The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP009093	Salmonella enterica subsp. enterica serovar Enteritidis strain OLF-SE11-10058 chromosome, complete genome	4702741	934764	942077	4702741	integrase,protease	Dickeya_phage(16.67%)	7	923502:923516	942295:942309
923502:923516	attL	AGCCTGCGAGGAGAC	NA	NA	NA	NA
WP_001201751.1|934764_935883_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
WP_000125875.1|935879_937826_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
WP_000447499.1|937955_938177_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000520789.1|938500_938821_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000934064.1|938851_941128_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_001117984.1|941340_941538_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001539594.1|941699_942077_-|integrase	integrase	integrase	A0A077KET4	Ralstonia_phage	41.0	1.2e-20
942295:942309	attR	GTCTCCTCGCAGGCT	NA	NA	NA	NA
>prophage 2
NZ_CP009093	Salmonella enterica subsp. enterica serovar Enteritidis strain OLF-SE11-10058 chromosome, complete genome	4702741	1217892	1229717	4702741	integrase,holin	Salmonella_phage(40.0%)	13	1217728:1217757	1237348:1237377
1217728:1217757	attL	ACAGGAATCGTATTCGGTCTCTTTTTATTT	NA	NA	NA	NA
WP_000087636.1|1217892_1218972_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	52.5	3.0e-101
WP_001575998.1|1218946_1219225_-	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	37.5	1.4e-10
WP_001237395.1|1219638_1221618_+	MBL fold metallo-hydrolase	NA	A0A2P0VMX1	Tetraselmis_virus	46.3	1.9e-162
WP_000911593.1|1222306_1222555_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000940753.1|1222618_1223218_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	82.9	4.7e-96
WP_000784710.1|1223214_1223442_+	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	66.7	2.2e-14
WP_001097218.1|1223571_1224261_+	antitermination protein	NA	I6PDF8	Cronobacter_phage	54.9	2.1e-60
WP_001574213.1|1224357_1224882_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000798708.1|1225255_1225705_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001574215.1|1226065_1226752_-	PipA/GogA/GtgA family type III secretion system effector	NA	Q9MBM0	Phage_Gifsy-2	99.6	1.8e-131
WP_001574216.1|1227027_1227357_+|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_000984586.1|1227340_1227793_+	lysozyme	NA	A0A0M4R365	Salmonella_phage	97.3	2.3e-79
WP_000877926.1|1229183_1229717_-	superoxide dismutase [Cu-Zn]	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
1237348:1237377	attR	ACAGGAATCGTATTCGGTCTCTTTTTATTT	NA	NA	NA	NA
>prophage 3
NZ_CP009093	Salmonella enterica subsp. enterica serovar Enteritidis strain OLF-SE11-10058 chromosome, complete genome	4702741	1458437	1472713	4702741	holin,tRNA	Escherichia_phage(66.67%)	19	NA	NA
WP_000123686.1|1458437_1459811_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.0	2.1e-51
WP_001156217.1|1459854_1460790_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	97.3	7.2e-144
WP_001676915.1|1461106_1461724_-	exodeoxyribonuclease	NA	A0A088CD28	Shigella_phage	41.9	2.5e-36
WP_000800272.1|1461751_1462069_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000560208.1|1462153_1462375_-	cell division protein FtsZ	NA	A0A0U2RTC4	Escherichia_phage	83.6	7.9e-33
WP_000004762.1|1462812_1463334_+	superinfection exclusion B family protein	NA	NA	NA	NA	NA
WP_085981757.1|1463441_1463597_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	48.9	2.6e-06
WP_001227859.1|1463981_1464449_-	helix-turn-helix domain-containing protein	NA	A0A0U2QW76	Escherichia_phage	66.9	1.0e-53
WP_001676916.1|1464721_1465051_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.7	6.5e-23
WP_001033796.1|1465212_1465767_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000556389.1|1465763_1466696_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000882662.1|1467065_1467278_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.7	2.5e-28
WP_000734094.1|1467568_1467739_+	hypothetical protein	NA	A0A0U2I1S4	Escherichia_phage	61.8	8.5e-11
WP_000940751.1|1467801_1468401_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	82.9	5.5e-97
WP_000774470.1|1468400_1468691_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	76.0	5.1e-40
WP_000640113.1|1468687_1469224_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	70.9	1.4e-70
WP_001688615.1|1471711_1471900_+	hypothetical protein	NA	Q8W636	Enterobacteria_phage	57.4	9.4e-11
WP_000445513.1|1471889_1472171_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	49.4	1.3e-16
WP_000802786.1|1472167_1472713_+	glycoside hydrolase family 108 protein	NA	A0A0U2S643	Escherichia_phage	83.4	2.3e-89
>prophage 4
NZ_CP009093	Salmonella enterica subsp. enterica serovar Enteritidis strain OLF-SE11-10058 chromosome, complete genome	4702741	2126396	2136903	4702741		Enterobacteria_phage(37.5%)	10	NA	NA
WP_000126349.1|2126396_2127710_-	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
WP_000565913.1|2127736_2128816_-	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.5	1.7e-16
WP_000648783.1|2128820_2129594_-	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000018223.1|2129609_2130584_-	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000973709.1|2130589_2131141_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	1.3e-52
WP_000857535.1|2131141_2132020_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	2.1e-108
WP_001023658.1|2132067_2132967_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.0	5.1e-30
WP_000697848.1|2132966_2134052_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
WP_000981469.1|2134428_2135322_-	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_001144948.1|2135499_2136903_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	4.0e-21
>prophage 5
NZ_CP009093	Salmonella enterica subsp. enterica serovar Enteritidis strain OLF-SE11-10058 chromosome, complete genome	4702741	2204101	2213272	4702741	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000195340.1|2204101_2206135_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	26.9	6.1e-55
WP_000703145.1|2206375_2206834_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	6.4e-53
WP_001197951.1|2207005_2207536_+	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000950414.1|2207592_2208060_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	89.7	4.3e-73
WP_000598637.1|2208106_2208826_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000272845.1|2208822_2210508_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	6.2e-279
WP_001240421.1|2210730_2211462_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.4	1.7e-100
WP_001261696.1|2211521_2211629_+	protein YohO	NA	NA	NA	NA	NA
WP_000824854.1|2211609_2212341_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000569168.1|2212324_2213272_-	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	2.8e-10
>prophage 6
NZ_CP009093	Salmonella enterica subsp. enterica serovar Enteritidis strain OLF-SE11-10058 chromosome, complete genome	4702741	2449702	2455762	4702741		Salmonella_virus(50.0%)	6	NA	NA
WP_000377779.1|2449702_2450644_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	87.8	1.6e-146
WP_001576268.1|2451886_2452276_+	GtrA family protein	NA	A0A192Y6N5	Salmonella_phage	85.6	1.1e-50
WP_000703599.1|2452244_2452499_+	glycosyltransferase	NA	A8CG95	Salmonella_phage	79.5	3.1e-25
WP_000400616.1|2452516_2454439_+	acyltransferase	NA	A0A1R3Y5Q6	Salmonella_virus	77.3	5.6e-300
WP_105789228.1|2455428_2455572_-	hypothetical protein	NA	A0A1R3Y5S2	Salmonella_virus	82.9	1.7e-12
WP_108630384.1|2455510_2455762_-	hypothetical protein	NA	A0A1R3Y5S2	Salmonella_virus	68.6	7.6e-08
>prophage 7
NZ_CP009093	Salmonella enterica subsp. enterica serovar Enteritidis strain OLF-SE11-10058 chromosome, complete genome	4702741	2684839	2784788	4702741	plate,transposase,capsid,tail,integrase,head,terminase,portal,tRNA,lysis	Salmonella_phage(75.93%)	89	2703213:2703227	2783693:2783707
WP_000083345.1|2684839_2685577_-|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_000219174.1|2685706_2687041_+	ATP-dependent RNA helicase SrmB	NA	A0A1B1IS59	uncultured_Mediterranean_phage	29.7	1.6e-43
WP_001675040.1|2687058_2687958_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000188410.1|2688060_2688648_+	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000627811.1|2688709_2689093_-	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	74.0	6.1e-33
WP_000179978.1|2689411_2690101_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	49.5	4.6e-55
WP_000997368.1|2690216_2691254_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001098733.1|2691457_2691877_+	thioredoxin TrxC	NA	A0A1J0GW78	Streptomyces_phage	39.0	5.9e-13
WP_000183642.1|2691949_2692630_+|tRNA	tRNA-uridine aminocarboxypropyltransferase	tRNA	NA	NA	NA	NA
WP_000082648.1|2692683_2695344_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_001264473.1|2696859_2697183_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000807815.1|2697179_2698481_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	30.6	1.8e-44
WP_000985655.1|2698584_2699040_-	DUF4385 domain-containing protein	NA	E3SMI8	Prochlorococcus_phage	49.3	3.9e-34
2703213:2703227	attL	TTTGAGTTCCCGGCC	NA	NA	NA	NA
WP_001235093.1|2704819_2707393_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.5	2.0e-127
WP_000992636.1|2707522_2708254_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_000079130.1|2708250_2709231_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000197660.1|2709362_2710100_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000178449.1|2710371_2710710_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_010989056.1|2710813_2710861_+	pheA operon leader peptide PheL	NA	NA	NA	NA	NA
WP_000200077.1|2710960_2712121_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_000210984.1|2712081_2712990_-	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_000225188.1|2713047_2714169_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_001168062.1|2714178_2715249_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.8	2.4e-90
WP_001212379.1|2715688_2716207_+	YfiR family protein	NA	NA	NA	NA	NA
WP_001030985.1|2716199_2717420_+	diguanylate cyclase DgcN	NA	A0A2K8I9Y5	Pseudomonas_phage	36.2	5.8e-08
WP_000065257.1|2717576_2717924_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000469804.1|2717964_2718732_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000043266.1|2718776_2719325_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000256453.1|2719343_2719592_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000460052.1|2719844_2721206_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_001537507.1|2721371_2722163_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_127172650.1|2722182_2723469_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001287926.1|2723589_2724195_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001518875.1|2724229_2724820_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001059151.1|2724943_2725822_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_000880965.1|2725907_2727569_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001203445.1|2727717_2728056_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001112990.1|2728221_2728512_-	RnfH family protein	NA	NA	NA	NA	NA
WP_000242603.1|2728501_2728978_-	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_001518569.1|2729127_2729610_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	5.2e-29
WP_001237694.1|2730224_2741699_+	biofilm-associated protein BapA	NA	NA	NA	NA	NA
WP_000533863.1|2741763_2743173_+	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_000196151.1|2743169_2745350_+	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	34.0	1.3e-18
WP_012543392.1|2745357_2746521_+	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_000980500.1|2747072_2747291_-	ogr/Delta-like zinc finger family protein	NA	E5G6Q4	Salmonella_phage	100.0	2.1e-38
WP_001102269.1|2747359_2748460_-	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	100.0	2.6e-201
WP_000980411.1|2748456_2748942_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	100.0	6.7e-77
WP_001282768.1|2748938_2751746_-|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	99.9	0.0e+00
WP_000763316.1|2751738_2751858_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	100.0	1.8e-15
WP_001280963.1|2751872_2752175_-|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	100.0	1.5e-45
WP_001207651.1|2752229_2752745_-|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	100.0	9.3e-93
WP_000046108.1|2752754_2753927_-|tail	phage tail sheath protein	tail	E5G6P7	Salmonella_phage	100.0	8.9e-224
WP_000974843.1|2754029_2754254_-	helix-turn-helix domain-containing protein	NA	E5G6P5	Salmonella_phage	100.0	1.5e-34
WP_000143187.1|2755123_2755699_-|tail	tail fiber assembly protein	tail	E5G6P1	Salmonella_phage	100.0	4.3e-107
WP_001274649.1|2755698_2757552_-|tail	phage tail protein	tail	E5G6P0	Salmonella_phage	100.0	0.0e+00
WP_001086804.1|2757548_2758154_-|tail	phage tail protein I	tail	E5G6N9	Salmonella_phage	100.0	1.3e-117
WP_000268332.1|2758146_2759055_-|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	100.0	5.4e-160
WP_000189373.1|2759041_2759401_-	GPW/gp25 family protein	NA	E5G6N7	Salmonella_phage	100.0	1.1e-60
WP_001672413.1|2759397_2759976_-|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	100.0	1.4e-108
WP_000958562.1|2760053_2760905_+	hypothetical protein	NA	E5G6N5	Salmonella_phage	100.0	2.8e-163
WP_000343949.1|2760906_2761353_-	phage virion morphogenesis protein	NA	E5G6N4	Salmonella_phage	99.3	2.3e-71
WP_001039958.1|2761345_2761777_-|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	100.0	1.7e-76
WP_000196199.1|2761872_2762301_-|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	100.0	2.3e-68
WP_001069923.1|2762297_2762813_-	lysozyme	NA	E5G6N1	Salmonella_phage	100.0	5.3e-96
WP_000171565.1|2762793_2763009_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	100.0	5.9e-33
WP_000868184.1|2763012_2763216_-|tail	tail protein X	tail	E5G6M9	Salmonella_phage	100.0	3.8e-34
WP_000673537.1|2763215_2763680_-|head	head completion/stabilization protein	head	E5G6M8	Salmonella_phage	100.0	9.9e-86
WP_000059173.1|2763773_2764424_-|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	100.0	4.9e-115
WP_000730759.1|2764427_2765489_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	100.0	2.1e-195
WP_000216276.1|2765505_2766339_-|capsid	GPO family capsid scaffolding protein	capsid	E5G6M5	Salmonella_phage	100.0	3.1e-130
WP_001098395.1|2766481_2768248_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	97.1	0.0e+00
WP_001542203.1|2768247_2769288_+|portal	phage portal protein	portal	E5G6M3	Salmonella_phage	100.0	5.5e-201
WP_001284991.1|2769391_2771056_-	AIPR family protein	NA	E5G6M2	Salmonella_phage	100.0	0.0e+00
WP_001673609.1|2771369_2772047_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001217575.1|2772160_2772394_-	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_001154433.1|2772404_2772593_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	100.0	1.4e-27
WP_000017508.1|2772745_2775160_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	99.9	0.0e+00
WP_000104187.1|2775156_2776014_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	100.0	6.8e-165
WP_000752613.1|2776010_2776238_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
WP_001244219.1|2776237_2776471_-	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	100.0	1.7e-33
WP_000963474.1|2776538_2776880_-	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	100.0	1.2e-56
WP_000956190.1|2776843_2777044_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	100.0	2.4e-33
WP_000460848.1|2777051_2777561_-	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	100.0	1.5e-87
WP_000932273.1|2777957_2778590_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	51.4	6.3e-59
WP_000218402.1|2778592_2779609_+|integrase	site-specific integrase	integrase	E5G6L0	Salmonella_phage	100.0	5.0e-199
WP_000360326.1|2780161_2780824_+	hypothetical protein	NA	E5G6K9	Salmonella_phage	100.0	3.4e-124
WP_001142974.1|2781085_2781679_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000445376.1|2782077_2782881_+	DUF3800 domain-containing protein	NA	Q19UP3	Mannheimia_phage	44.7	1.2e-62
WP_089113803.1|2783676_2784788_-|transposase	IS3-like element IS1351 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	25.6	7.6e-07
2783693:2783707	attR	TTTGAGTTCCCGGCC	NA	NA	NA	NA
>prophage 8
NZ_CP009093	Salmonella enterica subsp. enterica serovar Enteritidis strain OLF-SE11-10058 chromosome, complete genome	4702741	3245682	3302369	4702741	plate,capsid,tail,holin,integrase,head,terminase,portal,tRNA	Cronobacter_phage(62.5%)	60	3241021:3241036	3284453:3284468
3241021:3241036	attL	ATGGCGGCGTAGCCAG	NA	NA	NA	NA
WP_001264394.1|3245682_3246696_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.5	2.8e-109
WP_001144069.1|3246923_3247139_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_000918865.1|3247373_3249119_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.4	2.1e-72
WP_001680745.1|3249268_3251116_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.4e-35
WP_000237776.1|3251239_3251746_-	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_000340945.1|3252069_3252372_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000977530.1|3253760_3255464_-	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	81.4	9.9e-224
WP_000200789.1|3255463_3256009_-	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	72.0	3.2e-59
WP_000267957.1|3255980_3256706_-	hypothetical protein	NA	F1BUK1	Cronobacter_phage	53.5	3.7e-63
WP_000861353.1|3256695_3257250_-|tail	tail fiber assembly protein	tail	S4TUB9	Salmonella_phage	89.0	2.7e-90
WP_000084307.1|3257262_3259497_-|tail	phage tail protein	tail	Q8HAB4	Salmonella_phage	73.7	7.2e-182
WP_001001828.1|3259506_3260094_-	hypothetical protein	NA	F1BUK5	Cronobacter_phage	82.6	3.8e-90
WP_000136921.1|3260086_3261271_-|plate	baseplate J/gp47 family protein	plate	F1BUK6	Cronobacter_phage	78.4	6.7e-179
WP_001002797.1|3261267_3261597_-	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	72.4	3.8e-39
WP_000811094.1|3261593_3263564_-|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	70.8	3.2e-274
WP_000411339.1|3263751_3264009_-|tail	putative phage tail assembly chaperone	tail	A5X9I7	Aeromonas_virus	63.4	3.6e-21
WP_000376373.1|3264155_3264488_-	hypothetical protein	NA	F1BUL2	Cronobacter_phage	70.9	1.5e-35
WP_000175560.1|3264487_3264829_-	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	91.1	2.2e-50
WP_001154425.1|3264825_3265119_-|holin	phage holin family protein	holin	C7BGD7	Burkholderia_phage	46.2	1.3e-14
WP_000166743.1|3265128_3265584_-	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	72.2	1.5e-57
WP_000220203.1|3265580_3266708_-	DUF2586 family protein	NA	F1BUL5	Cronobacter_phage	83.7	1.9e-175
WP_000560080.1|3266704_3267412_-	hypothetical protein	NA	F1BUL6	Cronobacter_phage	76.1	1.3e-100
WP_000084218.1|3267408_3267915_-|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	69.1	1.2e-63
WP_001680743.1|3267911_3268364_-|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	82.7	1.6e-64
WP_001218537.1|3268460_3269162_-|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	66.8	9.4e-88
WP_000550495.1|3269165_3270188_-|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	81.5	3.9e-159
WP_000018800.1|3270249_3271053_-|capsid	GPO family capsid scaffolding protein	capsid	F1BUM4	Cronobacter_phage	56.0	2.0e-78
WP_001151939.1|3271213_3272989_+	hypothetical protein	NA	F1BUM5	Cronobacter_phage	83.1	9.8e-291
WP_000038213.1|3272985_3274047_+|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	76.8	6.7e-162
WP_001552031.1|3274043_3274367_+	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	92.3	8.0e-50
WP_000353141.1|3274340_3274547_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000170874.1|3274666_3276688_-	replication endonuclease	NA	F1BUM9	Cronobacter_phage	74.5	7.9e-297
WP_000279404.1|3276684_3277545_-	DNA adenine methylase	NA	F1BUN1	Cronobacter_phage	82.0	1.1e-130
WP_000551169.1|3277535_3277769_-	DUF2732 family protein	NA	NA	NA	NA	NA
WP_000022786.1|3277836_3278238_-	hypothetical protein	NA	F1BUN2	Cronobacter_phage	66.9	1.4e-48
WP_000996837.1|3278237_3278663_-	hypothetical protein	NA	F1BUN5	Cronobacter_phage	49.6	2.2e-23
WP_000643375.1|3278652_3278880_-	DUF2724 domain-containing protein	NA	NA	NA	NA	NA
WP_000460878.1|3278889_3279393_-	phage regulatory CII family protein	NA	F1BUN6	Cronobacter_phage	72.5	3.5e-60
WP_001247711.1|3279423_3279645_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000514631.1|3279788_3280370_+	phage repressor protein	NA	A0A218M4J1	Erwinia_phage	37.2	1.2e-27
WP_000568371.1|3280386_3280953_+	PH domain-containing protein	NA	Q4ZA70	Staphylococcus_virus	32.2	7.5e-19
WP_001145219.1|3280956_3281994_+|integrase	tyrosine-type recombinase/integrase	integrase	F1BUS9	Erwinia_phage	63.9	1.5e-121
WP_000627044.1|3281983_3283765_+	ATP-binding protein	NA	X2KLG0	Campylobacter_phage	23.2	6.4e-08
WP_000213760.1|3284022_3284790_-	siderophore-interacting protein	NA	NA	NA	NA	NA
3284453:3284468	attR	CTGGCTACGCCGCCAT	NA	NA	NA	NA
WP_000983441.1|3285021_3285669_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000478462.1|3285665_3287234_-	MCP four helix bundle domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.5	2.2e-12
WP_000094642.1|3287621_3289142_-	PAS domain-containing methyl-accepting chemotaxis protein	NA	A0A1B0V854	Salmonella_phage	47.8	8.4e-33
WP_001576371.1|3289571_3290951_+	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	29.3	1.0e-32
WP_000121528.1|3291121_3293140_+	NADPH-dependent 2,4-dienoyl-CoA reductase	NA	NA	NA	NA	NA
WP_000019988.1|3293220_3294357_-	23S rRNA (guanine(1835)-N(2))-methyltransferase RlmG	NA	NA	NA	NA	NA
WP_000202966.1|3294442_3294940_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_000951050.1|3295091_3295784_+	vancomycin high temperature exclusion protein	NA	NA	NA	NA	NA
WP_000617682.1|3295872_3296871_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_001098833.1|3297141_3298110_+	TerC family protein	NA	I7HPH5	Enterobacteria_phage	34.9	5.0e-39
WP_000235363.1|3298364_3299609_+	serine/threonine transporter SstT	NA	NA	NA	NA	NA
WP_000422141.1|3300058_3300721_+	DedA family protein	NA	NA	NA	NA	NA
WP_000917516.1|3300724_3301108_+	EnvZ/OmpR regulon moderator MzrA	NA	NA	NA	NA	NA
WP_000877297.1|3301252_3301621_+	DUF1090 domain-containing protein	NA	NA	NA	NA	NA
WP_000031219.1|3301662_3301968_+	DUF883 domain-containing protein	NA	NA	NA	NA	NA
WP_000785626.1|3301970_3302369_+|holin	phage holin family protein	holin	NA	NA	NA	NA
