503.1|1201586_1202378_+|plate	baseplate J/gp47 family protein	plate	M1FQW3	Enterobacteria_phage	97.3	4.7e-144
WP_000383574.1|1202368_1202953_+	YmfQ family protein	NA	O22003	Shigella_phage	98.5	2.0e-112
WP_000554703.1|1202956_1203586_+	hypothetical protein	NA	M1FN94	Enterobacteria_phage	95.4	1.1e-52
WP_010723096.1|1203587_1204001_+|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	53.6	7.1e-27
WP_000548498.1|1203972_1204575_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	83.5	9.2e-92
WP_024184299.1|1204574_1205069_-|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	57.0	3.7e-46
WP_000905001.1|1205140_1205695_+	site-specific DNA recombinase	NA	A0A1S6L009	Salmonella_phage	88.3	2.8e-87
WP_000557907.1|1205801_1206635_+	5-methylcytosine-specific endonuclease McrA	NA	NA	NA	NA	NA
WP_000943927.1|1206868_1207033_+	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	96.3	4.2e-23
WP_001295666.1|1207135_1207459_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	65.4	3.0e-41
WP_032082692.1|1207995_1208106_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000373101.1|1208158_1208563_-	DUF1398 domain-containing protein	NA	NA	NA	NA	NA
WP_000332303.1|1208783_1209515_-	DNA-binding transcriptional repressor BluR	NA	Q9EYF2	Enterobacteria_phage	50.5	2.7e-53
1216218:1216232	attR	ACAACCACGCTGAAG	NA	NA	NA	NA
>prophage 5
NZ_CP009273	Escherichia coli BW25113 strain K-12 chromosome, complete genome	4631469	1390332	1431150	4631469	integrase,tRNA,transposase,lysis,tail	Escherichia_phage(45.16%)	43	1391479:1391497	1421854:1421872
WP_010723085.1|1390332_1391349_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
1391479:1391497	attL	GCTTATTCGCACCTTCCCT	NA	NA	NA	NA
WP_000605090.1|1391621_1391879_+	DUF2534 family protein	NA	NA	NA	NA	NA
WP_001262123.1|1391928_1392879_-	universal stress protein UspE	NA	NA	NA	NA	NA
WP_000611911.1|1393030_1393783_-	fumarate/nitrate reduction transcriptional regulator Fnr	NA	NA	NA	NA	NA
WP_000945011.1|1393977_1394493_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	42.8	1.1e-24
WP_000062973.1|1394503_1396030_-	p-aminobenzoyl-glutamate transporter	NA	NA	NA	NA	NA
WP_001156451.1|1396066_1397512_-	p-aminobenzoyl-glutamate hydrolase subunit AbgB	NA	NA	NA	NA	NA
WP_000444929.1|1397511_1398822_-	p-aminobenzoyl-glutamate hydrolase subunit AbgA	NA	NA	NA	NA	NA
WP_000885458.1|1398997_1399906_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001046829.1|1400235_1400799_+	DNA endonuclease SmrA	NA	NA	NA	NA	NA
WP_000628058.1|1400819_1402052_-	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
WP_000387388.1|1402306_1403290_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000123737.1|1403767_1405141_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_001157406.1|1405269_1406205_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
WP_000040852.1|1406256_1407492_-|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	98.8	5.5e-240
WP_000079604.1|1407493_1407709_-	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_000276809.1|1407787_1407997_-	double-strand break reduction protein RcbA	NA	A0A0U2QL97	Escherichia_phage	98.4	6.1e-27
WP_001317028.1|1407989_1408184_-	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	5.8e-32
WP_000166319.1|1408240_1409050_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	8.8e-106
WP_000105143.1|1409042_1411643_-	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.5	5.1e-248
WP_000632297.1|1411744_1412020_-	protein RacC	NA	A0A0U2QW85	Escherichia_phage	96.7	1.4e-42
WP_001352098.1|1412094_1412265_-	conserved protein, Rac prophage	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
WP_000560225.1|1412264_1412486_-	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	97.3	4.9e-35
WP_001312793.1|1412927_1413416_+	superinfection exclusion protein B	NA	NA	NA	NA	NA
WP_001169151.1|1413412_1413568_-	YdaF family protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
WP_000948459.1|1414021_1414498_-	DNA-binding transcriptional repressor RacR	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	2.2e-11
WP_000712069.1|1414621_1414918_+	toxin YdaS	NA	A0A0R6PH31	Moraxella_phage	44.9	9.6e-10
WP_000693797.1|1414940_1415363_+	phage protein	NA	A0A0U2RXZ9	Escherichia_phage	95.0	1.5e-69
WP_000899748.1|1415375_1416233_+	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	84.5	8.3e-70
WP_000788970.1|1416239_1416986_+	ATP-binding protein	NA	V5UQI5	Shigella_phage	78.9	3.8e-111
WP_000450663.1|1417008_1417569_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	88.1	1.9e-67
WP_001228696.1|1417656_1417842_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.2	2.8e-15
WP_001097895.1|1418038_1419496_+	Trk system potassium uptake protein TrkG	NA	NA	NA	NA	NA
WP_001350510.1|1419633_1419897_+	ParB N-terminal domain-containing protein	NA	A0A0R6PD10	Moraxella_phage	56.1	6.3e-21
WP_000091628.1|1419877_1420237_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000019448.1|1422002_1422983_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	8.9e-185
1421854:1421872	attR	AGGGAAGGTGCGAATAAGC	NA	NA	NA	NA
WP_000279097.1|1423305_1426668_+|tail	side tail fiber protein	tail	X2KTY7	Enterobacteria_phage	36.4	8.1e-12
WP_001698950.1|1426667_1427243_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	2.5e-102
WP_000086527.1|1427340_1427931_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000836770.1|1428247_1428481_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	87.0	5.4e-32
WP_120795384.1|1428549_1428663_-	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_001300461.1|1429441_1429876_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.8e-28
WP_000837921.1|1430016_1431150_-	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.5	1.1e-117
>prophage 6
NZ_CP009273	Escherichia coli BW25113 strain K-12 chromosome, complete genome	4631469	1623709	1642920	4631469	lysis,tail	Enterobacteria_phage(40.91%)	35	NA	NA
WP_000527743.1|1623709_1625170_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	4.3e-42
WP_000347482.1|1625258_1626542_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_120795384.1|1627146_1627260_+	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836768.1|1627328_1627562_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_000078177.1|1627878_1628469_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000885611.1|1628566_1629142_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.3	6.5e-103
WP_001027733.1|1629141_1630104_-|tail	tail fiber protein	tail	K7PHC9	Enterobacteria_phage	70.9	4.1e-41
WP_000453612.1|1630054_1630624_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	1.5e-91
WP_001368374.1|1631012_1631246_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	84.1	2.5e-21
WP_000373090.1|1631303_1631714_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	79.4	2.5e-56
WP_001019606.1|1631865_1632039_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001309517.1|1632210_1632366_-	hypothetical protein	NA	NA	NA	NA	NA
WP_120795388.1|1632444_1632510_-	Qin prophage; protein YnfR	NA	NA	NA	NA	NA
WP_071524604.1|1632512_1632701_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066495.1|1632711_1632924_-	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_001071769.1|1633286_1633784_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
WP_001092971.1|1633780_1634314_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
WP_000189916.1|1634310_1634622_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
WP_000839590.1|1634626_1634842_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
WP_000066484.1|1635595_1635811_-	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
WP_000087756.1|1636111_1636324_+	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_120795389.1|1636378_1636468_+	Qin prophage; protein YnfS	NA	NA	NA	NA	NA
WP_001047135.1|1636745_1637498_-	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	92.8	7.1e-134
WP_001393597.1|1637511_1638561_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.3	5.7e-113
WP_012304870.1|1638562_1638841_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000980994.1|1638907_1639159_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000813254.1|1639375_1639531_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000323025.1|1639602_1639890_-	type II toxin-antitoxin system mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
WP_000534858.1|1639889_1640129_-	type II toxin-antitoxin system antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
WP_001326990.1|1640153_1640459_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301033.1|1640661_1640994_+	protein FlxA	NA	NA	NA	NA	NA
WP_011443592.1|1641430_1641580_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000920568.1|1641876_1642107_-	dicB transcriptional regulator DicC	NA	NA	NA	NA	NA
WP_000448564.1|1642190_1642598_+	DNA-binding transcriptional dual regulator DicA	NA	K7PM82	Enterobacteria_phage	54.7	4.4e-13
WP_000379575.1|1642764_1642920_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
>prophage 7
NZ_CP009273	Escherichia coli BW25113 strain K-12 chromosome, complete genome	4631469	2100706	2109377	4631469		Escherichia_phage(28.57%)	8	NA	NA
WP_000272486.1|2100706_2101810_-	UDP-galactopyranose mutase	NA	E4ZFQ1	Streptococcus_phage	59.5	1.0e-133
WP_001393538.1|2101817_2103065_-	O16 family O-antigen flippase	NA	NA	NA	NA	NA
WP_001100981.1|2103061_2103619_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	57.5	7.8e-53
WP_000783975.1|2103618_2104500_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	63.8	1.9e-106
WP_001023610.1|2104557_2105457_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	35.2	1.5e-29
WP_000699460.1|2105456_2106542_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	5.2e-101
WP_000183060.1|2106914_2107808_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
WP_001116026.1|2107982_2109377_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.9	4.9e-19
>prophage 8
NZ_CP009273	Escherichia coli BW25113 strain K-12 chromosome, complete genome	4631469	2458779	2469989	4631469	integrase,tail	Enterobacteria_phage(50.0%)	17	2456754:2456770	2473664:2473680
2456754:2456770	attL	TATTGGTATCGACAACC	NA	NA	NA	NA
WP_000368140.1|2458779_2459712_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	99.0	2.5e-165
WP_000958671.1|2460023_2461181_+|integrase	prophage integrase IntS	integrase	A5VW56	Enterobacteria_phage	100.0	5.7e-223
WP_000915541.1|2461333_2461696_+	GtrA family protein	NA	U5P0S6	Shigella_phage	88.3	1.0e-53
WP_000703651.1|2461692_2462613_+	glycosyltransferase family 2 protein	NA	M1FQW5	Enterobacteria_phage	89.9	4.2e-160
WP_001030215.1|2462609_2463941_+	hypothetical protein	NA	U5P0I5	Shigella_phage	36.7	6.8e-63
WP_047792215.1|2463975_2464257_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001106835.1|2464555_2464996_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	70.1	9.5e-54
WP_011443597.1|2465022_2465541_-	hypothetical protein	NA	M1FN94	Enterobacteria_phage	68.8	4.6e-39
WP_000066913.1|2465590_2465866_-	phage N-6-adenine-methyltransferase	NA	Q8SBE9	Shigella_phage	100.0	2.6e-49
WP_001393497.1|2465865_2466360_-	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	98.1	1.2e-86
WP_000128175.1|2466356_2466725_-	hypothetical protein	NA	U5P0A0	Shigella_phage	99.2	1.3e-69
WP_000135673.1|2467082_2467445_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	99.2	1.9e-60
WP_000081278.1|2467510_2468335_+	YfdQ family protein	NA	K7PJQ6	Enterobacteria_phage	99.3	7.8e-150
WP_000008183.1|2468462_2468999_+	5'-deoxynucleotidase	NA	K7PKJ9	Enterobacteria_phage	98.9	3.7e-100
WP_001242717.1|2468989_2469352_+	phage protein	NA	K7PH61	Enterobacteria_phage	99.1	2.0e-65
WP_000206809.1|2469351_2469657_+	hypothetical protein	NA	U5P0J0	Shigella_phage	96.0	2.2e-49
WP_001163428.1|2469788_2469989_+	response regulator inhibitor TorI	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
2473664:2473680	attR	TATTGGTATCGACAACC	NA	NA	NA	NA
>prophage 9
NZ_CP009273	Escherichia coli BW25113 strain K-12 chromosome, complete genome	4631469	2850451	2857590	4631469		Escherichia_phage(83.33%)	6	NA	NA
WP_001272928.1|2850451_2853013_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	3.0e-30
WP_001141337.1|2853118_2853775_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	4.7e-49
WP_001272547.1|2853825_2854623_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.0	1.3e-69
WP_000848004.1|2854788_2855697_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	4.3e-117
WP_001393459.1|2855693_2856860_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	60.6	1.1e-120
WP_001278994.1|2856951_2857590_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
