The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP009084	Salmonella enterica subsp. enterica serovar Enteritidis strain OLF-SE2-98984-6 isolate OLF-SE2 chromosome, complete genome	4679126	934557	941870	4679126	integrase,protease	Dickeya_phage(16.67%)	7	923295:923309	942088:942102
923295:923309	attL	AGCCTGCGAGGAGAC	NA	NA	NA	NA
WP_001201751.1|934557_935676_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
WP_000125875.1|935672_937619_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
WP_000447499.1|937748_937970_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000520789.1|938293_938614_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000934064.1|938644_940921_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_001117984.1|941133_941331_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001539594.1|941492_941870_-|integrase	integrase	integrase	A0A077KET4	Ralstonia_phage	41.0	1.2e-20
942088:942102	attR	GTCTCCTCGCAGGCT	NA	NA	NA	NA
>prophage 2
NZ_CP009084	Salmonella enterica subsp. enterica serovar Enteritidis strain OLF-SE2-98984-6 isolate OLF-SE2 chromosome, complete genome	4679126	1013580	1024374	4679126	tail	Escherichia_phage(37.5%)	9	NA	NA
WP_000274547.1|1013580_1014210_+	hypothetical protein	NA	A0A0U2RJZ0	Escherichia_phage	65.9	1.6e-75
WP_000729406.1|1014193_1014820_+	hypothetical protein	NA	A0A0U2RK03	Escherichia_phage	71.6	3.3e-92
WP_000583382.1|1014816_1016526_+|tail	tail fiber protein	tail	A0A0U2SAV1	Escherichia_phage	66.0	1.5e-91
WP_000143167.1|1016525_1017107_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	89.5	1.7e-95
WP_001674638.1|1017584_1018553_+	SPI-2 type III secretion system effector SseI	NA	Q9MBL9	Phage_Gifsy-2	99.4	3.0e-193
WP_000334547.1|1019200_1019827_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	63.2	1.4e-66
WP_001525490.1|1020186_1020873_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000497441.1|1021143_1021335_-	DinI-like family protein	NA	S4TNM0	Salmonella_phage	95.2	6.2e-26
WP_000193790.1|1021761_1024374_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	6.3e-20
>prophage 3
NZ_CP009084	Salmonella enterica subsp. enterica serovar Enteritidis strain OLF-SE2-98984-6 isolate OLF-SE2 chromosome, complete genome	4679126	1226239	1275489	4679126	lysis,holin,tail,integrase,protease	Salmonella_phage(28.57%)	47	1226075:1226104	1245696:1245725
1226075:1226104	attL	ACAGGAATCGTATTCGGTCTCTTTTTATTT	NA	NA	NA	NA
WP_000087636.1|1226239_1227319_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	52.5	3.0e-101
WP_001575998.1|1227293_1227572_-	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	37.5	1.4e-10
WP_001237395.1|1227985_1229965_+	MBL fold metallo-hydrolase	NA	A0A2P0VMX1	Tetraselmis_virus	46.3	1.9e-162
WP_000911593.1|1230653_1230902_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000940753.1|1230965_1231565_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	82.9	4.7e-96
WP_000784710.1|1231561_1231789_+	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	66.7	2.2e-14
WP_001097218.1|1231918_1232608_+	antitermination protein	NA	I6PDF8	Cronobacter_phage	54.9	2.1e-60
WP_001574213.1|1232704_1233229_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000798708.1|1233602_1234052_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001574215.1|1234412_1235099_-	PipA/GogA/GtgA family type III secretion system effector	NA	Q9MBM0	Phage_Gifsy-2	99.6	1.8e-131
WP_001574216.1|1235374_1235704_+|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_000984586.1|1235687_1236140_+	lysozyme	NA	A0A0M4R365	Salmonella_phage	97.3	2.3e-79
WP_001541990.1|1236157_1236637_+|lysis	lysis protein	lysis	Q56118	Enterobacteria_phage	77.0	1.4e-55
WP_000877926.1|1237531_1238065_-	superoxide dismutase [Cu-Zn]	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
WP_001152416.1|1238154_1238850_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.7	1.0e-89
WP_000161704.1|1242904_1243627_-	SPI-1 type III secretion system guanine nucleotide exchange factor SopE	NA	NA	NA	NA	NA
WP_001536069.1|1244106_1244907_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077681935.1|1246764_1247259_-	RecE	NA	A0A0U2I1R6	Escherichia_phage	70.3	3.7e-22
1245696:1245725	attR	ACAGGAATCGTATTCGGTCTCTTTTTATTT	NA	NA	NA	NA
WP_001013467.1|1247448_1247679_+	hypothetical protein	NA	Q8HA86	Salmonella_phage	93.7	6.1e-28
WP_001050883.1|1247732_1248266_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	43.0	5.4e-11
WP_000789530.1|1248522_1248690_-	lytic enzyme	NA	NA	NA	NA	NA
WP_001576014.1|1248754_1248943_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000348542.1|1248997_1249489_+	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	56.2	1.6e-41
WP_001687735.1|1251593_1252094_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	77.4	1.5e-63
WP_012543349.1|1252190_1252391_-	phage virulence factor PagK family protein	NA	NA	NA	NA	NA
WP_000457876.1|1252960_1253086_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000951652.1|1253586_1253733_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000848072.1|1254220_1254835_-	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_000480735.1|1254844_1255003_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001233445.1|1255135_1256050_-	DMT family transporter	NA	NA	NA	NA	NA
WP_001576018.1|1259188_1259329_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001576019.1|1259494_1259764_-	hypothetical protein	NA	B6SCX2	Bacteriophage	47.9	3.1e-07
WP_001025515.1|1260136_1260556_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000030934.1|1260928_1261405_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000422882.1|1261734_1262130_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	32.8	9.2e-16
WP_000182071.1|1262813_1263536_+	SPI-1 type III secretion system guanine nucleotide exchange factor SopE2	NA	NA	NA	NA	NA
WP_001134856.1|1263820_1263985_+	membrane protein	NA	NA	NA	NA	NA
WP_000986173.1|1264208_1264859_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.9	7.2e-58
WP_000457838.1|1264877_1265069_-	YebW family protein	NA	NA	NA	NA	NA
WP_024131108.1|1265179_1265416_-	DUF1480 family protein	NA	NA	NA	NA	NA
WP_001531515.1|1265533_1266973_-	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_001529852.1|1267050_1269684_-	PqiB family protein	NA	NA	NA	NA	NA
WP_001207294.1|1269652_1270936_-	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_001518229.1|1271064_1271562_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_000431401.1|1271659_1272346_+	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_001091237.1|1272365_1274414_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	8.0e-87
WP_000984498.1|1274607_1275489_+|protease	protease HtpX	protease	NA	NA	NA	NA
>prophage 4
NZ_CP009084	Salmonella enterica subsp. enterica serovar Enteritidis strain OLF-SE2-98984-6 isolate OLF-SE2 chromosome, complete genome	4679126	1466786	1481062	4679126	tRNA,holin	Escherichia_phage(66.67%)	19	NA	NA
WP_000123686.1|1466786_1468160_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.0	2.1e-51
WP_001156217.1|1468203_1469139_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	97.3	7.2e-144
WP_001676915.1|1469455_1470073_-	exodeoxyribonuclease	NA	A0A088CD28	Shigella_phage	41.9	2.5e-36
WP_000800272.1|1470100_1470418_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000560208.1|1470502_1470724_-	cell division protein FtsZ	NA	A0A0U2RTC4	Escherichia_phage	83.6	7.9e-33
WP_000004762.1|1471161_1471683_+	superinfection exclusion B family protein	NA	NA	NA	NA	NA
WP_085981757.1|1471790_1471946_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	48.9	2.6e-06
WP_001227859.1|1472330_1472798_-	helix-turn-helix domain-containing protein	NA	A0A0U2QW76	Escherichia_phage	66.9	1.0e-53
WP_001676916.1|1473070_1473400_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.7	6.5e-23
WP_001033796.1|1473561_1474116_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000556389.1|1474112_1475045_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000882662.1|1475414_1475627_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.7	2.5e-28
WP_000734094.1|1475917_1476088_+	hypothetical protein	NA	A0A0U2I1S4	Escherichia_phage	61.8	8.5e-11
WP_000940751.1|1476150_1476750_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	82.9	5.5e-97
WP_000774470.1|1476749_1477040_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	76.0	5.1e-40
WP_000640113.1|1477036_1477573_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	70.9	1.4e-70
WP_001688615.1|1480060_1480249_+	hypothetical protein	NA	Q8W636	Enterobacteria_phage	57.4	9.4e-11
WP_000445513.1|1480238_1480520_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	49.4	1.3e-16
WP_000802786.1|1480516_1481062_+	glycoside hydrolase family 108 protein	NA	A0A0U2S643	Escherichia_phage	83.4	2.3e-89
>prophage 5
NZ_CP009084	Salmonella enterica subsp. enterica serovar Enteritidis strain OLF-SE2-98984-6 isolate OLF-SE2 chromosome, complete genome	4679126	2134752	2145259	4679126		Enterobacteria_phage(37.5%)	10	NA	NA
WP_000126349.1|2134752_2136066_-	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
WP_000565913.1|2136092_2137172_-	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.5	1.7e-16
WP_000648783.1|2137176_2137950_-	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000018223.1|2137965_2138940_-	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000973709.1|2138945_2139497_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	1.3e-52
WP_000857535.1|2139497_2140376_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	2.1e-108
WP_001023658.1|2140423_2141323_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.0	5.1e-30
WP_000697848.1|2141322_2142408_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
WP_000981469.1|2142784_2143678_-	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_001144948.1|2143855_2145259_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	4.0e-21
>prophage 6
NZ_CP009084	Salmonella enterica subsp. enterica serovar Enteritidis strain OLF-SE2-98984-6 isolate OLF-SE2 chromosome, complete genome	4679126	2212456	2221627	4679126	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000195340.1|2212456_2214490_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	26.9	6.1e-55
WP_000703145.1|2214730_2215189_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	6.4e-53
WP_001197951.1|2215360_2215891_+	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000950414.1|2215947_2216415_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	89.7	4.3e-73
WP_000598637.1|2216461_2217181_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000272845.1|2217177_2218863_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	6.2e-279
WP_001240421.1|2219085_2219817_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.4	1.7e-100
WP_001261696.1|2219876_2219984_+	protein YohO	NA	NA	NA	NA	NA
WP_000824854.1|2219964_2220696_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000569168.1|2220679_2221627_-	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	2.8e-10
>prophage 7
NZ_CP009084	Salmonella enterica subsp. enterica serovar Enteritidis strain OLF-SE2-98984-6 isolate OLF-SE2 chromosome, complete genome	4679126	2458061	2464121	4679126		Salmonella_virus(50.0%)	6	NA	NA
WP_000377779.1|2458061_2459003_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	87.8	1.6e-146
WP_001576268.1|2460245_2460635_+	GtrA family protein	NA	A0A192Y6N5	Salmonella_phage	85.6	1.1e-50
WP_000703599.1|2460603_2460858_+	glycosyltransferase	NA	A8CG95	Salmonella_phage	79.5	3.1e-25
WP_000400616.1|2460875_2462798_+	acyltransferase	NA	A0A1R3Y5Q6	Salmonella_virus	77.3	5.6e-300
WP_105789228.1|2463787_2463931_-	hypothetical protein	NA	A0A1R3Y5S2	Salmonella_virus	82.9	1.7e-12
WP_108630384.1|2463869_2464121_-	hypothetical protein	NA	A0A1R3Y5S2	Salmonella_virus	68.6	7.6e-08
>prophage 8
NZ_CP009084	Salmonella enterica subsp. enterica serovar Enteritidis strain OLF-SE2-98984-6 isolate OLF-SE2 chromosome, complete genome	4679126	2693507	2793456	4679126	lysis,portal,tRNA,transposase,capsid,plate,tail,head,integrase,terminase	Salmonella_phage(76.36%)	91	2711880:2711894	2792361:2792375
WP_000083345.1|2693507_2694245_-|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_000219174.1|2694374_2695709_+	ATP-dependent RNA helicase SrmB	NA	A0A1B1IS59	uncultured_Mediterranean_phage	29.7	1.6e-43
WP_001675040.1|2695726_2696626_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000188410.1|2696728_2697316_+	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000627811.1|2697377_2697761_-	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	74.0	6.1e-33
WP_000179978.1|2698079_2698769_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	49.5	4.6e-55
WP_000997368.1|2698884_2699922_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001098733.1|2700125_2700545_+	thioredoxin TrxC	NA	A0A1J0GW78	Streptomyces_phage	39.0	5.9e-13
WP_000183642.1|2700617_2701298_+|tRNA	tRNA-uridine aminocarboxypropyltransferase	tRNA	NA	NA	NA	NA
WP_000082648.1|2701351_2704012_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_000949286.1|2704126_2705482_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_001264473.1|2705526_2705850_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000807815.1|2705846_2707148_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	30.6	1.8e-44
WP_000985655.1|2707251_2707707_-	DUF4385 domain-containing protein	NA	E3SMI8	Prochlorococcus_phage	49.3	3.9e-34
2711880:2711894	attL	TTTGAGTTCCCGGCC	NA	NA	NA	NA
WP_001235093.1|2713486_2716060_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.5	2.0e-127
WP_000992636.1|2716189_2716921_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_000079130.1|2716917_2717898_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000197660.1|2718029_2718767_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000178449.1|2719038_2719377_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_010989056.1|2719480_2719528_+	pheA operon leader peptide PheL	NA	NA	NA	NA	NA
WP_000200077.1|2719627_2720788_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_000210984.1|2720748_2721657_-	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_000225188.1|2721714_2722836_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_001168062.1|2722845_2723916_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.8	2.4e-90
WP_001212379.1|2724355_2724874_+	YfiR family protein	NA	NA	NA	NA	NA
WP_001030985.1|2724866_2726087_+	diguanylate cyclase DgcN	NA	A0A2K8I9Y5	Pseudomonas_phage	36.2	5.8e-08
WP_000065257.1|2726243_2726591_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000469804.1|2726631_2727399_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000043266.1|2727443_2727992_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000256453.1|2728010_2728259_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000460052.1|2728511_2729873_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_001537507.1|2730038_2730830_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_127172650.1|2730849_2732136_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001287926.1|2732256_2732862_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001518875.1|2732896_2733487_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001059151.1|2733610_2734489_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_000880965.1|2734574_2736236_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001203445.1|2736384_2736723_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001112990.1|2736888_2737179_-	RnfH family protein	NA	NA	NA	NA	NA
WP_000242603.1|2737168_2737645_-	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_001518569.1|2737794_2738277_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	5.2e-29
WP_001237694.1|2738891_2750366_+	biofilm-associated protein BapA	NA	NA	NA	NA	NA
WP_000533863.1|2750430_2751840_+	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_000196151.1|2751836_2754017_+	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	34.0	1.3e-18
WP_012543392.1|2754024_2755188_+	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_000980500.1|2755739_2755958_-	ogr/Delta-like zinc finger family protein	NA	E5G6Q4	Salmonella_phage	100.0	2.1e-38
WP_001102269.1|2756026_2757127_-	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	100.0	2.6e-201
WP_000980411.1|2757123_2757609_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	100.0	6.7e-77
WP_001282768.1|2757605_2760413_-|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	99.9	0.0e+00
WP_000763316.1|2760405_2760525_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	100.0	1.8e-15
WP_001280963.1|2760539_2760842_-|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	100.0	1.5e-45
WP_001207651.1|2760896_2761412_-|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	100.0	9.3e-93
WP_000046108.1|2761421_2762594_-|tail	phage tail sheath protein	tail	E5G6P7	Salmonella_phage	100.0	8.9e-224
WP_000974843.1|2762696_2762921_-	helix-turn-helix domain-containing protein	NA	E5G6P5	Salmonella_phage	100.0	1.5e-34
WP_000143187.1|2763790_2764366_-|tail	tail fiber assembly protein	tail	E5G6P1	Salmonella_phage	100.0	4.3e-107
WP_001274649.1|2764365_2766219_-|tail	phage tail protein	tail	E5G6P0	Salmonella_phage	100.0	0.0e+00
WP_001086804.1|2766215_2766821_-|tail	phage tail protein I	tail	E5G6N9	Salmonella_phage	100.0	1.3e-117
WP_000268332.1|2766813_2767722_-|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	100.0	5.4e-160
WP_000189373.1|2767708_2768068_-	GPW/gp25 family protein	NA	E5G6N7	Salmonella_phage	100.0	1.1e-60
WP_001672413.1|2768064_2768643_-|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	100.0	1.4e-108
WP_000958562.1|2768720_2769572_+	hypothetical protein	NA	E5G6N5	Salmonella_phage	100.0	2.8e-163
WP_000343949.1|2769573_2770020_-	phage virion morphogenesis protein	NA	E5G6N4	Salmonella_phage	99.3	2.3e-71
WP_001039958.1|2770012_2770444_-|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	100.0	1.7e-76
WP_000196199.1|2770539_2770968_-|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	100.0	2.3e-68
WP_001069923.1|2770964_2771480_-	lysozyme	NA	E5G6N1	Salmonella_phage	100.0	5.3e-96
WP_000171565.1|2771460_2771676_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	100.0	5.9e-33
WP_000868184.1|2771679_2771883_-|tail	tail protein X	tail	E5G6M9	Salmonella_phage	100.0	3.8e-34
WP_000673537.1|2771882_2772347_-|head	head completion/stabilization protein	head	E5G6M8	Salmonella_phage	100.0	9.9e-86
WP_000059173.1|2772440_2773091_-|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	100.0	4.9e-115
WP_000730759.1|2773094_2774156_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	100.0	2.1e-195
WP_000216276.1|2774172_2775006_-|capsid	GPO family capsid scaffolding protein	capsid	E5G6M5	Salmonella_phage	100.0	3.1e-130
WP_001098395.1|2775148_2776915_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	97.1	0.0e+00
WP_001542203.1|2776914_2777955_+|portal	phage portal protein	portal	E5G6M3	Salmonella_phage	100.0	5.5e-201
WP_001284991.1|2778058_2779723_-	AIPR family protein	NA	E5G6M2	Salmonella_phage	100.0	0.0e+00
WP_001673609.1|2780036_2780714_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001217571.1|2780827_2781061_-	DinI family protein	NA	E5G6M1	Salmonella_phage	98.7	1.8e-35
WP_001154433.1|2781071_2781260_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	100.0	1.4e-27
WP_000017507.1|2781412_2783827_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	100.0	0.0e+00
WP_000104187.1|2783823_2784681_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	100.0	6.8e-165
WP_000752613.1|2784677_2784905_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
WP_001244219.1|2784904_2785138_-	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	100.0	1.7e-33
WP_000963474.1|2785205_2785547_-	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	100.0	1.2e-56
WP_000956190.1|2785510_2785711_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	100.0	2.4e-33
WP_000460848.1|2785718_2786228_-	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	100.0	1.5e-87
WP_000102105.1|2786261_2786504_-	Rha family transcriptional regulator	NA	A0A1S6KZZ6	Salmonella_phage	97.5	6.8e-38
WP_000932273.1|2786625_2787258_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	51.4	6.3e-59
WP_000218402.1|2787260_2788277_+|integrase	site-specific integrase	integrase	E5G6L0	Salmonella_phage	100.0	5.0e-199
WP_038394562.1|2788829_2789492_+	hypothetical protein	NA	E5G6K9	Salmonella_phage	99.5	1.3e-123
WP_001142974.1|2789753_2790347_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000445376.1|2790745_2791549_+	DUF3800 domain-containing protein	NA	Q19UP3	Mannheimia_phage	44.7	1.2e-62
WP_089113803.1|2792344_2793456_-|transposase	IS3-like element IS1351 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	25.6	7.6e-07
2792361:2792375	attR	TTTGAGTTCCCGGCC	NA	NA	NA	NA
