The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	0	5496	4806594		Enterobacteria_phage(33.33%)	5	NA	NA
WP_002210942.1|1118_2051_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002210943.1|2153_3179_-	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	31.4	5.9e-30
WP_002216285.1|3512_3602_+	YnhF family membrane protein	NA	NA	NA	NA	NA
WP_038399781.1|3705_4284_-	superoxide dismutase [Fe]	NA	Q56AR7	Bacillus_thuringiensis_phage	45.1	9.9e-43
WP_012105035.1|4644_5496_-	hydrolase	NA	A0A2H5BMT3	Streptomyces_phage	41.9	1.5e-18
>prophage 2
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	21112	22387	4806594	tRNA	Pectobacterium_phage(100.0%)	1	NA	NA
WP_011192524.1|21112_22387_+|tRNA	tyrosine--tRNA ligase	tRNA	A0A1L2CUL7	Pectobacterium_phage	42.2	8.8e-84
>prophage 3
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	29478	31286	4806594		Planktothrix_phage(100.0%)	2	NA	NA
WP_002210969.1|29478_30294_-	peptide ABC transporter ATP-binding protein SapF	NA	G9BWD6	Planktothrix_phage	30.9	6.5e-16
WP_002210970.1|30293_31286_-	peptide ABC transporter ATP-binding protein SapD	NA	G9BWD6	Planktothrix_phage	25.3	8.8e-07
>prophage 4
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	51054	53271	4806594	tRNA	Moumouvirus(50.0%)	2	NA	NA
WP_162007547.1|51054_52023_-	alpha/beta hydrolase fold domain-containing protein	NA	A0A2P1EM31	Moumouvirus	28.7	7.3e-14
WP_002210992.1|52329_53271_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	88.3	2.1e-130
>prophage 5
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	57959	60835	4806594		Bacillus_virus(50.0%)	4	NA	NA
WP_002210995.1|57959_58619_-	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	44.6	6.0e-20
WP_012413750.1|58921_59263_+	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_012105050.1|59320_59773_-	heat shock protein HslJ	NA	NA	NA	NA	NA
WP_012105052.1|59842_60835_-	2-hydroxyacid dehydrogenase	NA	M1HKI4	Acanthocystis_turfacea_Chlorella_virus	44.2	9.9e-67
>prophage 6
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	64659	72275	4806594		Ostreococcus_tauri_virus(50.0%)	4	NA	NA
WP_032466441.1|64659_66051_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	30.2	2.7e-46
WP_032466440.1|66260_67217_+	sugar-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_002211004.1|67337_67943_-	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
WP_012105055.1|68387_72275_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SBU4	Catovirus	31.4	4.0e-55
>prophage 7
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	82842	84147	4806594		Bacillus_phage(100.0%)	1	NA	NA
WP_002232819.1|82842_84147_-	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	27.9	3.5e-19
>prophage 8
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	93773	94292	4806594		Streptococcus_phage(100.0%)	1	NA	NA
WP_002211023.1|93773_94292_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	50.5	1.6e-23
>prophage 9
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	100173	101841	4806594		Micromonas_sp._RCC1109_virus(100.0%)	1	NA	NA
WP_011192500.1|100173_101841_-	acetolactate synthase large subunit	NA	E5EQ70	Micromonas_sp._RCC1109_virus	29.6	6.2e-53
>prophage 10
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	112575	113394	4806594		Bacillus_virus(100.0%)	1	NA	NA
WP_002223602.1|112575_113394_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.1	4.4e-36
>prophage 11
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	116664	118203	4806594		Staphylococcus_phage(100.0%)	1	NA	NA
WP_011192492.1|116664_118203_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.2	1.5e-16
>prophage 12
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	151217	152789	4806594		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_012105090.1|151217_152789_-	L-arabinose ABC transporter ATP-binding protein AraG	NA	A0A2R8FG22	Brazilian_cedratvirus	30.6	3.2e-11
>prophage 13
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	157777	163460	4806594		Bacillus_phage(100.0%)	3	NA	NA
WP_012105093.1|157777_159916_-	type I secretion system permease/ATPase	NA	W8CYL7	Bacillus_phage	30.4	3.3e-51
WP_011192461.1|159917_161288_-	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_038399833.1|161312_163460_-	type I secretion system permease/ATPase	NA	W8CYL7	Bacillus_phage	30.7	8.8e-44
>prophage 14
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	175428	180858	4806594		Bodo_saltans_virus(50.0%)	4	NA	NA
WP_038399839.1|175428_177363_+	exoribonuclease II	NA	A0A2H4UVB7	Bodo_saltans_virus	22.5	6.8e-11
WP_032466414.1|177711_179778_+	carbon starvation protein A	NA	NA	NA	NA	NA
WP_042592831.1|179770_180076_+	YbdD/YjiX family protein	NA	NA	NA	NA	NA
WP_002215192.1|180192_180858_-	fructose-6-phosphate aldolase	NA	A0A1Z1LWE4	Synechococcus_phage	34.4	6.1e-28
>prophage 15
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	188002	188593	4806594		Staphylococcus_phage(100.0%)	1	NA	NA
WP_002227926.1|188002_188593_+	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.4	8.0e-40
>prophage 16
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	194356	198807	4806594	protease	Catovirus(50.0%)	4	NA	NA
WP_038399844.1|194356_196972_-	type I DNA topoisomerase	NA	A0A1V0SB35	Catovirus	34.0	3.2e-88
WP_002228458.1|196998_197298_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002210623.1|197390_197642_+	YciN family protein	NA	NA	NA	NA	NA
WP_002210624.1|197760_198807_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	32.0	1.6e-22
>prophage 17
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	205369	208392	4806594		Acinetobacter_phage(100.0%)	3	NA	NA
WP_002215981.1|205369_205948_+	glutamine amidotransferase	NA	A0A0P0IKJ1	Acinetobacter_phage	37.3	7.4e-30
WP_002215980.1|205962_206961_+	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	38.7	7.7e-51
WP_011192443.1|206964_208392_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	39.0	2.9e-35
>prophage 18
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	213338	215078	4806594		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_038399852.1|213338_215078_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	26.3	6.9e-15
>prophage 19
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	218885	219425	4806594		Salmonella_phage(100.0%)	1	NA	NA
WP_038399856.1|218885_219425_-	outer membrane beta-barrel protein	NA	A0A1B0VBR9	Salmonella_phage	41.8	1.3e-25
>prophage 20
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	223503	224505	4806594		Bacillus_virus(100.0%)	1	NA	NA
WP_002210651.1|223503_224505_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.2	1.8e-15
>prophage 21
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	234339	234930	4806594		Serratia_phage(100.0%)	1	NA	NA
WP_002210659.1|234339_234930_-	thymidine kinase	NA	A0A1Z1LYD5	Serratia_phage	55.8	1.5e-54
>prophage 22
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	241071	241920	4806594		Synechococcus_phage(100.0%)	1	NA	NA
WP_002230891.1|241071_241920_+	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	37.3	7.0e-13
>prophage 23
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	245746	247672	4806594		Streptococcus_phage(100.0%)	1	NA	NA
WP_012105118.1|245746_247672_-	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	30.4	4.2e-37
>prophage 24
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	252701	253349	4806594		Tupanvirus(100.0%)	1	NA	NA
WP_038399865.1|252701_253349_+	bifunctional nicotinamidase/pyrazinamidase	NA	A0A2K9L6K4	Tupanvirus	33.0	1.8e-21
>prophage 25
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	260130	261405	4806594		Bacillus_phage(100.0%)	1	NA	NA
WP_002216501.1|260130_261405_+	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	37.1	1.5e-11
>prophage 26
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	264887	266081	4806594		Salmonella_phage(100.0%)	1	NA	NA
WP_011192426.1|264887_266081_+	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	29.1	9.9e-29
>prophage 27
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	273131	277467	4806594	transposase	Saccharomonospora_phage(50.0%)	4	NA	NA
WP_002213775.1|273131_273590_+|transposase	IS200/IS605-like element IS1541B family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	8.5e-13
WP_002214494.1|274062_274419_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002211692.1|275510_276251_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038399875.1|276267_277467_+	cysteine desulfurase	NA	A0A1X7QGF3	Faustovirus	29.3	1.5e-37
>prophage 28
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	285535	295731	4806594	tRNA	Staphylococcus_phage(33.33%)	10	NA	NA
WP_002220632.1|285535_287224_-	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	28.9	3.0e-31
WP_087768167.1|287758_287866_+	gluconate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_002211183.1|287866_288472_-	Slp family lipoprotein	NA	NA	NA	NA	NA
WP_002211184.1|288608_289307_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_011192419.1|289378_291283_-	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	32.6	3.4e-92
WP_002211186.1|291413_291758_+	RidA family protein	NA	NA	NA	NA	NA
WP_002211187.1|291889_292219_-	multidrug/spermidine efflux SMR transporter subunit MdtI	NA	NA	NA	NA	NA
WP_012105125.1|292205_292649_-	multidrug/spermidine efflux SMR transporter subunit MdtJ	NA	NA	NA	NA	NA
WP_002211190.1|293363_294005_-	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_011906215.1|294246_295731_-	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	36.8	4.0e-80
>prophage 29
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	300293	311617	4806594	tRNA	Bacillus_virus(50.0%)	11	NA	NA
WP_002228437.1|300293_301610_-	murein DD-endopeptidase MepM	NA	G3MBP9	Bacillus_virus	44.5	2.4e-15
WP_002227944.1|301630_302587_-	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_002228434.1|302662_303421_+	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	30.3	1.2e-16
WP_002211197.1|303417_304203_+	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_002211198.1|304257_305262_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	27.8	4.7e-08
WP_002211199.1|305423_306038_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_002211201.1|306344_306866_-	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	32.4	6.5e-09
WP_002211202.1|307074_307818_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_002211203.1|307875_308319_-	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_002211204.1|308318_310115_-|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	27.3	2.8e-11
WP_012105129.1|310801_311617_+	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	68.5	2.2e-48
>prophage 30
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	316454	318185	4806594	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_011192408.1|316454_318185_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	34.4	3.8e-90
>prophage 31
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	336316	337384	4806594		Bacillus_virus(100.0%)	1	NA	NA
WP_015683639.1|336316_337384_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.8	7.5e-28
>prophage 32
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	342444	348825	4806594		uncultured_Caudovirales_phage(33.33%)	6	NA	NA
WP_002224472.1|342444_344142_+	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	24.0	6.3e-21
WP_002211232.1|344691_345546_-	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	39.7	4.4e-47
WP_002211233.1|345641_346451_-	tetratricopeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_002211234.1|346447_346849_-	SirB2 family protein	NA	NA	NA	NA	NA
WP_011192399.1|346912_347743_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_002211236.1|347742_348825_-	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	42.1	7.4e-07
>prophage 33
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	352290	353238	4806594		Tupanvirus(100.0%)	1	NA	NA
WP_002211240.1|352290_353238_+	ribose-phosphate diphosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	6.0e-45
>prophage 34
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	359997	360690	4806594		Bacillus_phage(100.0%)	1	NA	NA
WP_002211253.1|359997_360690_+	heavy metal response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.6	1.2e-31
>prophage 35
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	394989	396072	4806594		Enterobacteria_phage(100.0%)	1	NA	NA
WP_002230843.1|394989_396072_-	hypothetical protein	NA	Q1MVN1	Enterobacteria_phage	52.7	3.3e-100
>prophage 36
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	401806	403051	4806594		Klosneuvirus(100.0%)	1	NA	NA
WP_002216140.1|401806_403051_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	28.3	8.2e-26
>prophage 37
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	408999	409788	4806594		Cronobacter_phage(100.0%)	1	NA	NA
WP_002212037.1|408999_409788_-	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	73.8	2.5e-89
>prophage 38
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	421990	422704	4806594		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_011192364.1|421990_422704_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	32.2	2.1e-18
>prophage 39
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	434102	434873	4806594		Escherichia_phage(100.0%)	1	NA	NA
WP_038399911.1|434102_434873_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	64.3	9.0e-84
>prophage 40
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	448964	453564	4806594		Bacillus_phage(50.0%)	2	NA	NA
WP_002212073.1|448964_449597_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	32.3	2.7e-09
WP_032466357.1|449712_453564_+	transporter substrate-binding domain-containing protein	NA	A0A1V0SGX0	Hokovirus	29.6	1.4e-39
>prophage 41
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	460731	461874	4806594		Planktothrix_phage(100.0%)	1	NA	NA
WP_032466352.1|460731_461874_-	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	34.1	8.6e-22
>prophage 42
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	472200	515449	4806594	plate,integrase,tail,head,portal,lysis,capsid,holin	Salmonella_phage(45.24%)	59	476671:476684	483671:483684
WP_002213209.1|472200_472491_-	BrnA antitoxin family protein	NA	K4NZP3	Burkholderia_phage	39.4	1.8e-05
WP_002213210.1|472471_472744_-	BrnT family toxin	NA	NA	NA	NA	NA
WP_038399917.1|472879_473134_+|plate	phage baseplate assembly protein V	plate	F1BUP5	Erwinia_phage	62.5	8.2e-18
WP_002213212.1|473130_473430_+	lysozyme	NA	A0A218M4K8	Erwinia_phage	64.9	2.6e-23
WP_012304197.1|473784_474264_+|tail	phage tail protein	tail	F1BUP0	Erwinia_phage	41.9	2.0e-28
WP_012304198.1|474397_475573_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	79.3	3.9e-179
WP_038399918.1|475584_476100_+|tail	phage major tail tube protein	tail	A0A218M4J0	Erwinia_phage	66.3	6.5e-62
WP_038399919.1|476153_476501_+|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	50.5	2.5e-17
WP_071819140.1|476515_476635_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
476671:476684	attL	TAGATAAAATCACC	NA	NA	NA	NA
WP_012304165.1|479532_479997_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	56.2	7.2e-44
WP_038399920.1|479993_481088_+	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	65.7	6.5e-128
WP_012105206.1|481162_481378_+	phage transcriptional activator, Ogr/Delta	NA	S4TNZ3	Salmonella_phage	60.6	1.1e-18
WP_012304167.1|481728_482736_-|integrase	tyrosine-type recombinase/integrase	integrase	P79671	Haemophilus_phage	59.3	3.4e-107
WP_038399923.1|482735_483116_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071840288.1|483184_483406_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032466344.1|483421_483964_-	hypothetical protein	NA	NA	NA	NA	NA
483671:483684	attR	GGTGATTTTATCTA	NA	NA	NA	NA
WP_032466343.1|483998_484367_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_012304171.1|484427_484619_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012304172.1|484631_484835_+	hypothetical protein	NA	U3PFJ1	Vibrio_phage	41.1	9.8e-06
WP_012304173.1|484846_485053_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012304174.1|485049_485364_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038399925.1|485505_485766_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038399926.1|485796_486102_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038399927.1|486184_486952_+	hypothetical protein	NA	K7ZRM8	Xanthomonas_citri_phage	49.3	1.9e-09
WP_038399929.1|487008_487662_+	3'-5' exonuclease	NA	A0A1D9C9N8	Salinivibrio_phage	62.9	3.0e-56
WP_080725834.1|487658_488561_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	E5G6L8	Salmonella_phage	53.5	3.5e-79
WP_049862773.1|488557_489595_+	phosphoadenosine phosphosulfate reductase family protein	NA	B7SYG0	Stenotrophomonas_phage	43.0	8.2e-64
WP_038399930.1|489591_492147_+	replication endonuclease	NA	E5G6L9	Salmonella_phage	37.4	3.8e-126
WP_012413686.1|492127_492358_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012413685.1|492354_492699_+	hypothetical protein	NA	H9C172	Pectobacterium_phage	40.7	5.0e-18
WP_038399932.1|493397_493652_-	DUF2513 domain-containing protein	NA	NA	NA	NA	NA
WP_024063353.1|493800_494838_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	63.3	1.0e-130
WP_038399933.1|494837_496601_-	oxidoreductase	NA	A0A1S6KZW3	Salmonella_phage	63.4	6.8e-228
WP_038399934.1|496792_497608_+|capsid	GPO family capsid scaffolding protein	capsid	E5G6M5	Salmonella_phage	69.2	4.0e-74
WP_032466330.1|497644_498700_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	63.0	6.5e-125
WP_038399936.1|498706_499360_+	hypothetical protein	NA	F1BUQ7	Erwinia_phage	47.3	2.9e-43
WP_011192313.1|499593_500085_+|head	head completion/stabilization protein	head	A0A1S5NNA6	Burkholderia_phage	48.4	7.9e-33
WP_011192312.1|500084_500288_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	70.1	1.8e-23
WP_011192311.1|500317_500704_+|holin	holin	holin	NA	NA	NA	NA
WP_011192310.1|500690_501086_+	M15 family metallopeptidase	NA	A9DET4	Yersinia_phage	71.8	3.5e-47
WP_032466327.1|501090_501516_+|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	48.9	4.2e-22
WP_072083431.1|501403_501628_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011192308.1|501614_502082_+|tail	phage tail protein	tail	F1BUP9	Erwinia_phage	57.2	1.8e-42
WP_011192307.1|502078_502525_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	50.7	7.7e-35
WP_012304193.1|502856_503558_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038399937.1|503888_504524_+|plate	phage baseplate assembly protein V	plate	O80314	Escherichia_phage	62.4	2.7e-65
WP_011192304.1|504520_504874_+|plate	baseplate assembly protein	plate	A0A218M4K8	Erwinia_phage	59.3	2.4e-31
WP_011192303.1|504876_505785_+|plate	baseplate assembly protein	plate	F1BUP3	Erwinia_phage	73.2	1.3e-118
WP_011192302.1|505777_506386_+|tail	phage tail protein I	tail	F1BUP2	Erwinia_phage	75.0	1.7e-85
WP_032466321.1|506382_507822_+	hypothetical protein	NA	F1BUP1	Erwinia_phage	77.8	2.2e-75
WP_038399939.1|507833_508313_+|tail	phage tail protein	tail	F1BUP0	Erwinia_phage	41.9	8.8e-29
WP_038399940.1|508446_509622_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	79.6	3.0e-179
WP_012105203.1|509633_510149_+|tail	phage major tail tube protein	tail	A0A218M4J0	Erwinia_phage	67.4	2.9e-62
WP_011192297.1|510202_510550_+|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	51.6	8.6e-18
WP_071819140.1|510564_510684_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_038399942.1|510676_513592_+|tail	phage tail tape measure protein	tail	Q9ZXK0	Pseudomonas_virus	46.4	1.6e-157
WP_038399943.1|513603_514068_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	56.2	5.5e-44
WP_038399944.1|514064_515159_+	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	66.0	1.1e-127
WP_012105206.1|515233_515449_+	phage transcriptional activator, Ogr/Delta	NA	S4TNZ3	Salmonella_phage	60.6	1.1e-18
>prophage 43
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	521177	521729	4806594		Salmonella_phage(100.0%)	1	NA	NA
WP_038399945.1|521177_521729_-	outer membrane beta-barrel protein	NA	A0A1B0VBR9	Salmonella_phage	34.4	1.6e-21
>prophage 44
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	537845	538607	4806594		Bacillus_phage(100.0%)	1	NA	NA
WP_002211159.1|537845_538607_-	L-cystine ABC transporter ATP-binding protein YecC	NA	W8CYL7	Bacillus_phage	36.6	6.1e-16
>prophage 45
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	553136	553304	4806594		Enterobacterial_phage(100.0%)	1	NA	NA
WP_002215990.1|553136_553304_-	hypothetical protein	NA	K7PGV2	Enterobacterial_phage	71.2	1.0e-16
>prophage 46
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	568656	570234	4806594		Staphylococcus_phage(100.0%)	1	NA	NA
WP_038399955.1|568656_570234_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.8	3.1e-14
>prophage 47
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	578941	579886	4806594		Clostridium_phage(100.0%)	1	NA	NA
WP_002211118.1|578941_579886_-	flagellar assembly peptidoglycan hydrolase FlgJ	NA	A0A0A7RU71	Clostridium_phage	35.9	2.9e-15
>prophage 48
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	600427	600658	4806594		Pectobacterium_phage(100.0%)	1	NA	NA
WP_002211091.1|600427_600658_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.0e-14
>prophage 49
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	606026	610827	4806594		Diachasmimorpha_longicaudata_entomopoxvirus(50.0%)	4	NA	NA
WP_011192156.1|606026_607409_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	30.1	6.2e-51
WP_011192155.1|607721_608903_+	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_002211082.1|609028_609286_-	YoaH family protein	NA	NA	NA	NA	NA
WP_002211081.1|609450_610827_+	aminodeoxychorismate synthase component 1	NA	A0A0B5J984	Pandoravirus	31.1	4.5e-41
>prophage 50
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	624160	625705	4806594		Moraxella_phage(100.0%)	1	NA	NA
WP_002231099.1|624160_625705_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	44.2	1.4e-38
>prophage 51
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	633643	638721	4806594		Bacillus_virus(50.0%)	5	NA	NA
WP_002211063.1|633643_635725_+	PAS domain S-box protein	NA	G3MA91	Bacillus_virus	30.7	4.1e-14
WP_002211062.1|635946_636225_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011192144.1|636446_637286_-	23S rRNA (guanine(745)-N(1))-methyltransferase	NA	NA	NA	NA	NA
WP_012413644.1|637665_638421_+	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
WP_002221949.1|638511_638721_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	79.7	5.3e-23
>prophage 52
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	642749	643049	4806594		Pectobacterium_phage(100.0%)	1	NA	NA
WP_002211053.1|642749_643049_-	DUF2591 family protein	NA	K9L3P6	Pectobacterium_phage	37.0	7.4e-10
>prophage 53
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	646575	648294	4806594		Bacillus_phage(100.0%)	1	NA	NA
WP_002211045.1|646575_648294_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.4	3.1e-52
>prophage 54
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	668536	669904	4806594		Dickeya_phage(100.0%)	1	NA	NA
WP_002211920.1|668536_669904_+	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	93.7	7.0e-63
>prophage 55
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	689889	691431	4806594		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_038399973.1|689889_691431_+	sugar ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	23.9	2.8e-07
>prophage 56
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	694818	695718	4806594		Cellulophaga_phage(100.0%)	1	NA	NA
WP_002211896.1|694818_695718_+	ATP phosphoribosyltransferase	NA	A0A0F7Q4B0	Cellulophaga_phage	81.6	3.2e-08
>prophage 57
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	701352	705829	4806594		Bacillus_phage(50.0%)	4	NA	NA
WP_012105321.1|701352_701967_+	bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE	NA	A0A2H4UVM0	Bodo_saltans_virus	28.8	2.3e-13
WP_002211888.1|702166_703576_-	NADP-dependent phosphogluconate dehydrogenase	NA	A0A1D7RI04	Synechococcus_phage	30.2	1.8e-29
WP_002211887.1|703961_704855_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	41.1	1.1e-45
WP_002211886.1|704938_705829_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	46.3	1.1e-56
>prophage 58
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	714340	715159	4806594		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_002211879.1|714340_715159_+	ABC transporter ATP-binding protein	NA	M1H3A1	Paramecium_bursaria_Chlorella_virus	29.7	2.0e-09
>prophage 59
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	721956	730694	4806594	tRNA	Moraxella_phage(25.0%)	6	NA	NA
WP_002211875.1|721956_723543_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	45.5	1.5e-40
WP_002211874.1|723674_725531_-	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
WP_002211873.1|725717_726299_-	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	43.2	2.5e-33
WP_002211872.1|726403_727045_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	37.9	1.0e-35
WP_038399977.1|727289_728402_-	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_038399978.1|728666_730694_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.1	1.8e-54
>prophage 60
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	743173	744694	4806594		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_002211964.1|743173_744694_-	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	29.9	2.6e-10
>prophage 61
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	747884	752300	4806594		Vibrio_phage(50.0%)	4	NA	NA
WP_002211960.1|747884_748547_-	GTP cyclohydrolase I FolE	NA	R9TJA5	Vibrio_phage	53.5	5.8e-55
WP_002211959.1|748730_749882_-	YbfB/YjiJ family MFS transporter	NA	NA	NA	NA	NA
WP_002211958.1|750017_750887_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002224699.1|751160_752300_+	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	30.2	6.1e-36
>prophage 62
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	757341	758010	4806594		Planktothrix_phage(100.0%)	1	NA	NA
WP_011192100.1|757341_758010_+	darobactin export ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.0	2.3e-35
>prophage 63
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	762857	764453	4806594		Tupanvirus(100.0%)	1	NA	NA
WP_002227996.1|762857_764453_-	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.5	6.1e-58
>prophage 64
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	782678	785381	4806594		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_038399990.1|782678_785381_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	32.5	5.2e-17
>prophage 65
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	793483	796126	4806594		Cronobacter_phage(100.0%)	1	NA	NA
WP_038399992.1|793483_796126_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	32.0	1.9e-93
>prophage 66
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	812892	813639	4806594		Diadromus_pulchellus_ascovirus(100.0%)	1	NA	NA
WP_002213038.1|812892_813639_+	SDR family oxidoreductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	31.4	3.3e-14
>prophage 67
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	820623	826471	4806594		Streptococcus_phage(50.0%)	6	NA	NA
WP_002213052.1|820623_821814_+	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	W6LLI2	Streptococcus_phage	28.1	2.1e-26
WP_002213054.1|821874_822192_+	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_002213056.1|822300_822717_-	CoA-binding protein	NA	NA	NA	NA	NA
WP_002213058.1|823032_823713_+	DUF2057 family protein	NA	NA	NA	NA	NA
WP_002213060.1|823891_824356_+	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_011192072.1|824416_826471_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	25.8	5.7e-16
>prophage 68
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	841381	843295	4806594		Tupanvirus(100.0%)	1	NA	NA
WP_012105373.1|841381_843295_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	28.9	2.0e-47
>prophage 69
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	854069	860686	4806594	tRNA	Powai_lake_megavirus(25.0%)	6	NA	NA
WP_002211301.1|854069_855470_+|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	35.2	6.5e-80
WP_162472802.1|855770_856850_+	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	57.1	2.9e-112
WP_012304295.1|857815_859006_+	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_071840291.1|859159_859276_+	gluconate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_011192061.1|859429_860077_-	MBL fold metallo-hydrolase	NA	A0A1X9I5D3	Streptococcus_phage	31.7	3.7e-22
WP_002211305.1|860137_860686_-	YcbK family protein	NA	A0A0K1LLY2	Rhodobacter_phage	34.7	7.8e-05
>prophage 70
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	873825	874035	4806594		Morganella_phage(100.0%)	1	NA	NA
WP_002211317.1|873825_874035_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	50.0	3.0e-10
>prophage 71
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	877204	882111	4806594		Bacillus_phage(100.0%)	3	NA	NA
WP_038400016.1|877204_878953_-	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	31.5	1.5e-65
WP_011192058.1|878988_881280_-	ComEC family protein	NA	NA	NA	NA	NA
WP_002211322.1|881826_882111_-	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	2.4e-10
>prophage 72
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	886487	890902	4806594		Streptococcus_phage(50.0%)	3	NA	NA
WP_011192055.1|886487_887573_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.1	1.7e-83
WP_038400019.1|887939_889787_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038400020.1|889807_890902_-	hemagglutinin	NA	B0FIT1	Escherichia_phage	32.7	3.7e-06
>prophage 73
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	895782	923216	4806594	protease,tRNA	Tetraselmis_virus(15.38%)	18	NA	NA
WP_002211332.1|895782_898065_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.2	1.6e-157
WP_002211333.1|898182_898857_-	glycosyltransferase family 25 protein	NA	A0A2H4UUT1	Bodo_saltans_virus	40.5	7.8e-31
WP_038400022.1|899843_900578_+	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	27.4	3.6e-21
WP_002211335.1|900731_901880_-	MFS transporter	NA	NA	NA	NA	NA
WP_002211336.1|902150_903443_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	43.5	4.0e-92
WP_002228009.1|903684_905028_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	39.4	5.4e-76
WP_002211338.1|905038_905647_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_038400024.1|905836_909766_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.8	1.5e-89
WP_002211340.1|909888_910383_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_038400026.1|911150_912113_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	45.7	3.8e-63
WP_012304304.1|912571_914338_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.9	8.9e-26
WP_002211344.1|914340_916065_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	31.8	3.3e-17
WP_002211346.1|916283_916994_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_002211347.1|917159_917378_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_011192049.1|917739_920016_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	41.8	1.9e-166
WP_002211349.1|920041_920362_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	42.7	8.2e-15
WP_002211350.1|920722_920986_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	59.7	3.6e-16
WP_002211351.1|921266_923216_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	37.7	8.8e-35
>prophage 74
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	939077	939806	4806594		Planktothrix_phage(100.0%)	1	NA	NA
WP_012105392.1|939077_939806_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	35.4	8.7e-28
>prophage 75
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	945128	955737	4806594		Anomala_cuprea_entomopoxvirus(25.0%)	10	NA	NA
WP_012105395.1|945128_945914_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.8	1.8e-10
WP_032466212.1|945910_946969_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_032466211.1|946968_948060_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002211378.1|948494_949421_-	prohibitin family protein	NA	A0A2C9D0H9	Yersinia_phage	44.1	4.6e-50
WP_002220045.1|950110_950842_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_038400032.1|950968_952099_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	26.8	3.9e-27
WP_011192038.1|952182_952647_-	YbjO family protein	NA	NA	NA	NA	NA
WP_002208758.1|952771_953617_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_011192037.1|953613_954579_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_002208760.1|954603_955737_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	35.4	3.4e-31
>prophage 76
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	958938	959202	4806594		Vibrio_phage(100.0%)	1	NA	NA
WP_002208765.1|958938_959202_+	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	70.5	2.5e-25
>prophage 77
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	967789	970984	4806594		Stx2-converting_phage(50.0%)	3	NA	NA
WP_002208774.1|967789_968995_-	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	48.6	6.1e-103
WP_002208775.1|969329_970001_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_002208776.1|969997_970984_-	methionine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.8	2.6e-19
>prophage 78
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	975026	978072	4806594		Acinetobacter_phage(50.0%)	2	NA	NA
WP_002208782.1|975026_977024_-	ligand-gated channel protein	NA	A0A0P0I887	Acinetobacter_phage	31.6	3.5e-10
WP_011192030.1|977283_978072_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.9	1.5e-12
>prophage 79
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	985327	986185	4806594		Catovirus(100.0%)	1	NA	NA
WP_002208791.1|985327_986185_+	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	31.0	6.9e-24
>prophage 80
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	996294	999491	4806594		Escherichia_virus(50.0%)	3	NA	NA
WP_002208801.1|996294_996750_+	NUDIX domain-containing protein	NA	D9ICN3	Escherichia_virus	44.3	2.9e-05
WP_038400036.1|996882_997881_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_038400037.1|997916_999491_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.8	2.9e-12
>prophage 81
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	1006069	1007861	4806594		Only_Syngen_Nebraska_virus(50.0%)	2	NA	NA
WP_072080443.1|1006069_1007035_+	C-terminal binding protein	NA	A0A1J0F959	Only_Syngen_Nebraska_virus	30.3	5.2e-28
WP_032466202.1|1007045_1007861_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.6	8.8e-13
>prophage 82
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	1012432	1013905	4806594		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_002224659.1|1012432_1013905_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	32.5	4.9e-46
>prophage 83
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	1017769	1018354	4806594		Clostridioides_phage(100.0%)	1	NA	NA
WP_002208822.1|1017769_1018354_+	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	39.8	2.8e-13
>prophage 84
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	1024549	1034122	4806594		Vibrio_phage(50.0%)	7	NA	NA
WP_012105426.1|1024549_1026142_+	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	32.8	1.3e-20
WP_011192014.1|1026202_1026547_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002208831.1|1027547_1028747_-	Bcr/CflA family multidrug efflux MFS transporter	NA	S4TR35	Salmonella_phage	25.1	1.3e-23
WP_012105427.1|1028895_1029603_-	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_012105428.1|1030116_1031874_+	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	42.4	3.0e-98
WP_002208834.1|1032035_1032320_+	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_038400045.1|1033117_1034122_-	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	47.7	3.1e-84
>prophage 85
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	1042807	1063861	4806594	plate,tail	Pseudomonas_phage(20.0%)	22	NA	NA
WP_002208845.1|1042807_1043587_-|tail	tail fiber protein	tail	Q9MCR6	Enterobacteria_phage	52.4	7.1e-52
WP_011192006.1|1043683_1044286_-	YmfQ family protein	NA	A0A2P9JZK7	Alteromonadaceae_phage	38.6	2.0e-33
WP_011192005.1|1044282_1045419_-|plate	baseplate J/gp47 family protein	plate	B5TK75	Pseudomonas_phage	30.5	3.5e-31
WP_002208848.1|1045422_1045878_-	hypothetical protein	NA	A0A0C4UR04	Shigella_phage	43.8	4.3e-17
WP_002215460.1|1045874_1046471_-|plate	baseplate assembly protein	plate	NA	NA	NA	NA
WP_011192004.1|1046486_1047542_-|tail	tail protein	tail	A0A2I7S9G1	Vibrio_phage	27.5	1.3e-37
WP_038400047.1|1047538_1048945_-	hypothetical protein	NA	U5P4I0	Shigella_phage	36.1	2.1e-17
WP_002208854.1|1050829_1051129_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_002208855.1|1051130_1051499_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_002208856.1|1051520_1053029_-|tail	tail protein	tail	B5TK67	Pseudomonas_phage	44.2	2.4e-104
WP_002208857.1|1053025_1053220_-	DUF2635 domain-containing protein	NA	B5TK66	Pseudomonas_phage	60.4	3.5e-08
WP_072085061.1|1053224_1053842_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_002208859.1|1053887_1054178_-	hypothetical protein	NA	H6WRZ3	Salmonella_phage	46.3	7.7e-12
WP_002208860.1|1054808_1055603_-	hydroxypyruvate isomerase family protein	NA	NA	NA	NA	NA
WP_002208861.1|1055578_1056391_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_032466639.1|1056393_1057065_-	aldolase	NA	A0A077SK32	Escherichia_phage	54.9	1.3e-57
WP_032466197.1|1057121_1058426_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	46.0	1.7e-90
WP_002215470.1|1058636_1059116_-	antitermination protein Q	NA	S5M7R9	Escherichia_phage	61.0	2.3e-37
WP_002208864.1|1059389_1060112_+	LexA family transcriptional regulator	NA	F1C599	Cronobacter_phage	51.9	2.2e-63
WP_002208866.1|1060317_1060560_+	DinI family protein	NA	K7PKR6	Enterobacteria_phage	65.0	6.9e-22
WP_011191999.1|1060731_1061667_+	omptin family outer membrane beta-barrel protein YcoB	NA	NA	NA	NA	NA
WP_002208868.1|1062073_1063861_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	63.5	4.0e-10
>prophage 86
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	1070187	1071303	4806594		Enterobacteria_phage(100.0%)	1	NA	NA
WP_038400049.1|1070187_1071303_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	57.6	1.3e-110
>prophage 87
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	1077001	1088137	4806594		Pseudomonas_phage(40.0%)	6	NA	NA
WP_072085060.1|1077001_1079875_-	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	28.3	3.8e-42
WP_038400052.1|1080062_1082774_-	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	34.4	1.4e-102
WP_002210820.1|1083073_1083802_+	bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase	NA	NA	NA	NA	NA
WP_011191994.1|1084295_1086584_+	ribonucleoside-diphosphate reductase subunit alpha	NA	I3UMG3	Colwellia_phage	64.9	1.9e-286
WP_002210817.1|1086745_1087876_+	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	78.6	7.6e-172
WP_002210816.1|1087879_1088137_+	2Fe-2S ferredoxin-like protein	NA	G9IAA2	Pseudomonas_phage	54.9	4.0e-20
>prophage 88
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	1092896	1097971	4806594		Tupanvirus(33.33%)	3	NA	NA
WP_038400053.1|1092896_1094333_+	catalase	NA	A0A2K9L0T1	Tupanvirus	38.7	2.2e-99
WP_011191991.1|1094405_1096586_-	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	26.3	1.4e-44
WP_011191990.1|1096855_1097971_+	porin OmpF2	NA	Q1MVN1	Enterobacteria_phage	54.5	1.3e-110
>prophage 89
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	1104802	1105741	4806594		Bacillus_virus(100.0%)	1	NA	NA
WP_002210802.1|1104802_1105741_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.7	8.6e-20
>prophage 90
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	1112226	1113789	4806594		Staphylococcus_phage(50.0%)	2	NA	NA
WP_012304351.1|1112226_1112925_-	urea ABC transporter ATP-binding subunit UrtE	NA	A0A2H4PQG7	Staphylococcus_phage	25.6	1.1e-11
WP_032465620.1|1113018_1113789_-	urea ABC transporter ATP-binding protein UrtD	NA	A0A285PWH2	Cedratvirus	28.2	3.9e-10
>prophage 91
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	1118396	1118870	4806594		Enterobacteria_phage(100.0%)	1	NA	NA
WP_002210791.1|1118396_1118870_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	50.7	1.7e-37
>prophage 92
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	1121928	1122765	4806594		Pithovirus(100.0%)	1	NA	NA
WP_002210787.1|1121928_1122765_-	phosphonate ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	28.8	8.2e-14
>prophage 93
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	1131825	1137076	4806594		Diachasmimorpha_longicaudata_entomopoxvirus(50.0%)	4	NA	NA
WP_002220152.1|1131825_1133181_-	ATP-dependent RNA helicase RhlE	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	35.6	4.1e-55
WP_002220154.1|1133571_1134282_+	transcriptional regulator CecR	NA	NA	NA	NA	NA
WP_011191973.1|1134333_1135320_+	secretion protein HlyD	NA	NA	NA	NA	NA
WP_011191972.1|1135333_1137076_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.6	6.3e-24
>prophage 94
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	1142678	1157645	4806594	holin	Feldmannia_irregularis_virus(20.0%)	11	NA	NA
WP_011191970.1|1142678_1144043_-	sigma 54-interacting transcriptional regulator	NA	Q6XM27	Feldmannia_irregularis_virus	29.1	1.3e-05
WP_011191969.1|1144029_1145844_-	PAS domain S-box protein	NA	W8CYF6	Bacillus_phage	28.4	5.9e-17
WP_011191968.1|1146193_1146667_+	zinc resistance sensor/chaperone ZraP	NA	NA	NA	NA	NA
WP_011191967.1|1146754_1148011_-	MFS transporter	NA	NA	NA	NA	NA
WP_011191966.1|1148149_1149013_-	xanthosine phosphorylase	NA	Q5YBA4	Grouper_iridovirus	40.7	1.7e-51
WP_038400062.1|1149358_1150207_+	DMT family transporter	NA	NA	NA	NA	NA
WP_038400063.1|1150244_1151138_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011191964.1|1151378_1153427_-|holin	choline transporter	holin	A0A2I7QNT1	Vibrio_phage	28.5	1.4e-19
WP_002218278.1|1153792_1154389_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_038400064.1|1154446_1155919_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_024063412.1|1155941_1157645_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.4	2.1e-56
>prophage 95
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	1161739	1162663	4806594		Streptococcus_phage(100.0%)	1	NA	NA
WP_002210769.1|1161739_1162663_+	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	27.8	3.7e-23
>prophage 96
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	1166436	1167147	4806594		Bacillus_phage(100.0%)	1	NA	NA
WP_002210766.1|1166436_1167147_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.1	3.1e-06
>prophage 97
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	1171124	1182732	4806594	protease	Klosneuvirus(25.0%)	11	NA	NA
WP_038400065.1|1171124_1172405_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	32.1	2.4e-17
WP_011191955.1|1172590_1173595_-	6-phosphogluconolactonase	NA	NA	NA	NA	NA
WP_012304377.1|1173885_1174707_+	pyridoxal phosphatase	NA	NA	NA	NA	NA
WP_038400066.1|1174763_1175843_-	molybdenum ABC transporter ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	35.1	1.4e-21
WP_038400067.1|1175836_1176532_-	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_002210756.1|1176531_1177311_-	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002217291.1|1177545_1177698_-	multidrug efflux pump-associated protein, AcrZ family	NA	NA	NA	NA	NA
WP_002210754.1|1177929_1178721_+	molybdenum-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_024063421.1|1178830_1180321_+	molybdate ABC transporter ATP-binding protein ModF	NA	A0A1M7XV31	Cedratvirus	26.8	2.8e-12
WP_002210751.1|1180537_1181356_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_002230680.1|1181715_1182732_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	45.1	4.7e-80
>prophage 98
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	1187914	1191212	4806594		Edwardsiella_phage(33.33%)	3	NA	NA
WP_002223549.1|1187914_1188967_-	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A0B6VT43	Edwardsiella_phage	47.7	1.3e-80
WP_002210743.1|1189433_1190372_+	CDF family zinc transporter ZitB	NA	A0A1V0SED0	Indivirus	42.0	1.2e-10
WP_002210742.1|1190486_1191212_-	nicotinamide riboside transporter PnuC	NA	A0A2I7SAC7	Vibrio_phage	28.6	8.7e-20
>prophage 99
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	1202869	1203742	4806594		Tupanvirus(100.0%)	1	NA	NA
WP_002210729.1|1202869_1203742_-	succinate--CoA ligase subunit alpha	NA	A0A2K9L1S3	Tupanvirus	34.7	3.6e-20
>prophage 100
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	1219605	1221895	4806594	integrase	Staphylococcus_phage(50.0%)	2	1211483:1211495	1225846:1225858
1211483:1211495	attL	CAGAGAAAATAGT	NA	NA	NA	NA
WP_002210714.1|1219605_1220088_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.2	3.4e-28
WP_071840295.1|1220611_1221895_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	86.8	9.4e-211
1225846:1225858	attR	ACTATTTTCTCTG	NA	NA	NA	NA
>prophage 101
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	1241462	1245383	4806594	integrase	uncultured_Caudovirales_phage(33.33%)	5	1233859:1233872	1244243:1244256
1233859:1233872	attL	TCAAATTATTCATA	NA	NA	NA	NA
WP_005172867.1|1241462_1241666_-	AlpA family transcriptional regulator	NA	A0A2H4J8C8	uncultured_Caudovirales_phage	36.0	8.3e-05
WP_072085111.1|1242380_1242911_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1B5FPC6	Escherichia_phage	46.3	7.0e-35
WP_002215393.1|1243305_1243491_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002212204.1|1243653_1243905_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012304383.1|1244615_1245383_+	esterase	NA	G1DB77	Mycobacterium_phage	35.1	3.4e-06
1244243:1244256	attR	TCAAATTATTCATA	NA	NA	NA	NA
>prophage 102
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	1253329	1255659	4806594	transposase,tRNA	Escherichia_phage(50.0%)	2	NA	NA
WP_002210354.1|1253329_1254997_-|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	86.9	8.9e-294
WP_002213775.1|1255200_1255659_-|transposase	IS200/IS605-like element IS1541B family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	8.5e-13
>prophage 103
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	1262747	1264412	4806594		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_002210348.1|1262747_1264412_+	asparagine synthase B	NA	H8ZJK1	Ostreococcus_tauri_virus	39.4	3.0e-84
>prophage 104
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	1269093	1270149	4806594		Pseudomonas_phage(100.0%)	1	NA	NA
WP_002354474.1|1269093_1270149_+	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	44.7	1.6e-46
>prophage 105
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	1276384	1280571	4806594	tRNA	Planktothrix_phage(50.0%)	3	NA	NA
WP_002210336.1|1276384_1277110_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.5	5.8e-32
WP_002210335.1|1277244_1277727_-	zinc ribbon-containing protein	NA	NA	NA	NA	NA
WP_002210333.1|1277988_1280571_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	42.3	4.3e-186
>prophage 106
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	1287190	1289878	4806594		Synechococcus_phage(50.0%)	2	NA	NA
WP_002210324.1|1287190_1288273_+	endolytic peptidoglycan transglycosylase RlpA	NA	F5B3X9	Synechococcus_phage	53.9	3.7e-14
WP_011191931.1|1288675_1289878_+	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	51.8	7.7e-106
>prophage 107
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	1293431	1294447	4806594		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_012105525.1|1293431_1293815_+	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	58.3	8.1e-25
WP_002210315.1|1294237_1294447_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	5.9e-22
>prophage 108
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	1298792	1300583	4806594		Bacillus_phage(100.0%)	1	NA	NA
WP_002214723.1|1298792_1300583_-	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	29.3	1.3e-48
>prophage 109
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	1307284	1313177	4806594		Acanthocystis_turfacea_Chlorella_virus(50.0%)	4	NA	NA
WP_012105532.1|1307284_1308832_-	sugar ABC transporter ATP-binding protein	NA	M1HS04	Acanthocystis_turfacea_Chlorella_virus	20.9	7.3e-08
WP_002210300.1|1308880_1309810_-	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_038400119.1|1309953_1310940_-	inositol 2-dehydrogenase	NA	NA	NA	NA	NA
WP_002359655.1|1311251_1313177_-	3D-(3,5/4)-trihydroxycyclohexane-1,2-dione acylhydrolase (decyclizing)	NA	E5ERI2	Ostreococcus_lucimarinus_virus	23.9	1.2e-23
>prophage 110
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	1342399	1343251	4806594		Staphylococcus_phage(100.0%)	1	NA	NA
WP_002209762.1|1342399_1343251_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	41.1	1.2e-49
>prophage 111
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	1352357	1440042	4806594	integrase,plate,tail,protease,terminase,tRNA,holin	Salmonella_phage(10.81%)	100	1399315:1399332	1440335:1440352
WP_080619191.1|1352357_1352636_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y6Q1	Salmonella_phage	72.6	1.6e-30
WP_002215266.1|1352718_1353057_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012105552.1|1353041_1353689_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002215268.1|1353802_1354003_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038400129.1|1354261_1354444_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_038400131.1|1354657_1355491_-	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_038400133.1|1355623_1355992_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038400135.1|1356017_1356392_-	Mu phage lytic protein YfjZ	NA	NA	NA	NA	NA
WP_038400137.1|1356412_1356634_-	DUF987 domain-containing protein	NA	NA	NA	NA	NA
WP_080725838.1|1356644_1357172_-	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_038400140.1|1357184_1357649_-	antirestriction protein	NA	NA	NA	NA	NA
WP_162472803.1|1357789_1357954_-	DUF905 family protein	NA	NA	NA	NA	NA
WP_038400142.1|1357979_1358813_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.2	4.0e-45
WP_038400144.1|1358956_1359313_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038401596.1|1359367_1359805_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038400146.1|1359861_1360416_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144243023.1|1360663_1361554_-	GTP-binding protein	NA	NA	NA	NA	NA
WP_038400148.1|1361650_1362508_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038400151.1|1362920_1363130_+	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_038400153.1|1363797_1364418_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_038400157.1|1364901_1365885_-	toll/interleukin-1 receptor domain-containing protein	NA	NA	NA	NA	NA
WP_038400160.1|1366121_1366841_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038400162.1|1366850_1367963_+	ImmA/IrrE family metallo-endopeptidase	NA	B6SBZ6	Clostridium_virus	31.8	1.4e-37
WP_038400164.1|1368204_1369980_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_038400166.1|1369976_1371125_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038400167.1|1371243_1372506_-	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_144243024.1|1372509_1374528_-	ATP-dependent helicase	NA	NA	NA	NA	NA
WP_038400171.1|1374565_1377238_-	class I SAM-dependent DNA methyltransferase	NA	Q6NE04	Leptospira_phage	38.9	1.3e-161
WP_038400173.1|1377909_1379124_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	58.4	2.8e-132
WP_002209774.1|1379591_1380458_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	34.1	2.2e-30
WP_002209775.1|1380472_1380685_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_024063201.1|1380906_1382292_-|tRNA	cysteine--tRNA ligase	tRNA	A0A0G2Y344	Acanthamoeba_polyphaga_mimivirus	28.7	1.3e-40
WP_002208567.1|1382502_1382997_+	peptidylprolyl isomerase B	NA	NA	NA	NA	NA
WP_002208568.1|1383007_1383730_+	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_032466182.1|1384025_1384550_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
WP_002208570.1|1384546_1385611_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_032466184.1|1385654_1388084_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_011191895.1|1388080_1388767_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.2	2.1e-31
WP_002208573.1|1388737_1389373_+|protease	multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1	protease	NA	NA	NA	NA
WP_002208574.1|1389759_1390536_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_032466185.1|1390612_1391482_+	co-chaperone YbbN	NA	NA	NA	NA	NA
WP_002208576.1|1391676_1392591_+	SPFH/Band 7/PHB domain protein	NA	NA	NA	NA	NA
WP_002208577.1|1392593_1393043_+	NfeD family protein	NA	NA	NA	NA	NA
WP_002208578.1|1393222_1393642_-	Cu(I)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_011191893.1|1393848_1396734_+	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	36.8	7.8e-112
WP_002208580.1|1396882_1397692_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032466186.1|1397955_1398435_+|tRNA	Cys-tRNA(Pro)/Cys-tRNA(Cys) deacylase YbaK	tRNA	NA	NA	NA	NA
WP_002208583.1|1398771_1399011_+	hypothetical protein	NA	NA	NA	NA	NA
1399315:1399332	attL	TTTTGCAGAAGGTTTTTT	NA	NA	NA	NA
WP_080725839.1|1399389_1399626_-	hypothetical protein	NA	B6SCW7	Bacteriophage	53.3	7.2e-16
WP_038400176.1|1399817_1400654_-|tail	tail fiber protein	tail	Q858V4	Yersinia_virus	35.7	5.7e-07
WP_038400177.1|1400704_1401301_-	YmfQ family protein	NA	A0A2P9JZK7	Alteromonadaceae_phage	37.2	3.6e-32
WP_038400178.1|1401297_1402431_-|plate	baseplate J/gp47 family protein	plate	B6SBU6	Clostridium_virus	25.8	1.7e-09
WP_038400179.1|1402434_1402872_-	hypothetical protein	NA	A0A0C4UR04	Shigella_phage	46.2	6.2e-21
WP_012304446.1|1402868_1403462_-|plate	baseplate assembly protein	plate	NA	NA	NA	NA
WP_038400180.1|1403461_1404532_-|tail	tail protein	tail	M1PVV2	Vibrio_phage	30.9	2.4e-42
WP_012304448.1|1404528_1405935_-	hypothetical protein	NA	A0A192Y5U9	Salmonella_phage	27.7	2.3e-24
WP_038400182.1|1405998_1406538_-	zinc ribbon domain-containing protein	NA	S4TR42	Salmonella_phage	59.8	4.3e-24
WP_012304450.1|1406641_1408588_-	hypothetical protein	NA	A0A2R3UAN6	Myoviridae_environmental_samples	24.0	2.3e-14
WP_012304451.1|1408710_1409010_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_012304452.1|1409011_1409386_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_038400184.1|1409398_1410907_-|tail	tail protein	tail	B5TK67	Pseudomonas_phage	45.2	4.3e-106
WP_038400186.1|1410906_1411098_-	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
WP_038400188.1|1411103_1411601_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038400190.1|1411677_1411926_-	hypothetical protein	NA	A0A1W6JPH4	Morganella_phage	51.3	5.2e-17
WP_038400192.1|1412046_1412631_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038400194.1|1412966_1413488_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038400196.1|1413509_1414217_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038400197.1|1414306_1414654_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038400199.1|1415644_1416298_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038400202.1|1416300_1417299_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_038400204.1|1417516_1417768_-	pyocin activator protein PrtN	NA	K7PGU0	Enterobacteria_phage	56.4	2.1e-18
WP_158499329.1|1418182_1418332_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080725840.1|1418550_1419930_-	AAA family ATPase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	62.4	4.0e-151
WP_038400206.1|1419926_1420265_-	hypothetical protein	NA	A0A2H4JCX7	uncultured_Caudovirales_phage	53.8	1.9e-22
WP_049862777.1|1420261_1420576_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038400208.1|1420568_1420766_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038400210.1|1420755_1420938_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_012303527.1|1420918_1421113_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012303526.1|1421105_1421480_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038401606.1|1421472_1421748_-	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_038400213.1|1421962_1422301_+	hypothetical protein	NA	A0A0K2FIR8	Escherichia_phage	38.5	1.1e-06
WP_158499330.1|1422312_1422822_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038400217.1|1422820_1423171_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_049862778.1|1423516_1424053_-	antirepressor protein	NA	A0A1W6JPH8	Morganella_phage	62.3	1.0e-46
WP_144243034.1|1424213_1424795_-	antirepressor protein	NA	A0A1W6JPH8	Morganella_phage	52.3	5.1e-47
WP_038400221.1|1424962_1425181_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_038400223.1|1425218_1426469_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1V0E8G8	Vibrio_phage	42.8	3.1e-89
WP_038400225.1|1428156_1428402_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038400227.1|1428410_1430519_-|terminase	terminase	terminase	A0A2K9V3X4	Faecalibacterium_phage	36.6	2.1e-98
WP_038400229.1|1430460_1431027_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038400232.1|1431306_1431951_-	hypothetical protein	NA	A0A1B0Z000	Pseudomonas_phage	33.7	7.5e-07
WP_038400234.1|1432322_1432571_-	hypothetical protein	NA	G8C7W3	Escherichia_phage	59.6	2.5e-19
WP_038400237.1|1432851_1433184_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038400238.1|1433180_1433807_-	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	63.6	6.9e-66
WP_038400240.1|1433810_1434161_-|holin	phage holin, lambda family	holin	U5P0K7	Shigella_phage	55.1	4.9e-29
WP_049862779.1|1434358_1434733_+	hypothetical protein	NA	E5AGG6	Erwinia_phage	54.8	1.5e-23
WP_038400242.1|1434959_1436021_-	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	60.2	4.7e-123
WP_038400244.1|1436376_1437195_-	antitermination protein	NA	F1C595	Cronobacter_phage	41.3	1.6e-54
WP_038400245.1|1437271_1438303_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	47.1	3.1e-87
WP_038400247.1|1438299_1440042_-	DNA methyltransferase	NA	H9C171	Pectobacterium_phage	63.4	2.7e-245
1440335:1440352	attR	TTTTGCAGAAGGTTTTTT	NA	NA	NA	NA
>prophage 112
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	1449245	1453413	4806594		Synechococcus_phage(60.0%)	5	NA	NA
WP_038400256.1|1449245_1449923_-	NTP transferase domain-containing protein	NA	M1I080	Acanthocystis_turfacea_Chlorella_virus	26.6	3.2e-08
WP_012413525.1|1449924_1450515_-	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	34.5	5.6e-17
WP_012413524.1|1450502_1451531_-	dehydrogenase	NA	A0A222YW25	Synechococcus_phage	41.1	1.2e-62
WP_012413523.1|1451548_1452577_-	GDP-D-glycero-D-manno-heptose 6-dehydratase DmhA	NA	A0A222YY99	Synechococcus_phage	75.1	3.8e-146
WP_038400259.1|1452579_1453413_-	NAD(P)-dependent oxidoreductase	NA	A0A222YYW2	Synechococcus_phage	30.9	8.7e-32
>prophage 113
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	1461984	1474969	4806594		Ostreococcus_tauri_virus(20.0%)	11	NA	NA
WP_011191881.1|1461984_1463298_-	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	3.1e-52
WP_071840302.1|1463315_1464389_-	CDP-glucose 4,6-dehydratase	NA	NA	NA	NA	NA
WP_002208597.1|1464393_1465167_-	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_002208598.1|1465204_1466194_-	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	A0A1D8KSN6	Synechococcus_phage	44.7	1.9e-09
WP_002208599.1|1466791_1467754_-	ferrochelatase	NA	NA	NA	NA	NA
WP_002208600.1|1467843_1468488_-	adenylate kinase	NA	NA	NA	NA	NA
WP_002208601.1|1468714_1470589_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	37.2	2.4e-114
WP_002208603.1|1470780_1471386_-	recombination protein RecR	NA	NA	NA	NA	NA
WP_002208604.1|1471385_1471718_-	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_002208605.1|1471773_1473750_-	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	36.6	3.4e-42
WP_012105567.1|1474405_1474969_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	40.5	2.7e-29
>prophage 114
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	1494189	1497772	4806594		Bacillus_phage(100.0%)	2	NA	NA
WP_012304501.1|1494189_1496013_-	SmdB family multidrug efflux ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.5	6.5e-40
WP_012304502.1|1496005_1497772_-	SmdA family multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.5	1.6e-46
>prophage 115
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	1502606	1503305	4806594		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_002208635.1|1502606_1503305_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	70.5	2.1e-87
>prophage 116
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	1506924	1512064	4806594	protease	Burkholderia_virus(25.0%)	4	NA	NA
WP_002208639.1|1506924_1507197_-	DNA-binding protein HU-beta	NA	A4JWM7	Burkholderia_virus	59.6	3.5e-22
WP_002208640.1|1507414_1509769_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.9	4.5e-227
WP_002208641.1|1509963_1511235_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.2	7.3e-131
WP_002208642.1|1511440_1512064_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	62.9	1.7e-64
>prophage 117
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	1534817	1543912	4806594	transposase,tRNA	uncultured_Mediterranean_phage(50.0%)	9	NA	NA
WP_002208666.1|1534817_1535288_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	47.7	3.5e-30
WP_002208667.1|1535423_1536533_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	34.2	1.5e-50
WP_002208668.1|1536682_1537132_-	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_032466145.1|1537202_1537796_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002213759.1|1538821_1539280_-|transposase	IS200/IS605-like element IS1541A family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	8.5e-13
WP_038400294.1|1539486_1540455_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	39.7	2.5e-46
WP_002208670.1|1540465_1542313_-	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_002208671.1|1542340_1542676_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	35.6	6.4e-10
WP_002208672.1|1542787_1543912_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	45.8	3.2e-90
>prophage 118
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	1556783	1566515	4806594		Bacillus_phage(50.0%)	6	NA	NA
WP_012304517.1|1556783_1558100_-	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	29.2	7.1e-28
WP_002208685.1|1558124_1558814_-	phosphate response regulator transcription factor PhoB	NA	W8CYM9	Bacillus_phage	37.1	1.7e-36
WP_002208687.1|1559081_1560326_+	exonuclease subunit SbcD	NA	NA	NA	NA	NA
WP_012105590.1|1560322_1564012_+	AAA family ATPase	NA	G3MAB6	Bacillus_virus	26.1	2.2e-10
WP_002208690.1|1564356_1565271_-	fructokinase	NA	NA	NA	NA	NA
WP_002208691.1|1565603_1566515_+	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	65.5	7.9e-103
>prophage 119
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	1571948	1579968	4806594	transposase,holin	Streptococcus_phage(40.0%)	8	NA	NA
WP_011191846.1|1571948_1573208_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	45.6	2.7e-93
WP_038400308.1|1573217_1574321_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	43.6	7.7e-60
WP_002208702.1|1574497_1574899_-	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_002208703.1|1574958_1576206_-	esterase FrsA	NA	NA	NA	NA	NA
WP_002208704.1|1576332_1576791_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_002216043.1|1577217_1577523_+|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	46.2	2.0e-10
WP_002208705.1|1577719_1579324_+	chitin-binding domain protein	NA	Q9J8B0	Spodoptera_exigua_multiple_nucleopolyhedrovirus	31.0	2.3e-20
WP_002213759.1|1579509_1579968_+|transposase	IS200/IS605-like element IS1541A family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	8.5e-13
>prophage 120
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	1596810	1597392	4806594		Caulobacter_phage(100.0%)	1	NA	NA
WP_002208720.1|1596810_1597392_-	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	30.8	3.7e-13
>prophage 121
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	1618649	1624763	4806594	integrase	Salmonella_phage(60.0%)	6	1611868:1611927	1626825:1626890
1611868:1611927	attL	CCTGATGAGCTGACATCAGTCAGTGATTCAGGCGAGTGAGAGCCGCTAACACCGCTGCGG	NA	NA	NA	NA
WP_038400318.1|1618649_1618901_+	Arc family DNA-binding protein	NA	E7C9U8	Salmonella_phage	64.6	2.3e-20
WP_123767273.1|1618884_1619565_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038400320.1|1619583_1621449_-	hypothetical protein	NA	E7C9U6	Salmonella_phage	62.0	6.6e-197
WP_038400322.1|1621448_1622885_-	phage DNA ejection protein	NA	A0A2H4FND5	Salmonella_phage	43.8	1.8e-85
WP_038400326.1|1623207_1623459_+	DUF1233 family excisionase	NA	A0A286S2A4	Klebsiella_phage	50.0	5.8e-16
WP_038400327.1|1623491_1624763_+|integrase	site-specific integrase	integrase	Q8W658	Enterobacteria_phage	53.4	2.2e-127
1626825:1626890	attR	CCTGATGAGCTGACATCAGTCAGTGATTCAGGCGAGTGAGAGCCGCTAACACCGCTGCGGCGTCAA	NA	NA	NA	NA
>prophage 122
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	1629739	1630486	4806594		Planktothrix_phage(100.0%)	1	NA	NA
WP_002208732.1|1629739_1630486_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	41.1	3.4e-35
>prophage 123
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	1644206	1644644	4806594		Streptomyces_phage(100.0%)	1	NA	NA
WP_002216643.1|1644206_1644644_+	thioredoxin TrxC	NA	A0A1J0GW78	Streptomyces_phage	36.6	2.6e-11
>prophage 124
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	1656094	1658668	4806594		Enterobacteria_phage(100.0%)	1	NA	NA
WP_002217405.1|1656094_1658668_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	34.9	2.4e-128
>prophage 125
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	1664849	1665920	4806594		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_002228238.1|1664849_1665920_-	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.4	1.5e-89
>prophage 126
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	1680629	1686685	4806594	tRNA	Vibrio_phage(25.0%)	5	NA	NA
WP_002209449.1|1680629_1680815_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	3.8e-12
WP_012105619.1|1681064_1683692_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	36.5	7.9e-79
WP_032466124.1|1683831_1684380_-	recombination regulator RecX	NA	NA	NA	NA	NA
WP_002209446.1|1685011_1686082_-	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	61.3	4.1e-111
WP_002209445.1|1686196_1686685_-	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	48.0	2.6e-28
>prophage 127
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	1695838	1697362	4806594		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_011191801.1|1695838_1697362_-	sugar ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	27.5	3.4e-10
>prophage 128
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	1702369	1707969	4806594		Escherichia_phage(100.0%)	5	NA	NA
WP_011191798.1|1702369_1702900_+	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	42.1	1.6e-15
WP_038400356.1|1703157_1703868_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	37.0	2.2e-23
WP_011191796.1|1704027_1704888_-	dimethyl sulfoxide reductase anchor subunit	NA	A0A077SK59	Escherichia_phage	33.7	1.3e-22
WP_002209428.1|1704889_1705507_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	58.6	1.8e-74
WP_024063669.1|1705518_1707969_-	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.6	2.1e-219
>prophage 129
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	1712503	1714018	4806594		Bacillus_virus(100.0%)	1	NA	NA
WP_038400358.1|1712503_1714018_+	sugar ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	26.4	3.3e-13
>prophage 130
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	1723932	1726029	4806594		Acinetobacter_phage(100.0%)	1	NA	NA
WP_038400364.1|1723932_1726029_-	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	32.6	5.8e-08
>prophage 131
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	1730267	1731983	4806594		uncultured_Caudovirales_phage(100.0%)	2	NA	NA
WP_012304554.1|1730267_1730609_+	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	57.1	9.7e-22
WP_012304555.1|1730693_1731983_+	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	72.5	1.7e-167
>prophage 132
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	1735398	1745623	4806594		uncultured_Mediterranean_phage(33.33%)	8	NA	NA
WP_002209404.1|1735398_1736169_-	D-threitol dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	28.9	2.5e-17
WP_002209403.1|1736232_1737348_-	erythritol/L-threitol dehydrogenase	NA	NA	NA	NA	NA
WP_002209402.1|1737830_1738286_+	ribose 5-phosphate isomerase B	NA	NA	NA	NA	NA
WP_038400371.1|1739128_1741684_+	DNA mismatch repair protein MutS	NA	A0A1V0SGG8	Hokovirus	22.8	3.4e-26
WP_038400373.1|1742080_1743079_-	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.3	2.1e-32
WP_012304557.1|1743133_1744117_-	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	2.3e-07
WP_002209395.1|1744238_1744865_-	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.4	9.1e-34
WP_011191778.1|1744858_1745623_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	46.7	4.2e-57
>prophage 133
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	1749161	1751241	4806594		Tupanvirus(50.0%)	2	NA	NA
WP_002209388.1|1749161_1749803_-	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	40.3	1.0e-27
WP_002228227.1|1749804_1751241_-	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	26.7	4.2e-34
>prophage 134
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	1754637	1755620	4806594	transposase	Haemophilus_virus(50.0%)	2	NA	NA
WP_002209383.1|1754637_1755045_+	HicB family protein	NA	Q775F5	Haemophilus_virus	40.0	5.4e-19
WP_002213775.1|1755161_1755620_-|transposase	IS200/IS605-like element IS1541B family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	8.5e-13
>prophage 135
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	1761116	1765882	4806594		Bacillus_phage(25.0%)	4	NA	NA
WP_002209379.1|1761116_1761788_-	7-carboxy-7-deazaguanine synthase QueE	NA	J9PV61	Bacillus_phage	28.8	1.9e-13
WP_161597822.1|1761891_1762407_-	superoxide dismutase [Cu-Zn] SodC1	NA	Q9MC02	Salmonella_phage	71.1	2.4e-56
WP_038400379.1|1762868_1764164_-	phosphopyruvate hydratase	NA	W6LP63	Streptococcus_phage	57.8	2.2e-130
WP_002209376.1|1764244_1765882_-	CTP synthase (glutamine hydrolyzing)	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	51.3	5.0e-156
>prophage 136
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	1769833	1774257	4806594	protease	Hokovirus(50.0%)	2	NA	NA
WP_038400382.1|1769833_1772653_+	two-component sensor histidine kinase BarA	NA	A0A1V0SGX0	Hokovirus	29.5	5.9e-48
WP_012105650.1|1772811_1774257_-|protease	serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	29.6	3.6e-25
>prophage 137
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	1778727	1779072	4806594		Lake_Baikal_phage(100.0%)	1	NA	NA
WP_002209365.1|1778727_1779072_-	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	50.0	3.5e-27
>prophage 138
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	1785778	1792045	4806594		Planktothrix_phage(50.0%)	3	NA	NA
WP_002209359.1|1785778_1786573_-	Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC	NA	G9BWD6	Planktothrix_phage	29.0	2.1e-14
WP_038400388.1|1786894_1789375_-	bifunctional glycosyl transferase/transpeptidase	NA	NA	NA	NA	NA
WP_038401628.1|1789483_1792045_-	ATP-dependent helicase HrpB	NA	A0A2H4UU36	Bodo_saltans_virus	28.8	3.5e-39
>prophage 139
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	1795529	1797525	4806594		Bacillus_virus(50.0%)	2	NA	NA
WP_002228219.1|1795529_1797038_+	polynucleotide adenylyltransferase PcnB	NA	G3MAR3	Bacillus_virus	30.6	6.2e-28
WP_002209351.1|1797045_1797525_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	S4VNV0	Pandoravirus	43.2	1.4e-18
>prophage 140
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	1802754	1807262	4806594		Anomala_cuprea_entomopoxvirus(33.33%)	4	NA	NA
WP_011191749.1|1802754_1803681_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.7	5.9e-21
WP_002209342.1|1803916_1804579_+	carbonate dehydratase	NA	NA	NA	NA	NA
WP_011191748.1|1804904_1805441_-	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.1	5.1e-17
WP_011191747.1|1805660_1807262_-	multicopper oxidase CueO	NA	A0A0C6DWA2	Mamastrovirus	45.3	5.2e-17
>prophage 141
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	1815096	1816521	4806594		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_002209332.1|1815096_1816521_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.9	1.0e-40
>prophage 142
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	1831223	1834885	4806594		Chrysochromulina_ericina_virus(50.0%)	5	NA	NA
WP_002209320.1|1831223_1832267_-	GMP reductase	NA	A0A0N9Q9A5	Chrysochromulina_ericina_virus	56.2	6.3e-104
WP_002209319.1|1832562_1833183_+	dephospho-CoA kinase	NA	NA	NA	NA	NA
WP_002209318.1|1833179_1833932_+	cell division protein ZapD	NA	NA	NA	NA	NA
WP_002209317.1|1834139_1834346_+	DNA gyrase inhibitor YacG	NA	NA	NA	NA	NA
WP_002210424.1|1834498_1834885_-	8-oxo-dGTP diphosphatase MutT	NA	A0A0B5CYJ3	Rhizoctonia_fumigata_mycovirus	30.4	8.4e-06
>prophage 143
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	1860846	1864839	4806594		Yellowstone_lake_phycodnavirus(50.0%)	2	NA	NA
WP_002228103.1|1860846_1862574_-	acetolactate synthase 3 large subunit	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	29.4	7.8e-59
WP_038400409.1|1863033_1864839_-	long-chain fatty acid--CoA ligase	NA	A0A1V0SBX8	Catovirus	23.2	2.7e-38
>prophage 144
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	1879535	1886998	4806594		Bacillus_virus(33.33%)	4	NA	NA
WP_002210464.1|1879535_1880246_+	thiamine ABC transporter ATP-binding protein ThiQ	NA	G3M9Y6	Bacillus_virus	34.1	1.0e-20
WP_002210465.1|1880314_1881082_-	DedA family protein	NA	NA	NA	NA	NA
WP_002210466.1|1881277_1883647_+	DNA polymerase II	NA	A0A0P0YM26	Yellowstone_lake_phycodnavirus	25.5	1.5e-31
WP_011191719.1|1884091_1886998_+	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	37.1	6.8e-23
>prophage 145
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	1899060	1904101	4806594		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_011191715.1|1899060_1901409_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	32.9	2.1e-14
WP_024063110.1|1901512_1904101_-	type VI secretion system ATPase TssH	NA	A0A248SJW6	Salicola_phage	28.7	1.9e-77
>prophage 146
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	1923689	1924172	4806594		Bacillus_phage(100.0%)	1	NA	NA
WP_002210497.1|1923689_1924172_-	type 3 dihydrofolate reductase	NA	A0A219UQN5	Bacillus_phage	42.6	4.7e-30
>prophage 147
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	1929986	1931162	4806594		Halovirus(100.0%)	1	NA	NA
WP_002224759.1|1929986_1931162_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	34.3	6.9e-51
>prophage 148
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	1935268	1945481	4806594	tRNA	Bodo_saltans_virus(25.0%)	8	NA	NA
WP_038400423.1|1935268_1938085_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A2H4UVG0	Bodo_saltans_virus	26.1	1.0e-63
WP_012304604.1|1938116_1939055_-	bifunctional riboflavin kinase/FAD synthetase	NA	NA	NA	NA	NA
WP_157131898.1|1939188_1939353_-	DUF2575 family protein	NA	NA	NA	NA	NA
WP_002220715.1|1939469_1939733_+	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_038400424.1|1939863_1940763_-	transcriptional activator NhaR	NA	NA	NA	NA	NA
WP_011191700.1|1940892_1942077_-	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	51.2	1.0e-89
WP_002209249.1|1942319_1943459_-	molecular chaperone DnaJ	NA	A0A0P0YMJ9	Yellowstone_lake_phycodnavirus	32.7	3.6e-20
WP_002209248.1|1943570_1945481_-	molecular chaperone DnaK	NA	G8DDB7	Micromonas_pusilla_virus	49.2	9.9e-148
>prophage 149
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	1951669	1952623	4806594		Cyanophage(100.0%)	1	NA	NA
WP_002209241.1|1951669_1952623_-	transaldolase	NA	A0A127KNC6	Cyanophage	28.8	4.3e-11
>prophage 150
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	1964909	1977487	4806594		Bacillus_phage(33.33%)	8	NA	NA
WP_002209227.1|1964909_1966829_-	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	37.5	6.1e-12
WP_011191693.1|1967398_1970125_+	cation-transporting P-type ATPase	NA	M1IAU8	Acanthocystis_turfacea_Chlorella_virus	27.0	8.5e-68
WP_002209225.1|1970499_1971123_+	YfiR family protein	NA	NA	NA	NA	NA
WP_002209224.1|1971119_1972421_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	32.6	3.7e-13
WP_002215967.1|1972426_1972933_+	OmpA family protein	NA	NA	NA	NA	NA
WP_011191691.1|1973115_1974783_+	energy-dependent translational throttle protein EttA	NA	A0A2K9L3Z8	Tupanvirus	25.6	3.9e-39
WP_038401635.1|1974928_1976059_-	Fic family protein	NA	A0A1V0E025	Clostridioides_phage	30.9	1.4e-08
WP_002209221.1|1976215_1977487_-	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	46.3	2.4e-89
>prophage 151
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	1983373	1984696	4806594		Geobacillus_virus(100.0%)	1	NA	NA
WP_011191687.1|1983373_1984696_-	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	41.8	2.0e-78
>prophage 152
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	1990337	1993197	4806594		Salmonella_phage(50.0%)	3	NA	NA
WP_011191683.1|1990337_1990499_-	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	49.0	2.7e-06
WP_011191682.1|1990665_1991280_-	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_011191681.1|1991607_1993197_-	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	25.6	8.8e-33
>prophage 153
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	1996813	1997986	4806594		Bacillus_virus(100.0%)	1	NA	NA
WP_038400441.1|1996813_1997986_+	GGDEF domain-containing protein	NA	G3MA91	Bacillus_virus	32.2	1.6e-18
>prophage 154
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	2001104	2004191	4806594		Leptospira_phage(100.0%)	1	NA	NA
WP_011191676.1|2001104_2004191_-	efflux RND transporter permease subunit	NA	S5VL66	Leptospira_phage	19.0	7.0e-18
>prophage 155
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	2012259	2013843	4806594		Staphylococcus_phage(100.0%)	1	NA	NA
WP_038400448.1|2012259_2013843_+	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	33.2	6.7e-25
>prophage 156
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	2019115	2021692	4806594		Hokovirus(100.0%)	1	NA	NA
WP_038401639.1|2019115_2021692_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	27.3	1.4e-11
>prophage 157
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	2029141	2033018	4806594		Staphylococcus_phage(100.0%)	2	NA	NA
WP_038400451.1|2029141_2031733_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	40.3	3.6e-92
WP_032466092.1|2031734_2033018_+	restriction endonuclease subunit S	NA	A0A2H4PQP5	Staphylococcus_phage	25.0	3.2e-09
>prophage 158
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	2038839	2045149	4806594	terminase	Myoviridae_environmental_samples(50.0%)	5	NA	NA
WP_071840307.1|2038839_2039442_-|terminase	terminase small subunit	terminase	A0A2R3UAN5	Myoviridae_environmental_samples	49.2	1.4e-39
WP_012104463.1|2039494_2039968_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012104462.1|2039981_2040512_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038400460.1|2040520_2041894_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_038400462.1|2042440_2045149_-	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	53.7	6.5e-270
>prophage 159
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	2049693	2058787	4806594	integrase,tRNA	Enterobacteria_phage(33.33%)	6	2048351:2048364	2055245:2055258
2048351:2048364	attL	CCCGCGCGATTCAG	NA	NA	NA	NA
WP_038400480.1|2049693_2050962_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	36.4	1.3e-63
WP_002223173.1|2051315_2052392_-	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_002209311.1|2052391_2053486_-	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_002209310.1|2053765_2055277_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	37.7	5.4e-48
2055245:2055258	attR	CTGAATCGCGCGGG	NA	NA	NA	NA
WP_002209309.1|2055427_2055877_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_011191653.1|2055889_2058787_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	5.5e-142
>prophage 160
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	2066509	2071304	4806594		Bacillus_virus(25.0%)	4	NA	NA
WP_002209298.1|2066509_2067388_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	27.9	7.5e-10
WP_012105727.1|2067374_2068091_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.5	2.3e-20
WP_002209296.1|2068524_2070663_+	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	65.3	1.5e-269
WP_032466992.1|2070839_2071304_+	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	K4F9T1	Cronobacter_phage	58.5	4.6e-51
>prophage 161
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	2075497	2077397	4806594		Bacillus_virus(50.0%)	2	NA	NA
WP_002209288.1|2075497_2076289_+	phosphonate C-P lyase system protein PhnK	NA	G3M9Y6	Bacillus_virus	27.7	7.0e-15
WP_038401647.1|2076677_2077397_+	phosphonate C-P lyase system protein PhnL	NA	F2Y2R6	Organic_Lake_phycodnavirus	28.2	6.8e-09
>prophage 162
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	2082394	2083489	4806594		Bacillus_virus(100.0%)	1	NA	NA
WP_012105737.1|2082394_2083489_-	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G3M9Y6	Bacillus_virus	32.0	2.1e-25
>prophage 163
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	2090618	2090906	4806594		Diadromus_pulchellus_ascovirus(100.0%)	1	NA	NA
WP_038400498.1|2090618_2090906_+	GIY-YIG nuclease family protein	NA	F2NZ06	Diadromus_pulchellus_ascovirus	54.1	5.6e-15
>prophage 164
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	2102894	2104889	4806594		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_002209261.1|2102894_2104889_-	DEAD/DEAH family ATP-dependent RNA helicase	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	31.3	1.6e-52
>prophage 165
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	2110308	2112987	4806594		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_038400506.1|2110308_2112987_-	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	24.6	2.3e-25
>prophage 166
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	2117412	2120300	4806594	protease	Pandoravirus(50.0%)	2	NA	NA
WP_011191630.1|2117412_2118246_-	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	28.2	1.4e-18
WP_002228195.1|2118365_2120300_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	G8DDJ2	Micromonas_pusilla_virus	44.5	4.4e-119
>prophage 167
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	2123741	2143292	4806594	integrase,terminase	Bacillus_phage(20.0%)	24	2126734:2126751	2139494:2139511
WP_002210183.1|2123741_2124404_+	two-component system response regulator PmrA	NA	W8CYM9	Bacillus_phage	35.5	8.4e-30
WP_002210182.1|2124400_2125468_+	two-component system sensor histidine kinase PmrB	NA	W8CYF6	Bacillus_phage	21.9	4.7e-06
WP_002210181.1|2125562_2126735_-	Obg family GTPase CgtA	NA	NA	NA	NA	NA
2126734:2126751	attL	ATTTACTTTCTCCGTAAA	NA	NA	NA	NA
WP_038400512.1|2127275_2127647_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072092013.1|2127779_2127968_-	hypothetical protein	NA	A0A1W6JPH4	Morganella_phage	53.4	2.3e-09
WP_071840309.1|2128420_2129023_-|terminase	terminase small subunit	terminase	A0A2R3UAN5	Myoviridae_environmental_samples	49.7	1.4e-39
WP_038400516.1|2129294_2129783_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038400519.1|2129795_2130944_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_038400521.1|2131490_2134199_-	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	53.6	5.9e-271
WP_038400523.1|2134192_2134498_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038400524.1|2134500_2134671_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_038400527.1|2134651_2134846_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038401650.1|2134838_2135021_-	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_071840310.1|2135163_2135346_+	DUF3950 domain-containing protein	NA	NA	NA	NA	NA
WP_038400530.1|2135911_2136922_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038400532.1|2136936_2137218_-	AlpA family phage regulatory protein	NA	A0A2H4JB58	uncultured_Caudovirales_phage	41.5	4.2e-07
WP_049862783.1|2137330_2138116_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038400535.1|2138112_2139333_-|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	52.2	1.3e-121
WP_002210180.1|2139495_2140482_-	DMT family transporter	NA	NA	NA	NA	NA
2139494:2139511	attR	ATTTACTTTCTCCGTAAA	NA	NA	NA	NA
WP_002210179.1|2140569_2140827_-	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_002210178.1|2140846_2141158_-	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_011191628.1|2141417_2142389_+	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	27.6	7.8e-08
WP_002210176.1|2142485_2142833_-	putative DNA-binding transcriptional regulator	NA	A0A0M3LPN5	Mannheimia_phage	45.2	7.3e-09
WP_002210175.1|2143016_2143292_+	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	64.2	1.1e-18
>prophage 168
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	2148101	2149842	4806594		Klosneuvirus(50.0%)	2	NA	NA
WP_011191626.1|2148101_2149115_+	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	45.8	1.8e-71
WP_002210169.1|2149314_2149842_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	62.7	9.3e-56
>prophage 169
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	2172159	2177047	4806594		Lactococcus_phage(50.0%)	3	NA	NA
WP_038400547.1|2172159_2174694_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.3	2.5e-66
WP_002217229.1|2174934_2175360_-	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_002209157.1|2175748_2177047_-	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.4	1.3e-66
>prophage 170
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	2182770	2186607	4806594		Wolbachia_phage(50.0%)	2	NA	NA
WP_002209148.1|2182770_2184678_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.3	4.3e-58
WP_032466063.1|2184693_2186607_-	N-acetylmuramoyl-L-alanine amidase AmiB	NA	M1HNA7	Bacillus_virus	28.9	3.5e-28
>prophage 171
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	2191098	2191644	4806594		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_002209143.1|2191098_2191644_-	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.1	3.8e-28
>prophage 172
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	2199410	2201225	4806594		Lactobacillus_phage(100.0%)	1	NA	NA
WP_032466066.1|2199410_2201225_+	fumarate reductase (quinol) flavoprotein subunit	NA	A0A2P0ZL82	Lactobacillus_phage	27.6	1.0e-16
>prophage 173
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	2206584	2208571	4806594		Vibrio_phage(50.0%)	2	NA	NA
WP_002209128.1|2206584_2208231_-	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	66.9	1.6e-183
WP_002209127.1|2208277_2208571_-	co-chaperone GroES	NA	A0A221S322	uncultured_virus	36.8	3.3e-10
>prophage 174
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	2221527	2224935	4806594		Peridroma_alphabaculovirus(50.0%)	2	NA	NA
WP_038400565.1|2221527_2224083_-	enhancing factor	NA	A0A068LKB3	Peridroma_alphabaculovirus	23.2	3.1e-40
WP_002209112.1|2224509_2224935_+	subtilase	NA	A0A0U2KD34	Escherichia_phage	50.0	6.0e-29
>prophage 175
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	2234557	2243471	4806594		Klebsiella_phage(25.0%)	6	NA	NA
WP_002209100.1|2234557_2235106_-	single-stranded DNA-binding protein SSB1	NA	A0A291LCB6	Klebsiella_phage	90.1	1.1e-54
WP_038400569.1|2235687_2238531_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	55.5	1.2e-309
WP_002209098.1|2238623_2238983_-	MmcQ/YjbR family DNA-binding protein	NA	NA	NA	NA	NA
WP_038400571.1|2239509_2240703_-	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_012304687.1|2240888_2241968_-	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.7	4.9e-27
WP_002209095.1|2242064_2243471_-	replicative DNA helicase	NA	A0A1B0VG30	Salmonella_phage	75.4	2.8e-192
>prophage 176
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	2247832	2248441	4806594		Lactococcus_phage(100.0%)	1	NA	NA
WP_002209090.1|2247832_2248441_-	repressor LexA	NA	Q9G0C2	Lactococcus_phage	39.8	7.8e-14
>prophage 177
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	2268900	2277976	4806594	protease	Caulobacter_phage(33.33%)	10	NA	NA
WP_002209079.1|2268900_2269476_-	TerD family protein	NA	K4JRX3	Caulobacter_phage	40.0	1.6e-29
WP_002209078.1|2269659_2270238_-	TerD family protein	NA	K4JRX3	Caulobacter_phage	40.5	4.9e-34
WP_012304695.1|2270301_2271339_-	TerC/Alx family metal homeostasis membrane protein	NA	K7QKE8	Escherichia_phage	49.1	3.4e-78
WP_002209076.1|2271360_2271816_-	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_038400580.1|2271848_2273021_-	tellurium resistance protein TerA	NA	NA	NA	NA	NA
WP_011191586.1|2273020_2273614_-	tellurium resistance protein TerZ	NA	A0A2L1IWC0	Streptomyces_phage	34.5	9.3e-12
WP_011191585.1|2273889_2274951_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002209072.1|2274962_2276099_+	hypothetical protein	NA	A0A172Q0Y1	Acinetobacter_phage	28.3	4.8e-33
WP_002209071.1|2276091_2276904_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002209070.1|2276896_2277976_+|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	36.1	3.7e-43
>prophage 178
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	2289256	2290057	4806594		Pithovirus(100.0%)	1	NA	NA
WP_002209058.1|2289256_2290057_+	heme ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	27.5	1.9e-15
>prophage 179
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	2310712	2318484	4806594		Ectocarpus_siliculosus_virus(50.0%)	4	NA	NA
WP_032466017.1|2310712_2313532_+	two component system sensor kinase	NA	Q8QKV7	Ectocarpus_siliculosus_virus	28.4	1.3e-34
WP_012105859.1|2313544_2314177_+	two component system response regulator	NA	NA	NA	NA	NA
WP_011191564.1|2314354_2315671_-	glutamate/aspartate:proton symporter GltP	NA	NA	NA	NA	NA
WP_038400597.1|2316525_2318484_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	37.8	1.3e-86
>prophage 180
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	2322129	2323229	4806594	transposase	Leptospira_phage(100.0%)	1	NA	NA
WP_115027039.1|2322129_2323229_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.3	4.3e-47
>prophage 181
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	2329576	2333657	4806594		Prochlorococcus_phage(50.0%)	4	NA	NA
WP_011191559.1|2329576_2331166_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	50.0	5.3e-70
WP_011191558.1|2331225_2332512_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_012303442.1|2332678_2333332_-	DUF1481 domain-containing protein	NA	NA	NA	NA	NA
WP_002210689.1|2333381_2333657_-	DNA-binding protein HU-alpha	NA	A7KV42	Bacillus_phage	55.6	3.6e-19
>prophage 182
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	2341774	2361441	4806594		Catovirus(16.67%)	15	NA	NA
WP_032466797.1|2341774_2342572_+	HesA/MoeB/ThiF family protein	NA	A0A1V0SAV8	Catovirus	27.8	1.6e-11
WP_002217275.1|2342568_2342784_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_002228257.1|2342785_2343601_+	thiazole synthase	NA	NA	NA	NA	NA
WP_002210678.1|2343593_2344724_+	2-iminoacetate synthase ThiH	NA	NA	NA	NA	NA
WP_002210677.1|2345030_2349251_-	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	27.0	8.5e-67
WP_038400607.1|2349379_2353408_-	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	29.0	1.2e-22
WP_002210675.1|2353750_2354119_-	50S ribosomal protein L7/L12	NA	NA	NA	NA	NA
WP_038400609.1|2354185_2354683_-	50S ribosomal protein L10	NA	NA	NA	NA	NA
WP_002210673.1|2355047_2355752_-	50S ribosomal protein L1	NA	NA	NA	NA	NA
WP_002210672.1|2355755_2356184_-	50S ribosomal protein L11	NA	NA	NA	NA	NA
WP_002210671.1|2356374_2356920_-	transcription termination/antitermination protein NusG	NA	A0A291AUS6	Sinorhizobium_phage	28.3	5.9e-13
WP_002210670.1|2356921_2357305_-	preprotein translocase subunit SecE	NA	NA	NA	NA	NA
WP_002210669.1|2357555_2358740_-	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.9	2.0e-13
WP_011191551.1|2359728_2360280_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002212290.1|2360490_2361441_+	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	31.2	8.7e-28
>prophage 183
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	2371653	2372265	4806594		Streptococcus_phage(100.0%)	1	NA	NA
WP_002231137.1|2371653_2372265_-	IMPACT family protein	NA	A0A1X9I5T8	Streptococcus_phage	44.4	1.7e-24
>prophage 184
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	2382419	2388958	4806594		uncultured_Mediterranean_phage(33.33%)	7	NA	NA
WP_011191543.1|2382419_2383196_-	Sec-independent protein translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	33.3	4.2e-28
WP_002211537.1|2383198_2383861_-	Sec-independent protein translocase subunit TatB	NA	NA	NA	NA	NA
WP_002211536.1|2383864_2384131_-	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_002211535.1|2384310_2385942_-	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	M4R0M8	Ostreococcus_lucimarinus_virus	29.1	5.3e-41
WP_038400618.1|2385941_2386592_-	SCP2 domain-containing protein	NA	NA	NA	NA	NA
WP_002224024.1|2386605_2387361_-	bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE	NA	NA	NA	NA	NA
WP_033852389.1|2387452_2388958_-	DNA recombination protein RmuC	NA	R9RFD7	Alteromonas_phage	61.8	1.4e-08
>prophage 185
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	2400896	2401646	4806594		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_038400628.1|2400896_2401646_-	glycerophosphodiester phosphodiesterase	NA	M1HTS7	Paramecium_bursaria_Chlorella_virus	26.5	8.1e-13
>prophage 186
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	2413599	2415113	4806594		Anomala_cuprea_entomopoxvirus(50.0%)	2	NA	NA
WP_038400638.1|2413599_2414301_-	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivF	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.1	2.1e-10
WP_002211511.1|2414345_2415113_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	23.9	8.3e-13
>prophage 187
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	2419636	2422416	4806594		Salicola_phage(50.0%)	3	NA	NA
WP_002211506.1|2419636_2420494_-	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	40.0	4.6e-44
WP_032466010.1|2420804_2421758_-	cell division protein FtsX	NA	NA	NA	NA	NA
WP_004391337.1|2421747_2422416_-	cell division ATP-binding protein FtsE	NA	A0A2H4PQG7	Staphylococcus_phage	27.6	9.5e-13
>prophage 188
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	2426706	2431369	4806594		Dickeya_phage(50.0%)	4	NA	NA
WP_002211498.1|2426706_2427333_+	lysoplasmalogenase	NA	A0A140XAH6	Dickeya_phage	63.7	1.2e-30
WP_038400647.1|2427746_2430095_+	zinc/cadmium/mercury/lead-transporting ATPase	NA	E4ZFI9	Streptococcus_phage	37.0	3.2e-116
WP_002215973.1|2430162_2430417_-	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	91.7	2.0e-11
WP_011191518.1|2430700_2431369_+	7-cyano-7-deazaguanine/7-aminomethyl-7- deazaguanine transporter	NA	A0A2I7SAW6	Vibrio_phage	56.4	6.3e-57
>prophage 189
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	2437005	2438121	4806594		Staphylococcus_phage(100.0%)	1	NA	NA
WP_002211490.1|2437005_2438121_+	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	50.9	4.8e-09
>prophage 190
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	2443102	2444935	4806594		Catovirus(100.0%)	1	NA	NA
WP_002211484.1|2443102_2444935_-	ATP-dependent DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	36.8	2.4e-82
>prophage 191
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	2452615	2456504	4806594		Bacillus_phage(50.0%)	3	NA	NA
WP_002211475.1|2452615_2454778_-	DNA helicase II	NA	A7KV33	Bacillus_phage	37.1	9.3e-118
WP_011191513.1|2454876_2455593_-	5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB	NA	NA	NA	NA	NA
WP_002211473.1|2455592_2456504_-	tyrosine recombinase XerC	NA	A0A1B1IQT7	uncultured_Mediterranean_phage	31.2	4.6e-18
>prophage 192
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	2475718	2482195	4806594		Enterobacteria_phage(40.0%)	6	NA	NA
WP_038400670.1|2475718_2476849_-	dTDP-4-amino-4,6-dideoxygalactose transaminase	NA	A0A0F7LAY0	uncultured_marine_virus	35.5	7.9e-20
WP_012304738.1|2476850_2477588_-	dTDP-4-amino-4,6-dideoxy-D-galactose acyltransferase	NA	NA	NA	NA	NA
WP_002211983.1|2477565_2478447_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.6	1.3e-105
WP_011191500.1|2478741_2479809_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.6	1.2e-99
WP_002211985.1|2479805_2481068_-	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1HPJ2	Paramecium_bursaria_Chlorella_virus	26.3	4.7e-21
WP_011191498.1|2481064_2482195_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SJE0	Klosneuvirus	28.4	5.9e-31
>prophage 193
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	2487012	2492433	4806594		Indivirus(33.33%)	4	NA	NA
WP_002211990.1|2487012_2487339_-	thioredoxin TrxA	NA	A0A1V0SD63	Indivirus	42.1	1.9e-14
WP_038400673.1|2487457_2488744_+	ATP-dependent RNA helicase RhlB	NA	E3T5E1	Cafeteria_roenbergensis_virus	29.6	9.3e-33
WP_032466602.1|2488750_2490244_+	exopolyphosphatase	NA	NA	NA	NA	NA
WP_002211993.1|2490411_2492433_-	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.0	3.8e-113
>prophage 194
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	2514783	2516430	4806594		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_002212017.1|2514783_2516430_-	acetolactate synthase 2 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.7	3.1e-65
>prophage 195
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	2522304	2523795	4806594		Staphylococcus_phage(100.0%)	1	NA	NA
WP_011191480.1|2522304_2523795_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	23.7	1.2e-10
>prophage 196
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	2532563	2534438	4806594		Acinetobacter_phage(100.0%)	1	NA	NA
WP_038401674.1|2532563_2534438_-	TonB-dependent vitamin B12 receptor BtuB	NA	A0A0P0I887	Acinetobacter_phage	29.3	2.2e-14
>prophage 197
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	2539874	2540606	4806594		Synechococcus_phage(100.0%)	1	NA	NA
WP_002209479.1|2539874_2540606_+	glutathione peroxidase	NA	A0A1D8KSL1	Synechococcus_phage	58.5	1.3e-47
>prophage 198
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	2544551	2546360	4806594		Bacillus_phage(100.0%)	1	NA	NA
WP_038400683.1|2544551_2546360_-	type I secretion system permease/ATPase	NA	W8CYL7	Bacillus_phage	31.2	3.5e-25
>prophage 199
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	2571590	2572922	4806594		Erwinia_phage(100.0%)	1	NA	NA
WP_002208943.1|2571590_2572922_+	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.8	1.2e-43
>prophage 200
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	2577751	2581988	4806594		Indivirus(50.0%)	3	NA	NA
WP_011191463.1|2577751_2579866_+	peptidase domain-containing ABC transporter	NA	A0A1V0SE00	Indivirus	31.8	7.4e-19
WP_002208953.1|2580192_2580432_-	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_002208954.1|2581139_2581988_+	aquaporin family protein	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	27.5	3.2e-13
>prophage 201
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	2597920	2602291	4806594	transposase	Sodalis_phage(33.33%)	5	NA	NA
WP_002353252.1|2597920_2598841_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	54.3	8.6e-73
WP_002221684.1|2598924_2599101_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002208969.1|2599557_2600046_-	periplasmic heavy metal sensor	NA	NA	NA	NA	NA
WP_002208970.1|2600219_2600918_+	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	29.5	1.8e-06
WP_002208971.1|2600914_2602291_+	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.4	1.5e-17
>prophage 202
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	2606873	2615595	4806594		Rhizobium_phage(20.0%)	8	NA	NA
WP_002208977.1|2606873_2607122_-	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	50.0	5.4e-14
WP_002208978.1|2607240_2607675_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_002208979.1|2608071_2609619_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_002208980.1|2609628_2610999_+	murein hydrolase activator EnvC	NA	G9BW84	Planktothrix_phage	35.7	2.4e-10
WP_011191452.1|2611022_2612033_+	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_011191451.1|2612170_2613196_-	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	80.8	8.0e-19
WP_002208982.1|2613205_2614417_-	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	27.6	4.6e-34
WP_002208983.1|2614662_2615595_+	ADP-glyceromanno-heptose 6-epimerase	NA	E3SL51	Synechococcus_phage	36.6	1.3e-31
>prophage 203
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	2620131	2624702	4806594		uncultured_Mediterranean_phage(25.0%)	7	NA	NA
WP_012104267.1|2620131_2620611_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	46.3	4.7e-30
WP_002208989.1|2620616_2621426_-	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	A0A127AWE5	Bacillus_phage	32.7	6.7e-21
WP_002208990.1|2621508_2621676_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_002208991.1|2621687_2621924_-	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_002208992.1|2622186_2622855_-	JAB domain-containing protein	NA	NA	NA	NA	NA
WP_002208993.1|2623048_2624266_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	34.8	9.1e-46
WP_011566231.1|2624243_2624702_+	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	61.5	6.0e-51
>prophage 204
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	2629112	2634298	4806594		Vibrio_phage(33.33%)	4	NA	NA
WP_002215674.1|2629112_2630816_-	NAD-dependent DNA ligase LigB	NA	A0A1Q2U2Q6	Vibrio_phage	23.9	1.2e-19
WP_002209000.1|2631216_2631840_+	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	35.7	2.4e-18
WP_004392061.1|2631894_2632170_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_038400694.1|2632189_2634298_+	bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase	NA	A0A291L9W9	Bordetella_phage	34.5	3.7e-10
>prophage 205
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	2638907	2640293	4806594		environmental_Halophage(100.0%)	1	NA	NA
WP_011191446.1|2638907_2640293_+	uracil-xanthine permease	NA	H9YQ34	environmental_Halophage	80.7	4.5e-57
>prophage 206
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	2645730	2652247	4806594		Erysipelothrix_phage(33.33%)	4	NA	NA
WP_002217380.1|2645730_2647554_-	ribosome-dependent GTPase TypA	NA	A0A2K5B2A5	Erysipelothrix_phage	42.3	1.2e-20
WP_002213150.1|2648115_2649525_+	glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_038400696.1|2649777_2650827_+	nitrogen regulation protein NR(II)	NA	Q8QKV7	Ectocarpus_siliculosus_virus	25.2	4.2e-07
WP_011191444.1|2650834_2652247_+	nitrogen regulation protein NR(I)	NA	Q56AR1	Bacillus_thuringiensis_phage	25.6	3.1e-05
>prophage 207
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	2656224	2659023	4806594		uncultured_virus(100.0%)	1	NA	NA
WP_038400697.1|2656224_2659023_-	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	32.8	1.2e-69
>prophage 208
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	2662839	2664048	4806594	transposase	uncultured_virus(100.0%)	1	NA	NA
WP_012304013.1|2662839_2664048_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
>prophage 209
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	2674260	2680487	4806594		Paramecium_bursaria_Chlorella_virus(33.33%)	4	NA	NA
WP_011191440.1|2674260_2676129_-	low affinity potassium transporter Kup	NA	A7J6G4	Paramecium_bursaria_Chlorella_virus	30.3	5.8e-68
WP_038400701.1|2676402_2677926_+	ATPase RavA	NA	A0A0N9NIH9	Sulfolobus_monocaudavirus	32.4	1.5e-18
WP_038400703.1|2677929_2679396_+	ATPase RavA stimulator ViaA	NA	NA	NA	NA	NA
WP_002212256.1|2679494_2680487_-	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	36.0	2.2e-50
>prophage 210
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	2693053	2707960	4806594		Tupanvirus(16.67%)	14	NA	NA
WP_038400706.1|2693053_2694424_+	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A2K9L821	Tupanvirus	33.5	7.9e-30
WP_002215552.1|2694624_2696454_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	M1H1Z3	Paramecium_bursaria_Chlorella_virus	43.0	1.9e-132
WP_002215557.1|2696936_2697977_+	phosphate ABC transporter substrate-binding protein PstS	NA	M4QHS4	Cyanophage	38.2	5.7e-49
WP_002215558.1|2698205_2699162_+	phosphate ABC transporter permease PstC	NA	NA	NA	NA	NA
WP_012105988.1|2699163_2700051_+	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_002215562.1|2700131_2700908_+	phosphate ABC transporter ATP-binding protein PstB	NA	W8CYL7	Bacillus_phage	31.2	3.8e-13
WP_002220747.1|2700995_2701718_+	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_002228151.1|2702013_2702685_+	polymer-forming cytoskeletal protein	NA	NA	NA	NA	NA
WP_002215568.1|2702904_2703759_+	ABC transporter substrate-binding protein	NA	A0A140XBD5	Dickeya_phage	81.6	1.9e-10
WP_002215571.1|2703941_2704679_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_012105985.1|2704680_2705436_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_011193354.1|2705470_2706139_-	6-phosphogluconate phosphatase	NA	NA	NA	NA	NA
WP_071820238.1|2706213_2706312_-	gluconate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_002215577.1|2706631_2707960_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	37.1	4.7e-64
>prophage 211
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	2717339	2722132	4806594		Rhizobium_phage(50.0%)	3	NA	NA
WP_038400713.1|2717339_2718440_+	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	36.8	4.8e-54
WP_002209643.1|2718612_2719698_+	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_002209642.1|2719717_2722132_+	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	34.0	2.4e-114
>prophage 212
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	2727194	2728353	4806594		Cyanophage(50.0%)	2	NA	NA
WP_002209636.1|2727194_2727608_+	heat shock chaperone IbpA	NA	A0A127KM93	Cyanophage	36.8	7.1e-19
WP_002209635.1|2727888_2728353_+	heat shock chaperone IbpB	NA	A0A0E3FB97	Synechococcus_phage	32.2	3.3e-12
>prophage 213
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	2736597	2740380	4806594		Only_Syngen_Nebraska_virus(50.0%)	4	NA	NA
WP_012303319.1|2736597_2737578_-	glyoxylate/hydroxypyruvate reductase GhrB	NA	A0A1J0F959	Only_Syngen_Nebraska_virus	28.9	2.7e-24
WP_002209629.1|2738132_2738777_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_038400720.1|2738907_2739567_-	OmpA family lipoprotein	NA	NA	NA	NA	NA
WP_033851021.1|2739924_2740380_-	N-acetyltransferase	NA	A0A1X9I6I8	Streptococcus_phage	32.2	8.1e-16
>prophage 214
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	2754711	2755335	4806594		Bacillus_thuringiensis_phage(100.0%)	1	NA	NA
WP_002209614.1|2754711_2755335_-	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	57.4	2.4e-63
>prophage 215
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	2763990	2765964	4806594		Tupanvirus(100.0%)	1	NA	NA
WP_038400722.1|2763990_2765964_+	selenocysteine-specific translation elongation factor	NA	A0A2K9KZ60	Tupanvirus	25.1	3.1e-11
>prophage 216
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	2781889	2795397	4806594	integrase	Enterobacteria_phage(28.57%)	14	2775213:2775228	2803946:2803961
2775213:2775228	attL	GCCTGACGTATTTGGC	NA	NA	NA	NA
WP_002209590.1|2781889_2783422_+	xylose ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.4	8.5e-17
WP_038400725.1|2783408_2784593_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_002209588.1|2784682_2785876_+	DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_038400727.1|2786261_2787455_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	80.8	2.8e-185
WP_002209586.1|2787441_2788821_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038400729.1|2789089_2789335_-	transcriptional regulator	NA	Q7M294	Enterobacteria_phage	51.3	1.0e-12
WP_002209585.1|2790479_2790842_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_038400732.1|2790904_2791165_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A1S5NR91	Burkholderia_phage	36.0	5.7e-06
WP_072085081.1|2791595_2791769_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_002214362.1|2791765_2791951_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038400734.1|2792188_2792689_+	virulence RhuM family protein	NA	Q9JMN3	Wolbachia_phage	49.4	1.6e-36
WP_002209584.1|2792685_2793444_-	ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	28.6	1.2e-16
WP_002209583.1|2793440_2794448_-	iron chelate uptake ABC transporter family permease subunit	NA	NA	NA	NA	NA
WP_011193295.1|2794437_2795397_-	ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	39.3	4.6e-61
2803946:2803961	attR	GCCAAATACGTCAGGC	NA	NA	NA	NA
>prophage 217
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	2803062	2804595	4806594		Catovirus(100.0%)	1	NA	NA
WP_002209575.1|2803062_2804595_+	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	39.1	1.1e-83
>prophage 218
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	2814721	2816113	4806594		Moraxella_phage(100.0%)	1	NA	NA
WP_038400739.1|2814721_2816113_+	filamentous hemagglutinin N-terminal domain-containing protein	NA	A0A0R6PJK4	Moraxella_phage	28.7	1.1e-23
>prophage 219
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	2822489	2824543	4806594		Planktothrix_phage(50.0%)	2	NA	NA
WP_002209562.1|2822489_2823470_+	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.9	3.0e-15
WP_161597821.1|2823502_2824543_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.2	5.2e-18
>prophage 220
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	2848870	2850007	4806594		Streptococcus_phage(100.0%)	1	NA	NA
WP_012303361.1|2848870_2850007_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	37.7	1.1e-42
>prophage 221
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	2869080	2870604	4806594		Pithovirus(100.0%)	1	NA	NA
WP_011193264.1|2869080_2870604_+	sugar ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	22.4	1.1e-08
>prophage 222
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	2904898	2906596	4806594		Enterobacteria_phage(100.0%)	1	NA	NA
WP_038400757.1|2904898_2906596_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	67.9	3.0e-204
>prophage 223
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	2914428	2916876	4806594		Dickeya_phage(100.0%)	1	NA	NA
WP_011193248.1|2914428_2916876_+	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	84.5	1.2e-33
>prophage 224
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	2926394	2928800	4806594		Iris_mild_mosaic_virus(100.0%)	1	NA	NA
WP_012105894.1|2926394_2928800_+	maltodextrin phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	39.1	4.0e-13
>prophage 225
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	2940880	2944887	4806594		Bacillus_phage(66.67%)	3	NA	NA
WP_002208914.1|2940880_2941600_+	two-component system response regulator OmpR	NA	W8CYM9	Bacillus_phage	34.7	2.7e-29
WP_002208913.1|2941596_2942949_+	two-component system sensor histidine kinase EnvZ	NA	W8CYF6	Bacillus_phage	24.1	1.6e-11
WP_011193240.1|2943267_2944887_-	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	52.0	1.6e-138
>prophage 226
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	2955996	2957514	4806594		Vibrio_phage(100.0%)	1	NA	NA
WP_162472799.1|2955996_2957514_+	DNA uptake porin HofQ	NA	R9TEZ5	Vibrio_phage	22.3	1.3e-14
>prophage 227
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	2960855	2961671	4806594		Vibrio_phage(100.0%)	1	NA	NA
WP_002208895.1|2960855_2961671_+	adenine-specific DNA-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	49.5	9.0e-66
>prophage 228
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	2978428	2985378	4806594		Catovirus(25.0%)	4	NA	NA
WP_002208878.1|2978428_2978998_+	peptidylprolyl isomerase A	NA	A0A1V0S9I2	Catovirus	32.3	1.7e-07
WP_011193225.1|2981106_2981682_+	aminodeoxychorismate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	62.1	3.0e-68
WP_002212295.1|2981814_2983032_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	27.2	4.5e-29
WP_011193223.1|2983257_2985378_-	membrane protein	NA	H9YQA8	environmental_Halophage	62.3	1.1e-43
>prophage 229
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	2991727	2998324	4806594		Bacillus_virus(33.33%)	5	NA	NA
WP_002212307.1|2991727_2992495_+	taurine ABC transporter ATP-binding subunit	NA	G3M9Y6	Bacillus_virus	35.6	1.6e-35
WP_032466807.1|2992491_2993346_+	taurine ABC transporter permease TauC	NA	NA	NA	NA	NA
WP_002212310.1|2993342_2994191_+	taurine dioxygenase	NA	NA	NA	NA	NA
WP_038400766.1|2995277_2996267_-	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	30.6	6.1e-08
WP_002230378.1|2996401_2998324_-	ABC transporter ATP-binding protein	NA	A0A2K9L0W2	Tupanvirus	32.1	1.6e-73
>prophage 230
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	3006597	3009962	4806594		Streptococcus_phage(50.0%)	2	NA	NA
WP_002212325.1|3006597_3008706_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.7	1.0e-60
WP_038400768.1|3008777_3009962_+	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.5	2.0e-13
>prophage 231
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	3029576	3033916	4806594	tRNA	Synechococcus_phage(50.0%)	5	NA	NA
WP_002209020.1|3029576_3030524_-|tRNA	methionyl-tRNA formyltransferase	tRNA	M4QRX9	Synechococcus_phage	29.8	1.2e-05
WP_002209021.1|3030548_3031061_-	peptide deformylase	NA	NA	NA	NA	NA
WP_002209023.1|3032288_3032762_+	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_012105865.1|3032802_3033342_+	DNA topoisomerase	NA	NA	NA	NA	NA
WP_002209025.1|3033343_3033916_+	L-threonylcarbamoyladenylate synthase type 1 TsaC	NA	A0A291ATS8	Pandoravirus	30.2	4.9e-10
>prophage 232
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	3050800	3054496	4806594		Dickeya_phage(100.0%)	1	NA	NA
WP_038400771.1|3050800_3054496_+	methionine synthase	NA	A0A140XBC7	Dickeya_phage	82.5	4.6e-24
>prophage 233
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	3068447	3069557	4806594		Planktothrix_phage(100.0%)	1	NA	NA
WP_002212091.1|3068447_3069557_+	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	G9BWD6	Planktothrix_phage	35.5	5.0e-27
>prophage 234
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	3083473	3086077	4806594		Agrobacterium_phage(100.0%)	1	NA	NA
WP_038400773.1|3083473_3086077_+	type VI secretion system ATPase TssH	NA	A0A223W0B1	Agrobacterium_phage	31.5	6.4e-89
>prophage 235
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	3093972	3115593	4806594		uncultured_Caudovirales_phage(50.0%)	15	NA	NA
WP_038400775.1|3093972_3096192_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	27.7	2.0e-27
WP_002213383.1|3096197_3096656_+	DcrB-related protein	NA	NA	NA	NA	NA
WP_038400776.1|3096648_3100917_+	hypothetical protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	37.6	2.2e-30
WP_048901874.1|3100894_3101545_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011193193.1|3101604_3101958_-	type I addiction module toxin, SymE family	NA	NA	NA	NA	NA
WP_038400777.1|3101954_3102179_-	type I toxin-antitoxin system SymE family toxin	NA	NA	NA	NA	NA
WP_002210018.1|3102260_3102668_-	helix-turn-helix transcriptional regulator	NA	S5MUA5	Brevibacillus_phage	32.2	3.1e-06
WP_038400778.1|3103028_3105251_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	27.7	2.0e-27
WP_002213383.1|3105256_3105715_+	DcrB-related protein	NA	NA	NA	NA	NA
WP_080725848.1|3105707_3109880_+	type IV secretion protein Rhs	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	51.4	2.4e-29
WP_012303459.1|3109882_3110302_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012303460.1|3110585_3110831_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038401712.1|3110830_3111319_+	phosphotriesterase	NA	NA	NA	NA	NA
WP_012303462.1|3111364_3111727_-	type I toxin-antitoxin system SymE family toxin	NA	NA	NA	NA	NA
WP_080725849.1|3112086_3115593_+	hypothetical protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	37.4	1.9e-27
>prophage 236
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	3126201	3129648	4806594		Bacillus_virus(50.0%)	3	NA	NA
WP_011193182.1|3126201_3127017_+	aliphatic sulfonates ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.1	1.5e-28
WP_012104378.1|3127635_3127893_-	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
WP_002210039.1|3128292_3129648_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	74.0	4.1e-164
>prophage 237
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	3133203	3137619	4806594		Morganella_phage(50.0%)	3	NA	NA
WP_002210042.1|3133203_3134124_-	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	53.5	6.8e-78
WP_012104382.1|3134929_3135919_+	autoinducer 2 ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002210044.1|3136122_3137619_+	sugar ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	26.7	1.1e-13
>prophage 238
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	3146026	3147183	4806594		Morganella_phage(100.0%)	3	NA	NA
WP_038400785.1|3146026_3146239_-	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	80.0	2.6e-25
WP_011193172.1|3146498_3146711_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	78.6	1.7e-24
WP_011193172.1|3146970_3147183_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	78.6	1.7e-24
>prophage 239
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	3151153	3152518	4806594		Burkholderia_virus(100.0%)	1	NA	NA
WP_032466779.1|3151153_3152518_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	25.8	7.9e-14
>prophage 240
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	3168865	3169909	4806594		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_002228205.1|3168865_3169909_+	rod shape-determining protein MreB	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.0e-06
>prophage 241
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	3186473	3186875	4806594		Proteus_phage(100.0%)	1	NA	NA
WP_012303481.1|3186473_3186875_-	M15 family metallopeptidase	NA	A0A249XWK9	Proteus_phage	61.0	3.6e-36
>prophage 242
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	3208796	3209441	4806594		Salmonella_phage(100.0%)	1	NA	NA
WP_011055205.1|3208796_3209441_+	hypothetical protein	NA	A0A1B0VBK8	Salmonella_phage	49.0	3.4e-52
>prophage 243
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	3217613	3228472	4806594		Paramecium_bursaria_Chlorella_virus(16.67%)	13	NA	NA
WP_012104413.1|3217613_3218549_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	38.9	3.9e-49
WP_002210112.1|3218886_3219159_-	PTS phosphocarrier protein NPr	NA	NA	NA	NA	NA
WP_002210113.1|3219155_3220010_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	30.0	3.2e-05
WP_002213952.1|3220278_3220761_-	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_004392031.1|3220878_3221166_-	ribosome hibernation promoting factor	NA	NA	NA	NA	NA
WP_002210115.1|3221189_3222623_-	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_002210116.1|3222684_3223410_-	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	1.4e-22
WP_002210117.1|3223416_3223962_-	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_011193147.1|3223945_3224509_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_002228203.1|3224505_3225069_-	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	83.0	9.6e-59
WP_002210119.1|3225317_3226304_-	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	30.8	6.0e-40
WP_002210120.1|3226414_3227389_-	calcium/sodium antiporter	NA	NA	NA	NA	NA
WP_002210121.1|3227653_3228472_+	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	31.7	2.2e-19
>prophage 244
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	3233005	3235557	4806594	protease	uncultured_Mediterranean_phage(100.0%)	2	NA	NA
WP_002210128.1|3233005_3234094_-	outer membrane-stress sensor serine endopeptidase DegS	NA	A0A1B1IRD3	uncultured_Mediterranean_phage	31.8	2.1e-09
WP_002218066.1|3234183_3235557_-|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.2	7.4e-20
>prophage 245
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	3239752	3240268	4806594	protease	Pseudomonas_phage(100.0%)	1	NA	NA
WP_012104417.1|3239752_3240268_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	55.6	3.6e-28
>prophage 246
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	3249420	3258415	4806594		Hokovirus(33.33%)	8	NA	NA
WP_002210142.1|3249420_3251757_+	aerobic respiration two-component sensor histidine kinase ArcB	NA	A0A1V0SGX0	Hokovirus	30.4	9.9e-41
WP_012104420.1|3251998_3252652_+	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_002210144.1|3252648_3253374_+	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
WP_011193140.1|3253580_3254156_-	divisome-associated lipoprotein YraP	NA	NA	NA	NA	NA
WP_011193139.1|3254166_3254757_-	DnaA initiator-associating protein DiaA	NA	A0A067XQR2	Caulobacter_phage	32.0	2.4e-12
WP_002210147.1|3255027_3255381_-	YraN family protein	NA	NA	NA	NA	NA
WP_012303495.1|3255479_3257453_-	penicillin-binding protein activator	NA	NA	NA	NA	NA
WP_002210149.1|3257515_3258415_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	44.4	1.0e-49
>prophage 247
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	3321906	3323022	4806594		Planktothrix_phage(100.0%)	1	NA	NA
WP_038400813.1|3321906_3323022_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.2	8.9e-24
>prophage 248
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	3326566	3327553	4806594		Enterobacteria_phage(100.0%)	1	NA	NA
WP_011193115.1|3326566_3327553_+	LacI family transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	30.0	2.3e-23
>prophage 249
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	3352333	3361777	4806594	tRNA	Vibrio_phage(25.0%)	8	NA	NA
WP_002210359.1|3352333_3354172_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.3	1.9e-34
WP_002210358.1|3354329_3356078_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.2	8.7e-74
WP_001144069.1|3356213_3356429_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_002212201.1|3356834_3357848_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	57.7	6.5e-106
WP_002217581.1|3358093_3358744_-	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_002212199.1|3358851_3359211_+	bifunctional dihydroneopterin aldolase/7,8-dihydroneopterin epimerase	NA	NA	NA	NA	NA
WP_038400825.1|3359484_3360303_+	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_011193101.1|3360538_3361777_-	multifunctional CCA addition/repair protein	NA	A0A076G5T8	Escherichia_phage	43.1	4.7e-82
>prophage 250
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	3367347	3375395	4806594		uncultured_Mediterranean_phage(25.0%)	7	NA	NA
WP_038400827.1|3367347_3368778_+	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	29.9	4.1e-37
WP_038400829.1|3368814_3370065_+	L-methionine/branched-chain amino acid transporter	NA	NA	NA	NA	NA
WP_002212191.1|3370389_3370671_-	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_002212190.1|3371240_3371894_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	45.1	1.1e-42
WP_002212189.1|3372352_3373135_+	4,5-DOPA dioxygenase extradiol	NA	NA	NA	NA	NA
WP_012104467.1|3373541_3374702_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	45.2	2.2e-89
WP_002357252.1|3374711_3375395_-	DUF1190 family protein	NA	A0A173GEW8	Erwinia_phage	45.6	2.2e-41
>prophage 251
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	3380171	3386201	4806594		Bacillus_virus(100.0%)	5	NA	NA
WP_002212181.1|3380171_3382067_+	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	35.5	2.9e-91
WP_038400832.1|3382070_3382982_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002212179.1|3383039_3383624_-	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_002216196.1|3383696_3383945_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002212178.1|3383927_3386201_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	35.4	5.4e-84
>prophage 252
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	3390510	3393693	4806594		Pseudomonas_phage(50.0%)	2	NA	NA
WP_038400837.1|3390510_3392838_+	YgiQ family radical SAM protein	NA	M1QSD9	Pseudomonas_phage	69.9	1.3e-101
WP_011193092.1|3392859_3393693_-	2,5-didehydrogluconate reductase DkgA	NA	A0A2H4PQR8	Staphylococcus_phage	43.5	2.8e-62
>prophage 253
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	3413187	3413487	4806594	integrase,transposase	Escherichia_phage(100.0%)	1	3413135:3413152	3419179:3419196
3413135:3413152	attL	TGGCACTGTTGCAAATAG	NA	NA	NA	NA
WP_080725854.1|3413187_3413487_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A077SL39	Escherichia_phage	69.6	2.7e-28
WP_080725854.1|3413187_3413487_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A077SL39	Escherichia_phage	69.6	2.7e-28
3419179:3419196	attR	CTATTTGCAACAGTGCCA	NA	NA	NA	NA
>prophage 254
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	3418799	3420775	4806594	integrase,transposase	Escherichia_phage(50.0%)	2	3413135:3413152	3419179:3419196
3413135:3413152	attL	TGGCACTGTTGCAAATAG	NA	NA	NA	NA
WP_080725855.1|3418799_3419096_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A077SL39	Escherichia_phage	73.4	2.4e-24
WP_038400851.1|3419362_3420775_-	hypothetical protein	NA	A0A0K1Y848	Apis_mellifera_filamentous_virus	27.6	6.9e-05
3419179:3419196	attR	CTATTTGCAACAGTGCCA	NA	NA	NA	NA
>prophage 255
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	3478429	3588884	4806594	integrase,transposase,protease	Escherichia_phage(33.33%)	58	3489738:3489797	3498004:3498823
WP_038400878.1|3478429_3489559_+	autotransporter adhesin YapH	NA	A0A2L1IV18	Escherichia_phage	37.8	4.3e-134
3489738:3489797	attL	GGGCACTGTTGCAAATAGCTGCTTAGGGTAAACTTTCCTCCAATTTAAAGATCTTAGAGG	NA	NA	NA	NA
WP_038400879.1|3489790_3490495_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	80.8	1.1e-112
WP_038401742.1|3490906_3491326_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	F1C5A6	Cronobacter_phage	52.4	2.0e-29
WP_038400880.1|3491333_3492593_+	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	55.8	1.6e-138
WP_038400881.1|3492622_3492943_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038400883.1|3492939_3493380_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038400885.1|3493380_3494529_-	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_038400887.1|3494530_3495403_-	ParA family protein	NA	NA	NA	NA	NA
WP_038277238.1|3495443_3495782_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038400888.1|3495887_3496961_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038400890.1|3497203_3497974_-|integrase	tyrosine-type recombinase/integrase	integrase	I3WFA4	Macacine_betaherpesvirus	52.0	6.8e-23
WP_038400879.1|3498056_3498761_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	80.8	1.1e-112
WP_049862788.1|3499313_3502514_+	inverse autotransporter beta-barrel domain-containing protein	NA	NA	NA	NA	NA
3498004:3498823	attR	GGGCACTGTTGCAAATAGCTGCTTAGGGTAAACTTTCCTCCAATTTAAAGATCTTAGAGGCTGAAAACGTAGTTCACCAGACGCACTTCGCCTTGGGGATGGCCATAGTACCAAGGTTCTGCCTGTCCTTTGCGCAACGCGCGCATCACCTCTATCCCTTTGATTGTAGCGTAAGCCGTCTTCATGGATTTGAAGCCTAACATCGGATTGATTATCCGCTTCAGCTTACCGTGGTCACATTCAATCACGTTGTTGAGGTATTTCACCTGGCGGTGTTCCACGTCAGGCCGACACTTACCTTCTCGCTTCAGCAAAGCCAGCGCCCTGCCATAGGTGGGGGCCTTATCTGTAATGATACGTCTTGGCTGTTCCCAATCCCGTAAGTGACCCAACATCTTCTTCAAAAATCGATAAGCTGCGTTAGTATTACGTCGGGAGGAAAGATAAAAATCGATAGTTCTACCGTGGCTGTCGACGGCCCGGTACAGGTAAGCCCATTTGCCACCTATTTTGACGTAGGTTTCATCCAGATGCCAGGGACGCAGGTAGGTCGGATGACGCCAGTACCAGCGTAGGCGTTTTTCCATTTCAGGGGCATAGCGCTGAACCCAACGATAAATCGTAGTGTGATCGACATTGACGCCGCGTTCAGCCAACATTTCCTGGAGTTCGCGGTAACTGATGCCGTATTTACAATACCAGCGAACAGCCCAAAGGATAATGTCGCCCTGAAAATGTCGTCCATGGAAAGGGTTCATGTGCTGTTCCTTCTGCAAAAAGATAGCTCAGTTTATCACCACTGGCTATTTGCAACAGTGCC	NA	NA	NA	NA
WP_038400879.1|3503379_3504084_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	80.8	1.1e-112
WP_038400891.1|3504555_3506520_+	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_038400893.1|3506665_3506926_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049862789.1|3506985_3507861_+	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_038400895.1|3507969_3508293_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_038277219.1|3508279_3508561_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_049862790.1|3509423_3510104_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038400899.1|3510131_3510833_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	78.6	1.8e-107
WP_011193029.1|3511996_3513229_+	peptidase T	NA	A0A0K2CPK3	Brevibacillus_phage	39.1	1.2e-05
WP_038400901.1|3513754_3515827_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_080725857.1|3515977_3527647_+	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	24.1	3.0e-37
WP_038400905.1|3527659_3533389_+	non-ribosomal peptide synthetase	NA	A0A2K9L3I8	Tupanvirus	31.3	4.4e-42
WP_012104555.1|3533385_3534456_+	NAD-dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
WP_011193024.1|3534452_3535580_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_012303607.1|3535572_3536337_+	thioesterase	NA	NA	NA	NA	NA
WP_038400907.1|3536326_3537613_+	MFS transporter	NA	NA	NA	NA	NA
WP_038400909.1|3537612_3539385_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	25.8	2.0e-30
WP_038400911.1|3539377_3541135_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	24.0	5.2e-34
WP_011193019.1|3541457_3542333_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038400912.1|3542768_3543167_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002223676.1|3544705_3546049_+	gluconate permease GntP	NA	NA	NA	NA	NA
WP_011193018.1|3547059_3550824_+	autotransporter adhesin YapJ	NA	NA	NA	NA	NA
WP_011193017.1|3551479_3555250_+	autotransporter adhesin YapV	NA	NA	NA	NA	NA
WP_011193016.1|3555835_3558061_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	27.0	1.2e-27
WP_038400914.1|3558086_3559406_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038400916.1|3559419_3563898_+	type IV secretion protein Rhs	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	47.9	4.8e-28
WP_012104566.1|3563917_3564280_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038400918.1|3565188_3565380_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071840321.1|3565400_3565787_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211404.1|3566330_3566744_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038400920.1|3566923_3568303_-	DASS family sodium-coupled anion symporter	NA	NA	NA	NA	NA
WP_012303625.1|3568584_3569604_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_038400921.1|3569909_3570983_+	cellulase family glycosylhydrolase	NA	NA	NA	NA	NA
WP_038400922.1|3571144_3572569_+	MFS transporter	NA	NA	NA	NA	NA
WP_002211646.1|3572859_3575040_-	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_011193002.1|3575111_3576440_-	lysine N(6)-hydroxylase/L-ornithine N(5)-oxygenase family protein	NA	NA	NA	NA	NA
WP_038400923.1|3576436_3578185_-	aerobactin synthase IucC	NA	NA	NA	NA	NA
WP_002211649.1|3578181_3579132_-	acetyltransferase	NA	NA	NA	NA	NA
WP_011192999.1|3579115_3580888_-	aerobactin synthase IucA	NA	NA	NA	NA	NA
WP_002211651.1|3581027_3582251_+	MFS transporter	NA	NA	NA	NA	NA
WP_012104578.1|3582540_3583374_-	intradiol ring-cleavage dioxygenase	NA	NA	NA	NA	NA
WP_038400925.1|3583750_3585127_-	peptidase	NA	NA	NA	NA	NA
WP_002211655.1|3585688_3586432_+	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002215903.1|3586412_3587063_-	acyl-homoserine-lactone synthase	NA	NA	NA	NA	NA
WP_002215902.1|3588233_3588884_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 256
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	3594097	3657336	4806594	plate,transposase,integrase	Escherichia_phage(25.0%)	55	3586015:3586030	3638008:3638023
3586015:3586030	attL	TTTCACTTTTGTTCTG	NA	NA	NA	NA
WP_038399996.1|3594097_3595450_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_038400930.1|3595446_3596133_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_038400932.1|3596132_3597869_+	OmpA family protein	NA	NA	NA	NA	NA
WP_002210014.1|3597872_3598364_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_038400934.1|3598751_3601400_+	type VI secretion system ATPase TssH	NA	A0A223W0B1	Agrobacterium_phage	34.5	3.7e-84
WP_038400935.1|3601396_3603745_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	32.5	1.0e-16
WP_038400937.1|3603760_3606058_+	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_002210008.1|3606044_3606812_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144243027.1|3607561_3607762_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038400939.1|3608106_3608721_+	DUF2345 domain-containing protein	NA	NA	NA	NA	NA
WP_002210011.1|3608735_3610958_+	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_016257413.1|3610958_3611450_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002216110.1|3611663_3611858_+	hypothetical protein	NA	NA	NA	NA	NA
WP_115027165.1|3611886_3612583_+|transposase	IS1-like element ISYps7 family transposase	transposase	A0A0U2RK18	Escherichia_phage	48.5	3.7e-60
WP_144243028.1|3612647_3612848_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038400942.1|3613192_3613828_+	DUF2345 domain-containing protein	NA	NA	NA	NA	NA
WP_004722488.1|3614617_3614857_-	helix-turn-helix transcriptional regulator	NA	A0A2I6TC97	Escherichia_phage	46.5	2.7e-10
WP_004722490.1|3614891_3615215_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	O64357	Escherichia_phage	48.0	2.8e-18
WP_038400945.1|3616362_3616695_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038400946.1|3616706_3617063_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049862791.1|3617118_3617451_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038401772.1|3617444_3617918_-	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_038400948.1|3617949_3618381_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.1	3.6e-13
WP_038400949.1|3618988_3619540_-	DUF4339 domain-containing protein	NA	NA	NA	NA	NA
WP_038400951.1|3621345_3621585_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038400954.1|3621639_3621942_+	helix-turn-helix transcriptional regulator	NA	A0A1W6JPB6	Staphylococcus_phage	40.8	3.3e-05
WP_038400955.1|3621910_3622879_+	RNA-directed DNA polymerase	NA	NA	NA	NA	NA
WP_038400957.1|3623031_3624030_-|integrase	site-specific integrase	integrase	A0A142F1N9	Bacillus_phage	27.3	2.4e-20
WP_080725858.1|3624026_3624533_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_144243029.1|3624653_3625094_+	hypothetical protein	NA	NA	NA	NA	NA
WP_126287036.1|3625413_3625710_+	permease	NA	NA	NA	NA	NA
WP_038400961.1|3625968_3626310_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038400963.1|3626680_3627697_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_071840341.1|3627686_3628712_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_038400964.1|3628756_3630532_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_071840342.1|3630531_3631062_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_038400966.1|3631051_3634420_-	type VI secretion protein VasK	NA	NA	NA	NA	NA
WP_038400968.1|3634412_3635825_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038400969.1|3635824_3636079_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_038400971.1|3636100_3636559_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038400974.1|3636558_3637311_-	hypothetical protein	NA	A0A077K9W3	Ralstonia_phage	34.0	1.4e-09
WP_038400976.1|3637323_3639435_-	DUF3274 domain-containing protein	NA	A0A077K801	Ralstonia_phage	27.4	5.6e-43
3638008:3638023	attR	CAGAACAAAAGTGAAA	NA	NA	NA	NA
WP_038400978.1|3639510_3640260_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038400979.1|3640272_3642381_-	DUF3274 domain-containing protein	NA	A0A077K801	Ralstonia_phage	26.2	5.6e-35
WP_038400981.1|3642380_3644891_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_038400983.1|3645790_3646357_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071840322.1|3646417_3646693_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038401789.1|3648037_3649597_+	recombinase family protein	NA	A0A0N9RZT8	Staphylococcus_phage	28.8	1.3e-12
WP_038400984.1|3649593_3650484_+	ParB N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_038400985.1|3650476_3651361_+	ParB N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_038401792.1|3651677_3652334_-	DUF533 domain-containing protein	NA	NA	NA	NA	NA
WP_038401795.1|3652625_3652856_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_038400986.1|3653863_3654364_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_038400987.1|3654406_3655972_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_038400988.1|3655983_3657336_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
>prophage 257
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	3660412	3665397	4806594		Cronobacter_phage(50.0%)	2	NA	NA
WP_038400994.1|3660412_3663061_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	31.6	9.7e-93
WP_038400996.1|3663057_3665397_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	30.0	3.2e-15
>prophage 258
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	3691515	3692724	4806594	integrase	Enterobacteria_phage(100.0%)	1	3691486:3691498	3693733:3693745
3691486:3691498	attL	TTACTGATGTTGC	NA	NA	NA	NA
WP_038401020.1|3691515_3692724_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	53.9	1.3e-121
WP_038401020.1|3691515_3692724_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	53.9	1.3e-121
3693733:3693745	attR	TTACTGATGTTGC	NA	NA	NA	NA
>prophage 259
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	3697392	3698892	4806594		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_011192984.1|3697392_3698892_+	sugar ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	27.5	8.4e-09
>prophage 260
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	3725618	3727622	4806594		Acanthocystis_turfacea_Chlorella_virus(50.0%)	2	NA	NA
WP_038401031.1|3725618_3726734_-	agmatine deiminase	NA	M1I1E2	Acanthocystis_turfacea_Chlorella_virus	50.7	2.3e-96
WP_002209979.1|3726737_3727622_-	N-carbamoylputrescine amidase	NA	A7IVZ1	Paramecium_bursaria_Chlorella_virus	51.0	3.1e-80
>prophage 261
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	3732442	3733597	4806594		Staphylococcus_phage(100.0%)	1	NA	NA
WP_002209971.1|3732442_3733597_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	62.1	1.7e-126
>prophage 262
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	3750055	3751297	4806594		Catovirus(100.0%)	1	NA	NA
WP_002209956.1|3750055_3751297_+	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	46.5	2.1e-98
>prophage 263
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	3760256	3763136	4806594		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_002209947.1|3760256_3763136_+	aminomethyl-transferring glycine dehydrogenase	NA	E3SN07	Prochlorococcus_phage	52.3	1.7e-268
>prophage 264
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	3776510	3793083	4806594	integrase,tRNA	Enterobacteria_phage(25.0%)	17	3779586:3779600	3798557:3798571
WP_002209933.1|3776510_3777410_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	29.7	8.5e-33
WP_002209932.1|3777440_3778157_+	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
WP_002209931.1|3778163_3779897_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	29.7	3.6e-64
3779586:3779600	attL	GCTGAGTTATCACTG	NA	NA	NA	NA
WP_002228062.1|3780075_3781173_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	5.4e-05
WP_002209930.1|3781183_3782701_+|tRNA	lysine--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	37.0	1.1e-85
WP_011192954.1|3783133_3784348_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	58.8	3.7e-132
WP_002209928.1|3784429_3784615_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002214785.1|3785212_3785473_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A1S5NR91	Burkholderia_phage	36.0	7.4e-06
WP_011192920.1|3785535_3785898_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_024063131.1|3786061_3786358_+	type II toxin-antitoxin system MqsR family toxin	NA	NA	NA	NA	NA
WP_002209924.1|3786357_3786756_+	type II toxin-antitoxin system MqsA family antitoxin	NA	NA	NA	NA	NA
WP_038401050.1|3787155_3789447_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	40.5	1.2e-152
WP_002209922.1|3789746_3790073_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002209920.1|3790231_3790432_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_032466587.1|3790613_3790946_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002209919.1|3791306_3791672_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032465900.1|3791940_3793083_+	Fic family protein	NA	A0A1V0E025	Clostridioides_phage	22.6	6.4e-09
3798557:3798571	attR	CAGTGATAACTCAGC	NA	NA	NA	NA
>prophage 265
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	3808019	3811179	4806594		Organic_Lake_phycodnavirus(50.0%)	2	NA	NA
WP_032465984.1|3808019_3809528_-	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	29.8	1.4e-08
WP_038401055.1|3810066_3811179_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.3	4.7e-25
>prophage 266
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	3818536	3822465	4806594	transposase	Vibrio_phage(33.33%)	4	NA	NA
WP_002209896.1|3818536_3818848_+	PTS transporter subunit EIIB	NA	A0A2I7SAJ6	Vibrio_phage	39.2	3.3e-08
WP_011192907.1|3819220_3820480_-	maltoporin	NA	NA	NA	NA	NA
WP_002209894.1|3820751_3821825_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	43.6	2.9e-72
WP_002213759.1|3822006_3822465_-|transposase	IS200/IS605-like element IS1541A family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	8.5e-13
>prophage 267
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	3833011	3836498	4806594		Erwinia_phage(50.0%)	3	NA	NA
WP_011192899.1|3833011_3834238_-	anaerobic sulfatase maturase	NA	A0A1B2IC15	Erwinia_phage	33.1	5.4e-06
WP_012104703.1|3834668_3835727_-	glycoside hydrolase family 105 protein	NA	NA	NA	NA	NA
WP_002230627.1|3835742_3836498_-	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	29.7	6.7e-15
>prophage 268
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	3844745	3846299	4806594		Catovirus(100.0%)	1	NA	NA
WP_002209873.1|3844745_3846299_+	sulfatase	NA	A0A1V0SA98	Catovirus	26.1	5.4e-19
>prophage 269
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	3857005	3858928	4806594		Vibrio_phage(100.0%)	1	NA	NA
WP_011192891.1|3857005_3858928_+	type II secretion system secretin GspD	NA	R9TEZ5	Vibrio_phage	32.2	6.9e-32
>prophage 270
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	3868966	3870658	4806594		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_012413875.1|3868966_3870658_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	23.3	1.8e-12
>prophage 271
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	3878567	3883433	4806594		Escherichia_phage(50.0%)	2	NA	NA
WP_011192877.1|3878567_3880829_+	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	30.6	2.5e-73
WP_038401078.1|3881276_3883433_+	bifunctional acyl-ACP--phospholipid O-acyltransferase/long-chain-fatty-acid--ACP ligase	NA	A0A2H4PQU7	Staphylococcus_phage	24.1	2.2e-18
>prophage 272
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	3888953	3893124	4806594		Hokovirus(50.0%)	3	NA	NA
WP_011192874.1|3888953_3891200_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	24.6	7.9e-11
WP_002211383.1|3891450_3892323_+	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_011192873.1|3892329_3893124_+	thymidylate synthase	NA	R4IFY1	Cronobacter_phage	62.9	1.2e-118
>prophage 273
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	3898988	3915314	4806594	tRNA	Klosneuvirus(16.67%)	9	NA	NA
WP_002211626.1|3898988_3901877_+	pitrilysin	NA	A0A1V0SJA4	Klosneuvirus	24.7	5.1e-63
WP_038401090.1|3901873_3905536_+	exodeoxyribonuclease V subunit beta	NA	A7KV33	Bacillus_phage	23.0	3.4e-11
WP_038401092.1|3905532_3907506_+	exodeoxyribonuclease V subunit alpha	NA	A0A1P8DII4	Virus_Rctr197k	26.9	5.1e-22
WP_002211624.1|3907660_3908986_-	amino-acid N-acetyltransferase	NA	NA	NA	NA	NA
WP_002211623.1|3909221_3910472_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A067ZJB6	Vibrio_phage	30.3	4.2e-14
WP_002228046.1|3911352_3912525_+	murein transglycosylase A	NA	NA	NA	NA	NA
WP_002212114.1|3912667_3913495_+|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	30.8	2.5e-15
WP_032467022.1|3913530_3913974_-	cysteine desulfurase sulfur acceptor subunit CsdE	NA	NA	NA	NA	NA
WP_038401095.1|3914108_3915314_-	cysteine desulfurase CsdA	NA	Q2XUY6	environmental_halophage	36.5	7.8e-74
>prophage 274
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	3918816	3922194	4806594		Bacillus_phage(50.0%)	3	NA	NA
WP_011192868.1|3918816_3919572_-	flap endonuclease Xni	NA	A0A0N7ACJ6	Bacillus_phage	29.2	1.1e-14
WP_038401097.1|3919831_3921196_-	LOG family protein	NA	NA	NA	NA	NA
WP_011192866.1|3921348_3922194_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	37.9	9.4e-42
>prophage 275
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	3935697	3936456	4806594		Flavobacterium_phage(100.0%)	1	NA	NA
WP_002212136.1|3935697_3936456_+	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	40.7	1.4e-23
>prophage 276
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	3945452	3949694	4806594		Emiliania_huxleyi_virus(50.0%)	2	NA	NA
WP_002212145.1|3945452_3946049_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	41.4	3.8e-29
WP_038401810.1|3946211_3949694_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.3e-203
>prophage 277
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	3960620	3961652	4806594		Planktothrix_phage(100.0%)	1	NA	NA
WP_011192854.1|3960620_3961652_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	35.8	2.6e-33
>prophage 278
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	3968621	3975438	4806594		Klosneuvirus(25.0%)	8	NA	NA
WP_002210693.1|3968621_3969425_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SKP9	Klosneuvirus	29.2	3.6e-27
WP_080725879.1|3969655_3969802_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002220059.1|3970289_3971072_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_012104749.1|3971114_3972494_-	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.8	4.5e-09
WP_038401116.1|3972565_3973321_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_002210698.1|3973365_3974085_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_002210699.1|3974139_3974604_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	53.9	9.1e-47
WP_002210700.1|3974673_3975438_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.8	1.9e-41
>prophage 279
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	3980879	3986619	4806594		Bacillus_virus(40.0%)	5	NA	NA
WP_002212210.1|3980879_3982079_-	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	37.0	7.1e-27
WP_002212211.1|3982754_3983726_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A0N7CCA3	Skermania_phage	74.3	3.1e-137
WP_002212212.1|3983832_3985983_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	51.8	1.1e-211
WP_002215935.1|3985964_3986369_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	G3MBF1	Bacillus_virus	32.8	3.5e-10
WP_002212214.1|3986382_3986619_-	redoxin NrdH	NA	V5UN81	Mycobacterium_phage	53.3	5.9e-18
>prophage 280
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	3989877	3990090	4806594		Morganella_phage(100.0%)	1	NA	NA
WP_002212220.1|3989877_3990090_+	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	75.7	3.2e-23
>prophage 281
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	4019271	4024888	4806594		Hokovirus(50.0%)	3	NA	NA
WP_002209649.1|4019271_4021998_-	two-component system sensor histidine kinase KdbD	NA	A0A1V0SGX0	Hokovirus	26.7	9.2e-14
WP_002224856.1|4022007_4022658_-	potassium-transporting ATPase subunit KdpC	NA	NA	NA	NA	NA
WP_011192833.1|4022821_4024888_-	potassium-transporting ATPase subunit KdpB	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	25.4	9.1e-30
>prophage 282
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	4028372	4029836	4806594		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_011192831.1|4028372_4029836_+	deoxyribodipyrimidine photo-lyase	NA	F2Y1K1	Organic_Lake_phycodnavirus	31.3	7.1e-53
>prophage 283
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	4037284	4042037	4806594		Equid_alphaherpesvirus(33.33%)	5	NA	NA
WP_012303780.1|4037284_4037971_-	uracil-DNA glycosylase	NA	A0A0A7D9F8	Equid_alphaherpesvirus	48.6	6.7e-54
WP_002209664.1|4038322_4038706_+	autonomous glycyl radical cofactor GrcA	NA	A0A1W5N098	Cronobacter_phage	67.3	9.8e-31
WP_002209665.1|4038884_4039847_+	DUF2974 domain-containing protein	NA	NA	NA	NA	NA
WP_002209667.1|4039924_4040581_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_012104783.1|4040711_4042037_-	ATP-dependent RNA helicase SrmB	NA	A0A1V0SIR5	Klosneuvirus	32.4	1.9e-52
>prophage 284
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	4045142	4045718	4806594		Sinorhizobium_phage(100.0%)	1	NA	NA
WP_002209672.1|4045142_4045718_+	RNA polymerase sigma factor RpoE	NA	A0A0F6TH34	Sinorhizobium_phage	27.4	6.2e-05
>prophage 285
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	4049182	4053022	4806594		Streptococcus_phage(50.0%)	3	NA	NA
WP_002209677.1|4049182_4050982_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	26.4	3.4e-25
WP_002209678.1|4050991_4051990_+	signal peptidase I	NA	NA	NA	NA	NA
WP_002209679.1|4052341_4053022_+	ribonuclease III	NA	A0A0P0YM82	Yellowstone_lake_phycodnavirus	28.8	2.4e-19
>prophage 286
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	4056040	4094578	4806594	integrase,tail,terminase,capsid,holin	uncultured_Caudovirales_phage(34.21%)	48	4056255:4056314	4095767:4095857
WP_002211567.1|4056040_4056301_-	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	53.5	9.3e-17
4056255:4056314	attL	TCGCACATATCGCAATTAATACAGCGTTTAGTAATCAATAAAGCCATTTCAGTAACTTAC	NA	NA	NA	NA
WP_038401141.1|4056515_4057916_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_144243036.1|4058124_4059423_-	DEAD/DEAH box helicase	NA	Q3LZN8	Bacteriophage	70.9	1.6e-186
WP_038401145.1|4062060_4062441_-	hypothetical protein	NA	A0A142K8T9	Gordonia_phage	45.7	4.4e-07
WP_038401147.1|4062782_4064093_-	DUF2800 domain-containing protein	NA	B6SCX9	Bacteriophage	54.4	3.9e-127
WP_038401149.1|4064095_4064830_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038401151.1|4065391_4066069_-	helix-turn-helix transcriptional regulator	NA	B6SCU0	Bacteriophage	47.7	8.6e-54
WP_038401153.1|4066209_4066410_+	transcriptional regulator	NA	K7RWG7	Bacteriophage	60.7	5.9e-11
WP_049862795.1|4066413_4068588_+	hypothetical protein	NA	W8CQP1	Croceibacter_phage	27.3	1.3e-18
WP_038401155.1|4068866_4069079_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038401156.1|4069160_4069586_+	antitermination protein Q	NA	B6SCY2	Bacteriophage	39.4	3.3e-19
WP_012303802.1|4069957_4070338_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038401158.1|4070476_4070947_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155407490.1|4070954_4071092_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038401836.1|4071336_4071537_+|holin	holin	holin	B6SD15	Bacteriophage	60.7	2.2e-13
WP_038401159.1|4071514_4071997_+	lysozyme	NA	A0A2H4JCH1	uncultured_Caudovirales_phage	64.8	3.8e-56
WP_038401160.1|4071981_4072374_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038401162.1|4072593_4073145_+|terminase	terminase small subunit	terminase	A0A2H4J480	uncultured_Caudovirales_phage	61.9	9.1e-54
WP_012303808.1|4073168_4073528_-	helix-turn-helix transcriptional regulator	NA	A0A1S5NNJ5	Burkholderia_phage	41.7	1.9e-12
WP_038401164.1|4073579_4073840_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A1S5NR91	Burkholderia_phage	40.7	3.6e-08
WP_038401165.1|4073983_4075600_+	bacteriophage TerL protein	NA	A9YWZ6	Burkholderia_phage	73.0	9.6e-237
WP_038401168.1|4075599_4077072_+	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	60.8	1.0e-176
WP_080693621.1|4077091_4077685_+|capsid	minor capsid protein	capsid	A0A2H4JI47	uncultured_Caudovirales_phage	61.7	1.6e-67
WP_038401173.1|4077688_4078915_+	DUF2213 domain-containing protein	NA	A0A2H4J159	uncultured_Caudovirales_phage	53.1	1.3e-108
WP_038401175.1|4078918_4079410_+	hypothetical protein	NA	A0A2H4JHM9	uncultured_Caudovirales_phage	51.2	6.2e-38
WP_038401177.1|4079422_4080367_+	DUF2184 domain-containing protein	NA	A0A2H4J191	uncultured_Caudovirales_phage	71.7	3.1e-134
WP_057534853.1|4080404_4080749_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038401179.1|4080702_4081107_+	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	68.1	4.3e-45
WP_038401181.1|4081103_4081598_+	hypothetical protein	NA	A0A2H4J488	uncultured_Caudovirales_phage	65.9	2.6e-52
WP_038401183.1|4081584_4081983_+	hypothetical protein	NA	A0A0M3ULK0	Salmonella_phage	80.6	6.6e-54
WP_038401185.1|4081948_4082512_+	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	61.1	7.1e-62
WP_038401186.1|4082514_4083990_+	DUF3383 domain-containing protein	NA	A0A0P0I492	Acinetobacter_phage	54.5	1.1e-146
WP_038401189.1|4084001_4084442_+	DUF3277 family protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	69.2	8.9e-52
WP_038401192.1|4084452_4084851_+	hypothetical protein	NA	A0A2H4J2V6	uncultured_Caudovirales_phage	60.6	2.2e-33
WP_162472804.1|4084862_4085036_+	lytic transglycosylase	NA	NA	NA	NA	NA
WP_038401195.1|4085028_4087047_+	lytic transglycosylase domain-containing protein	NA	A0A0M4REK7	Salmonella_phage	60.8	5.1e-227
WP_038401197.1|4087046_4087673_+	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	67.9	2.9e-64
WP_038401199.1|4087669_4087975_+	hypothetical protein	NA	A0A0M4R5B7	Salmonella_phage	55.4	2.2e-25
WP_038401201.1|4087977_4089039_+	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	65.5	1.7e-133
WP_038401203.1|4089039_4089378_+	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	38.5	9.3e-17
WP_038401206.1|4089489_4089714_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_025383660.1|4089710_4090085_+	type II toxin-antitoxin system death-on-curing family toxin	NA	A0A222YZ88	Escherichia_phage	45.8	4.0e-21
WP_038401208.1|4090147_4090906_+	hypothetical protein	NA	A0A0M5M1K7	Salmonella_phage	62.9	4.0e-84
WP_038401210.1|4090902_4091256_+	bacteriophage protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	71.8	3.9e-42
WP_038401211.1|4091256_4092444_+	bacteriophage protein	NA	A0A0M4RD32	Salmonella_phage	57.1	1.6e-116
WP_038401213.1|4092443_4093118_+	DUF2612 domain-containing protein	NA	A9YX13	Burkholderia_phage	47.5	2.1e-52
WP_049862796.1|4093110_4094109_+|tail	tail fiber protein	tail	A9YX14	Burkholderia_phage	56.6	3.0e-15
WP_071840344.1|4094158_4094578_+|tail	tail fiber assembly protein	tail	B6SCW7	Bacteriophage	40.0	1.3e-12
4095767:4095857	attR	TCGCACATATCGCAATTAATACAGCGTTTAGTAATCAATAAAGCCATTTCAGTAACTTACCTTTTTAATCTTTTTAAATCATGCAGTTAAT	NA	NA	NA	NA
>prophage 287
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	4098913	4105309	4806594	tRNA	Pandoravirus(33.33%)	3	NA	NA
WP_038401217.1|4098913_4099516_+|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	S4VYT2	Pandoravirus	34.1	6.5e-05
WP_002211562.1|4099642_4101103_-	membrane-bound lytic murein transglycosylase MltF	NA	I1VXB7	Halocynthia_phage	41.4	7.1e-13
WP_038401220.1|4101418_4105309_+	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	59.5	8.8e-127
>prophage 288
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	4109100	4114690	4806594		Bacillus_phage(66.67%)	4	NA	NA
WP_011192820.1|4109100_4110537_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	23.8	3.1e-13
WP_072085126.1|4110585_4111608_+	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_002211556.1|4111570_4112908_+	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	37.4	1.2e-11
WP_038401223.1|4113067_4114690_+	NAD+ synthase	NA	A0A2L0UZF5	Agrobacterium_phage	36.7	1.4e-94
>prophage 289
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	4118319	4120564	4806594		Aeromonas_phage(50.0%)	3	NA	NA
WP_002211552.1|4118319_4119573_+	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	52.5	2.8e-98
WP_002223388.1|4119724_4119907_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011192817.1|4120015_4120564_+	attachment invasion locus protein Ail	NA	A0A1B0VBR9	Salmonella_phage	36.7	5.2e-25
>prophage 290
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	4127742	4134800	4806594		Faustovirus(20.0%)	8	NA	NA
WP_011192814.1|4127742_4128972_+	IscS subfamily cysteine desulfurase	NA	A0A0H3TPH2	Faustovirus	33.1	1.1e-35
WP_002209835.1|4129002_4129389_+	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	77.3	5.4e-53
WP_002209834.1|4129658_4129982_+	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	47.7	7.8e-21
WP_002209833.1|4130092_4130617_+	co-chaperone HscB	NA	NA	NA	NA	NA
WP_012104797.1|4130859_4132794_+	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	39.5	2.8e-97
WP_002209831.1|4132796_4133132_+	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_002209830.1|4133161_4133362_+	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_011192810.1|4133501_4134800_+	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	39.0	9.7e-38
>prophage 291
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	4146197	4146626	4806594		Powai_lake_megavirus(100.0%)	1	NA	NA
WP_011192804.1|4146197_4146626_+	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	40.9	7.4e-19
>prophage 292
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	4158004	4161017	4806594		Indivirus(50.0%)	2	NA	NA
WP_011192797.1|4158004_4159384_-	exodeoxyribonuclease VII large subunit	NA	A0A1V0SD82	Indivirus	39.1	1.3e-43
WP_002227862.1|4159553_4161017_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.1	1.7e-86
>prophage 293
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	4171139	4175418	4806594	tRNA	Bacillus_phage(66.67%)	4	NA	NA
WP_002209798.1|4171139_4172534_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	81.4	1.5e-177
WP_002209797.1|4172831_4173170_-	YegP family protein	NA	NA	NA	NA	NA
WP_011192786.1|4173306_4174026_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.8	3.0e-33
WP_038401849.1|4174035_4175418_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	30.5	1.4e-31
>prophage 294
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	4184833	4189278	4806594		Bacillus_virus(33.33%)	3	NA	NA
WP_038401249.1|4184833_4185919_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.8	8.4e-27
WP_038401251.1|4186301_4187807_-	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	31.2	2.6e-18
WP_012104823.1|4187988_4189278_+	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.8	1.8e-23
>prophage 295
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	4204123	4212994	4806594		Bacillus_phage(20.0%)	9	NA	NA
WP_002209780.1|4204123_4204936_+	phosphate ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	32.8	1.3e-16
WP_011192772.1|4205168_4206329_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_002209779.1|4206422_4206968_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_002209778.1|4207196_4207835_-	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	41.4	3.1e-29
WP_011192770.1|4207949_4208993_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	41.3	1.2e-70
WP_002209776.1|4209389_4210016_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_011192769.1|4210172_4211459_+	uracil permease	NA	Q9KX94	Enterobacteria_phage	38.2	2.1e-64
WP_002228401.1|4211717_4212425_+	DnaA inactivator Hda	NA	NA	NA	NA	NA
WP_002208565.1|4212637_4212994_-	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	45.3	6.1e-19
>prophage 296
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	4221176	4221890	4806594		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_002208555.1|4221176_4221890_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	E3SPA9	Prochlorococcus_phage	34.8	2.9e-36
>prophage 297
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	4232180	4233251	4806594		Bacillus_virus(100.0%)	1	NA	NA
WP_011192760.1|4232180_4233251_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.9	3.7e-27
>prophage 298
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	4257985	4260450	4806594		Stx_converting_phage(50.0%)	3	NA	NA
WP_012104845.1|4257985_4258399_-	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	40.9	1.0e-17
WP_002208521.1|4258761_4259373_+	RpoE-regulated lipoprotein	NA	NA	NA	NA	NA
WP_011192751.1|4259550_4260450_+	Dyp-type peroxidase	NA	S4VXK8	Pandoravirus	33.2	2.0e-26
>prophage 299
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	4266866	4268399	4806594		Burkholderia_virus(100.0%)	1	NA	NA
WP_002231046.1|4266866_4268399_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	23.1	3.2e-08
>prophage 300
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	4271466	4276032	4806594		Planktothrix_phage(25.0%)	4	NA	NA
WP_011192745.1|4271466_4272558_+	sulfate/thiosulfate ABC transporter ATP-binding protein CysA	NA	G9BWD6	Planktothrix_phage	39.4	3.0e-32
WP_038401284.1|4272728_4273607_+	cysteine synthase CysM	NA	A0A1X9I5K7	Streptococcus_phage	40.3	1.4e-51
WP_002224818.1|4273783_4274491_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.3	2.4e-35
WP_002208505.1|4274487_4276032_-	HAMP domain-containing histidine kinase	NA	A0A1B0VMK3	Pseudomonas_phage	28.6	8.6e-09
>prophage 301
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	4284576	4298538	4806594		Planktothrix_phage(20.0%)	11	NA	NA
WP_011192738.1|4284576_4286613_-	MacB family efflux pump subunit	NA	G9BWD6	Planktothrix_phage	41.0	4.0e-38
WP_038401293.1|4286616_4287822_-	efflux RND transporter periplasmic adaptor subunit	NA	A0A140XAI1	Dickeya_phage	64.2	3.0e-25
WP_002208494.1|4288009_4288693_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_011192737.1|4288718_4290068_+	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_002208491.1|4290250_4290760_-	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_002208490.1|4290808_4292536_-	phosphoenolpyruvate-protein phosphotransferase PtsI	NA	A0A1V0SGR7	Hokovirus	33.3	3.0e-18
WP_002208488.1|4292584_4292842_-	phosphocarrier protein Hpr	NA	NA	NA	NA	NA
WP_002222180.1|4293340_4294309_-	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	51.8	4.8e-74
WP_002231042.1|4294465_4295200_-	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_038401296.1|4295448_4296435_+	cell division protein ZipA	NA	NA	NA	NA	NA
WP_038401299.1|4296525_4298538_+	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	42.4	7.7e-143
>prophage 302
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	4313879	4314930	4806594		Escherichia_phage(50.0%)	2	NA	NA
WP_002211611.1|4313879_4314404_+	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	47.1	9.3e-24
WP_002211610.1|4314498_4314930_-	hypothetical protein	NA	Q7Y3V7	Yersinia_phage	48.2	2.4e-25
>prophage 303
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	4318038	4322950	4806594		Escherichia_phage(100.0%)	4	NA	NA
WP_002228419.1|4318038_4318635_-	molecular chaperone	NA	A0A077SLS7	Escherichia_phage	49.2	9.2e-44
WP_038401310.1|4319116_4319893_-	dimethyl sulfoxide reductase anchor subunit	NA	A0A077SK59	Escherichia_phage	40.6	5.6e-41
WP_002211603.1|4319894_4320512_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	68.3	1.1e-87
WP_038401312.1|4320523_4322950_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	54.8	1.6e-256
>prophage 304
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	4326391	4327441	4806594		Planktothrix_phage(100.0%)	1	NA	NA
WP_012303902.1|4326391_4327441_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.4	3.9e-21
>prophage 305
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	4336562	4337900	4806594		Xanthomonas_phage(100.0%)	1	NA	NA
WP_012104865.1|4336562_4337900_-	glycosyl transferase	NA	A0A292GJ55	Xanthomonas_phage	32.6	4.0e-71
>prophage 306
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	4343959	4346617	4806594		Agrobacterium_phage(100.0%)	1	NA	NA
WP_012104866.1|4343959_4346617_+	type VI secretion system ATPase TssH	NA	A0A223W0B1	Agrobacterium_phage	31.9	2.2e-81
>prophage 307
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	4362360	4365003	4806594		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_038401324.1|4362360_4365003_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	23.1	3.4e-29
>prophage 308
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	4372878	4373535	4806594		Indivirus(100.0%)	1	NA	NA
WP_012303914.1|4372878_4373535_+	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	A0A1V0SE00	Indivirus	24.7	6.2e-09
>prophage 309
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	4390057	4391143	4806594		Pandoravirus(100.0%)	1	NA	NA
WP_002209711.1|4390057_4391143_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.4	2.7e-89
>prophage 310
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	4403664	4404792	4806594		Cedratvirus(100.0%)	1	NA	NA
WP_002209725.1|4403664_4404792_+	4-phosphoerythronate dehydrogenase PdxB	NA	A0A285PXZ1	Cedratvirus	27.9	6.1e-20
>prophage 311
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	4412048	4413566	4806594		Mollivirus(100.0%)	1	NA	NA
WP_002209733.1|4412048_4413566_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	42.4	5.0e-86
>prophage 312
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	4417203	4418001	4806594		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
WP_002209738.1|4417203_4418001_+	histidine ABC transporter ATP-binding protein HisP	NA	M1I0T9	Acanthocystis_turfacea_Chlorella_virus	27.9	1.1e-07
>prophage 313
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	4430914	4435000	4806594		Acanthocystis_turfacea_Chlorella_virus(50.0%)	4	NA	NA
WP_011192675.1|4430914_4431571_+	sugar phosphatase	NA	M1H9H9	Acanthocystis_turfacea_Chlorella_virus	25.6	4.0e-08
WP_012303929.1|4431862_4433695_+	SLC13 family permease	NA	NA	NA	NA	NA
WP_038401858.1|4434168_4434360_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002210283.1|4434406_4435000_-	5'-deoxynucleotidase	NA	A0A2L0V156	Salmonella_phage	34.6	8.4e-05
>prophage 314
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	4461839	4462790	4806594		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_038401353.1|4461839_4462790_+	2-hydroxyacid dehydrogenase	NA	M1HMI7	Paramecium_bursaria_Chlorella_virus	25.2	2.9e-15
>prophage 315
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	4481030	4483285	4806594		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_038401365.1|4481030_4482335_+	PAS domain S-box protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	34.8	1.0e-15
WP_038401368.1|4482562_4483285_-	glutamine ABC transporter ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	42.9	3.9e-36
>prophage 316
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	4486733	4490622	4806594		Streptomyces_phage(50.0%)	5	NA	NA
WP_002210233.1|4486733_4487237_-	DNA starvation/stationary phase protection protein Dps	NA	A0A222YYG6	Streptomyces_phage	24.8	2.5e-05
WP_038401373.1|4487493_4488270_-	trans-aconitate 2-methyltransferase	NA	NA	NA	NA	NA
WP_038401376.1|4488292_4488790_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002213809.1|4488805_4489693_-	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
WP_002210229.1|4490097_4490622_+	outer membrane protein OmpX	NA	H6WZM8	Escherichia_phage	33.0	5.5e-16
>prophage 317
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	4496553	4498044	4806594		Staphylococcus_phage(100.0%)	1	NA	NA
WP_012104931.1|4496553_4498044_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.6	6.3e-17
>prophage 318
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	4521337	4523905	4806594		Planktothrix_phage(50.0%)	2	NA	NA
WP_011192635.1|4521337_4522417_-	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	32.3	2.3e-24
WP_002210201.1|4522516_4523905_-	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	28.3	2.5e-31
>prophage 319
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	4536235	4543971	4806594		Vibrio_phage(100.0%)	5	NA	NA
WP_012104943.1|4536235_4537216_+	type I-F CRISPR-associated endonuclease Cas1	NA	A0A2D0YUF3	Vibrio_phage	36.7	2.4e-49
WP_038401388.1|4537212_4540500_+	type I-F CRISPR-associated helicase Cas3	NA	A0A2I7RCU8	Vibrio_phage	29.5	6.0e-60
WP_012303963.1|4540655_4542002_+	type I-F CRISPR-associated protein Csy1	NA	NA	NA	NA	NA
WP_038401390.1|4541998_4542949_+	type I-F CRISPR-associated protein Csy2	NA	NA	NA	NA	NA
WP_002211867.1|4542966_4543971_+	type I-F CRISPR-associated protein Csy3	NA	A0A2D0YRR8	Vibrio_phage	41.2	3.3e-54
>prophage 320
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	4560752	4563982	4806594		Acinetobacter_phage(50.0%)	2	NA	NA
WP_011192613.1|4560752_4562291_-	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	57.2	5.7e-162
WP_038401393.1|4563058_4563982_-	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferasee	NA	A0A1W6JP29	Morganella_phage	43.6	1.4e-62
>prophage 321
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	4571264	4571510	4806594		Enterobacteria_phage(100.0%)	1	NA	NA
WP_002213110.1|4571264_4571510_-	DNA damage-inducible protein I	NA	K7PM44	Enterobacteria_phage	51.3	2.6e-13
>prophage 322
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	4583387	4584512	4806594		Trichoplusia_ni_ascovirus(50.0%)	2	NA	NA
WP_002210935.1|4583387_4584122_+	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	33.1	7.7e-16
WP_002220787.1|4584275_4584512_+	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	45.6	7.7e-10
>prophage 323
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	4588319	4588958	4806594		Pseudomonas_phage(100.0%)	1	NA	NA
WP_012303974.1|4588319_4588958_+	dTMP kinase	NA	Q2Z0N0	Pseudomonas_phage	36.1	3.5e-25
>prophage 324
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	4607561	4611331	4806594		Planktothrix_phage(50.0%)	4	NA	NA
WP_002210923.1|4607561_4608266_+	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	43.3	1.4e-35
WP_002210922.1|4608265_4609513_+	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
WP_012303979.1|4609531_4610446_+	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
WP_012104979.1|4610494_4611331_+	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	34.0	2.6e-20
>prophage 325
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	4617649	4619020	4806594		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_002230790.1|4617649_4619020_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	45.8	3.4e-110
>prophage 326
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	4622264	4773286	4806594	integrase,plate,tail,coat,lysis,transposase,protease,terminase,tRNA,holin	Burkholderia_phage(10.17%)	145	4613124:4613140	4693468:4693484
4613124:4613140	attL	GAGGTTATTGACAAAGT	NA	NA	NA	NA
WP_032466488.1|4622264_4623518_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	88.9	5.2e-20
WP_038401411.1|4623641_4624766_-|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	56.4	4.2e-122
WP_038401413.1|4624749_4624992_-	excisionase	NA	NA	NA	NA	NA
WP_038401415.1|4625190_4625427_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049862797.1|4625419_4626091_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038401879.1|4626087_4626414_-	hypothetical protein	NA	A0A1B5FPL8	Escherichia_phage	50.5	3.4e-24
WP_038401417.1|4626419_4626980_-	hypothetical protein	NA	A0A088C4R7	Shewanella_sp._phage	34.8	1.4e-22
WP_144243037.1|4626979_4627810_-	transcriptional regulator	NA	A0A059VF66	Pseudomonas_phage	31.8	3.9e-08
WP_038401419.1|4627842_4628124_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049862799.1|4628133_4628370_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038401421.1|4628441_4628630_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038401423.1|4629588_4630350_+	molecular chaperone	NA	A0A286N2Q2	Klebsiella_phage	47.3	1.8e-63
WP_038401885.1|4630697_4631453_+	serine/threonine protein kinase	NA	I6PD73	Cronobacter_phage	38.3	7.9e-40
WP_038401426.1|4631449_4632187_+	protein phosphatase	NA	I6PCV8	Cronobacter_phage	44.0	5.7e-51
WP_038401427.1|4632271_4632610_+|holin	phage holin, lambda family	holin	C6ZR64	Salmonella_phage	51.6	2.7e-16
WP_038401429.1|4632599_4632995_+	M15 family metallopeptidase	NA	K0NZV5	Escherichia_virus	64.6	1.7e-38
WP_038401887.1|4633230_4633698_+|lysis	lysis protein	lysis	A5LH84	Enterobacteria_phage	41.7	1.1e-20
WP_038401431.1|4633908_4634091_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038401432.1|4634327_4634696_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071840332.1|4634726_4635332_+|terminase	terminase small subunit	terminase	A0A2R3UAN5	Myoviridae_environmental_samples	51.4	3.6e-43
WP_025383392.1|4635664_4635841_+	type II toxin-antitoxin system HicA family toxin	NA	A0A0R6PGU2	Moraxella_phage	49.1	3.8e-06
WP_038401436.1|4635891_4636299_+	type II toxin-antitoxin system HicB family antitoxin	NA	F1C593	Cronobacter_phage	66.9	1.1e-45
WP_038401438.1|4636355_4637960_+	bacteriophage TerL protein	NA	A0A0M5M1R6	Salmonella_phage	71.6	6.2e-236
WP_144243032.1|4638057_4638540_-	DUF1073 domain-containing protein	NA	A0A2H5BG24	Pseudoalteromonas_phage	36.4	3.0e-08
WP_038401443.1|4639248_4639470_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038401445.1|4639462_4641244_+|tail	phage tail protein	tail	H9C1B7	Pectobacterium_phage	59.1	5.0e-194
WP_012304440.1|4641625_4641871_-	DinI-like family protein	NA	K7PLW4	Enterobacteria_phage	45.0	1.5e-11
WP_012304439.1|4641884_4642127_-	DinI family protein	NA	K7PKR6	Enterobacteria_phage	70.1	2.5e-24
WP_098087206.1|4642262_4642484_+	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	88.9	6.9e-21
WP_038401447.1|4642629_4643673_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_002210908.1|4643932_4644193_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038401449.1|4644312_4645893_-	PAS domain-containing protein	NA	A0A1B0V854	Salmonella_phage	50.7	2.5e-35
WP_038401451.1|4646812_4647670_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_002227977.1|4647829_4648213_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011192581.1|4648744_4650070_+	AppA family phytase/histidine-type acid phosphatase	NA	NA	NA	NA	NA
WP_002210902.1|4650363_4650567_-	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	44.6	9.8e-06
WP_012413770.1|4650869_4651769_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038401453.1|4651860_4652310_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_002214045.1|4652812_4653346_-	membrane protein	NA	NA	NA	NA	NA
WP_038401455.1|4653656_4654667_-	NAD(P)H-quinone oxidoreductase	NA	NA	NA	NA	NA
WP_038401457.1|4655073_4658274_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	61.9	0.0e+00
WP_002210893.1|4658814_4659027_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	80.0	2.0e-25
WP_071525649.1|4659118_4659433_+	protein DsrB	NA	NA	NA	NA	NA
WP_011192577.1|4659615_4661355_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.7	9.7e-09
WP_011192576.1|4662480_4663179_+	MgtC family protein	NA	G3MA03	Bacillus_virus	39.3	6.2e-15
WP_038401459.1|4663571_4666271_+	magnesium-translocating P-type ATPase	NA	M1HM40	Paramecium_bursaria_Chlorella_virus	25.4	3.2e-43
WP_011192574.1|4667457_4667808_+	flagellar transcriptional regulator FlhD	NA	NA	NA	NA	NA
WP_002210889.1|4667811_4668393_+	flagellar transcriptional regulator FlhC	NA	NA	NA	NA	NA
WP_011192573.1|4668597_4669485_+	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
WP_038401462.1|4669481_4670765_+	flagellar motor protein MotB	NA	NA	NA	NA	NA
WP_038401464.1|4670781_4672932_+	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_011192570.1|4673094_4673592_+	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_032466477.1|4674211_4677076_+	DUF2339 domain-containing protein	NA	NA	NA	NA	NA
WP_002214064.1|4677144_4677846_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011192568.1|4678086_4679760_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	34.7	1.5e-11
WP_038401466.1|4679943_4681554_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	30.6	6.2e-10
WP_038401469.1|4681726_4682599_+	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_002210874.1|4682598_4683648_+	chemotaxis response regulator protein-glutamate methylesterase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.0	6.1e-06
WP_002210873.1|4683748_4684138_+	chemotaxis protein CheY	NA	A0A2K9L4R0	Tupanvirus	32.3	1.3e-06
WP_002210872.1|4684147_4684792_+	protein phosphatase CheZ	NA	NA	NA	NA	NA
WP_038401471.1|4685332_4686097_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A076YN96	Rhizobium_phage	27.2	1.9e-09
WP_080725865.1|4686453_4688676_+	cell surface protein	NA	NA	NA	NA	NA
WP_038401473.1|4688662_4689097_+	adhesin	NA	NA	NA	NA	NA
WP_012304001.1|4689196_4690150_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011192563.1|4690767_4691997_-	alanine racemase	NA	NA	NA	NA	NA
WP_002210867.1|4692397_4692592_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002210865.1|4693156_4693405_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002210864.1|4693798_4695055_+	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
4693468:4693484	attR	GAGGTTATTGACAAAGT	NA	NA	NA	NA
WP_002210862.1|4695209_4695443_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011192562.1|4696242_4696632_+	ASCH domain-containing protein	NA	NA	NA	NA	NA
WP_002210859.1|4696741_4696981_-	YebV family protein	NA	NA	NA	NA	NA
WP_011192561.1|4697188_4698178_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_011192560.1|4698383_4700831_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_002210856.1|4700933_4701686_-	molecular chaperone	NA	NA	NA	NA	NA
WP_012304006.1|4701716_4702274_-|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_002216613.1|4702294_4702825_-|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_002210852.1|4702830_4703385_-|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_038401478.1|4703865_4706517_-	PqiB family protein	NA	NA	NA	NA	NA
WP_038401479.1|4706485_4707733_-	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_002210850.1|4707964_4708462_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_002210849.1|4708557_4709271_+	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_011192556.1|4709290_4711369_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	34.8	4.0e-86
WP_038401484.1|4711621_4712023_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	32.1	2.7e-07
WP_002210847.1|4712535_4713417_+|protease	protease HtpX	protease	NA	NA	NA	NA
WP_012105009.1|4714075_4714618_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_072080779.1|4714770_4715550_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_002210844.1|4715631_4718244_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_002215120.1|4718240_4719404_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_002210843.1|4719400_4720204_+	molecular chaperone	NA	NA	NA	NA	NA
WP_002210842.1|4720257_4721625_-	MFS transporter	NA	NA	NA	NA	NA
WP_011192552.1|4722011_4723178_+	oligogalacturonate lyase	NA	NA	NA	NA	NA
WP_002210840.1|4723364_4724156_+	DNA-binding transcriptional regulator KdgR	NA	NA	NA	NA	NA
WP_002210839.1|4724529_4725381_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1W6DX33	Sphingobium_phage	28.8	1.3e-11
WP_012105013.1|4725595_4726987_-	L-cystine transporter	NA	NA	NA	NA	NA
WP_033851001.1|4727190_4727739_-	metal-dependent hydrolase	NA	A0A127AVX7	Bacillus_phage	33.3	5.2e-09
WP_002210836.1|4728254_4728965_-	porin	NA	NA	NA	NA	NA
WP_002210835.1|4729262_4730555_-	carbohydrate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002210834.1|4730570_4731698_-	ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	26.5	1.6e-12
WP_002210833.1|4731711_4732632_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_038401497.1|4732624_4733515_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_038401498.1|4733555_4735223_-	pectate lyase	NA	NA	NA	NA	NA
WP_002210830.1|4735568_4736330_-	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.9	3.1e-20
WP_002210829.1|4736421_4737258_-	5-dehydro-4-deoxy-D-glucuronate isomerase	NA	NA	NA	NA	NA
WP_012105016.1|4737593_4737926_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_002220277.1|4738126_4738792_-	hexitol phosphatase HxpB	NA	NA	NA	NA	NA
WP_002211847.1|4739202_4739757_+	yfeABCD regulator yfeE	NA	NA	NA	NA	NA
WP_002211846.1|4739885_4740761_-	fructosamine kinase family protein	NA	NA	NA	NA	NA
WP_002216683.1|4740785_4740998_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002211845.1|4741065_4741959_-	iron/manganese ABC transporter permease subunit YfeD	NA	NA	NA	NA	NA
WP_011192548.1|4741955_4742840_-	iron/manganese ABC transporter permease subunit YfeC	NA	NA	NA	NA	NA
WP_002211843.1|4742839_4743730_-	iron/manganese ABC transporter ATP-binding protein YfeB	NA	A0A1V0SKJ1	Klosneuvirus	27.5	2.9e-09
WP_038401500.1|4743726_4744695_-	iron/manganese ABC transporter substrate-binding protein YfeA	NA	NA	NA	NA	NA
WP_024062912.1|4744906_4745569_+	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_115027228.1|4745789_4746563_-	DNA adenine methylase	NA	A2I2Y7	Vibrio_virus	65.7	1.5e-99
WP_115027255.1|4746704_4746965_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038401507.1|4747051_4747843_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049862800.1|4747853_4748363_-	hypothetical protein	NA	A2I2X8	Vibrio_virus	40.4	1.7e-22
WP_049862801.1|4748359_4749016_-|tail	phage tail protein I	tail	A4JWL7	Burkholderia_virus	50.5	5.6e-18
WP_038401510.1|4749008_4750130_-	hypothetical protein	NA	A4JWL6	Burkholderia_virus	44.8	1.8e-80
WP_038401512.1|4750107_4750482_-|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	58.6	6.6e-32
WP_049862802.1|4750535_4751081_-|plate	phage baseplate assembly protein V	plate	Q6QIA1	Burkholderia_phage	37.6	5.0e-12
WP_144243033.1|4751080_4752187_-	late control protein D	NA	Q6QIA2	Burkholderia_phage	43.5	2.6e-68
WP_080725867.1|4752174_4752393_-	hypothetical protein	NA	Q6QIA3	Burkholderia_phage	60.0	6.6e-16
WP_049862803.1|4752389_4753241_-|tail	phage tail protein	tail	A4JWL1	Burkholderia_virus	30.0	9.8e-23
WP_038401516.1|4753237_4754188_-	hypothetical protein	NA	E5FFG5	Burkholderia_phage	36.9	9.6e-27
WP_038401518.1|4754252_4754690_+	regulatory protein GemA	NA	Q6QIE7	Burkholderia_phage	50.0	4.7e-29
WP_038401520.1|4754720_4755098_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038401522.1|4755402_4756110_-	MarC family NAAT transporter	NA	NA	NA	NA	NA
WP_002211839.1|4756428_4756680_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002216696.1|4757438_4757651_-	KTSC domain-containing protein	NA	A0A0K1LMB5	Caulobacter_phage	42.0	9.9e-09
WP_002211836.1|4758041_4759970_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.1	1.1e-127
WP_002227898.1|4759973_4760525_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.7	2.6e-16
WP_002211834.1|4760621_4760819_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_002211833.1|4760856_4761213_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_152328947.1|4761307_4761355_+	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_011192546.1|4761711_4762695_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	7.6e-35
WP_012105021.1|4762708_4765096_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_002211830.1|4765100_4765397_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	4.2e-13
WP_012105022.1|4765730_4766189_+	DUF2502 domain-containing protein	NA	NA	NA	NA	NA
WP_002220283.1|4766397_4767405_+	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_002211827.1|4767474_4768029_+	glutathione peroxidase	NA	NA	NA	NA	NA
WP_002211826.1|4768053_4768812_+	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A1M7XV31	Cedratvirus	28.5	9.4e-09
WP_002211825.1|4769161_4770316_+	UDP-4-amino-4-deoxy-L-arabinose aminotransferase	NA	A0A2K9L470	Tupanvirus	28.8	8.3e-33
WP_038401524.1|4770302_4771286_+	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase	NA	A8CG95	Salmonella_phage	33.2	1.5e-35
WP_011192542.1|4771282_4773286_+	bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA	NA	A0A2K9KZK0	Tupanvirus	24.6	1.3e-17
>prophage 327
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	4776850	4784885	4806594		Bacillus_phage(25.0%)	6	NA	NA
WP_002216102.1|4776850_4777315_+	lipoprotein	NA	A0A217EQL1	Bacillus_phage	37.0	8.9e-10
WP_032466454.1|4777439_4778456_+	lipoate--protein ligase A	NA	NA	NA	NA	NA
WP_011192539.1|4778507_4779971_+	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	35.8	8.9e-56
WP_032466452.1|4780139_4781186_-	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0B5IW14	Pandoravirus	49.0	4.2e-84
WP_002211814.1|4781342_4782164_-	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_002211813.1|4782500_4784885_+	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	36.6	4.1e-175
>prophage 328
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	4791460	4796806	4806594		uncultured_virus(33.33%)	5	NA	NA
WP_002211809.1|4791460_4791832_+	Fe-S cluster assembly scaffold SufA	NA	A0A218MM00	uncultured_virus	35.6	1.1e-15
WP_011192536.1|4791846_4793358_+	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_011192535.1|4793542_4794289_+	Fe-S cluster assembly ATPase SufC	NA	A0A1V0SJ29	Klosneuvirus	26.4	1.2e-08
WP_038401529.1|4794263_4795589_+	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_002211805.1|4795585_4796806_+	cysteine desulfurase SufS	NA	Q2XUY6	environmental_halophage	40.9	2.8e-87
>prophage 329
NZ_CP008943	Yersinia pseudotuberculosis strain ATCC 6904 chromosome, complete genome	4806594	4803881	4804538	4806594		Orpheovirus(100.0%)	1	NA	NA
WP_011192532.1|4803881_4804538_+	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	34.7	1.1e-21
