The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP003424	Serratia sp. SCBI, complete genome	5034688	2980184	3019378	5034688	integrase,head,protease,capsid,lysis,tail,holin,portal	Salmonella_phage(32.61%)	57	2979898:2979919	3019410:3019431
2979898:2979919	attL	ATCACACCGGCATATTCATGAT	NA	NA	NA	NA
WP_049866686.1|2980184_2982539_-	hypothetical protein	NA	A0A249Y293	Serratia_phage	42.9	1.9e-145
WP_042784814.1|2982946_2983198_+	Arc family DNA-binding protein	NA	E7C9U8	Salmonella_phage	53.2	2.0e-16
WP_084587987.1|2983681_2986045_-	lytic transglycosylase domain-containing protein	NA	B9UDL1	Salmonella_phage	66.1	2.2e-221
WP_042784816.1|2986158_2987508_-	DNA injection protein	NA	E7C9U5	Salmonella_phage	40.0	2.3e-50
WP_049866722.1|2987507_2988161_-	hypothetical protein	NA	I6S1K1	Salmonella_phage	55.6	4.0e-40
WP_042784817.1|2988216_2988675_-	DUF2824 family protein	NA	G5DA79	Enterobacteria_phage	84.4	2.6e-70
WP_049866687.1|2988674_2989589_-|tail	phage tail protein	tail	Q9AYZ3	Salmonella_phage	37.6	9.2e-35
WP_042784818.1|2989585_2991013_-	Packaged DNA stabilization protein gp10	NA	I1TEJ1	Salmonella_phage	70.3	1.4e-207
WP_004940081.1|2991020_2991503_-|head	head DNA stabilization protein	head	Q716G8	Shigella_phage	83.6	7.4e-76
WP_004940084.1|2991477_2991663_-	hypothetical protein	NA	Q716G9	Shigella_phage	80.3	3.4e-21
WP_042784820.1|2991702_2992977_-|head	head protein	head	Q716H0	Shigella_phage	92.2	9.0e-222
WP_042784821.1|2992988_2993876_-|capsid	phage capsid scaffolding protein	capsid	Q716H1	Shigella_phage	73.6	1.1e-98
WP_042784823.1|2993889_2996016_-|portal	portal protein	portal	Q9AYZ9	Salmonella_phage	89.0	0.0e+00
WP_042784824.1|2996018_2997479_-	DNA packaging protein	NA	Q2A0C1	Sodalis_phage	76.9	6.9e-234
WP_042784825.1|2997429_2997951_-	hypothetical protein	NA	F8TUR4	EBPR_podovirus	50.0	1.2e-26
WP_042784826.1|2997959_2998292_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071883555.1|2998418_2998979_-	hypothetical protein	NA	A0A096XV31	Lactococcus_phage	35.3	2.4e-17
WP_049866723.1|2998980_2999217_-	DUF2560 family protein	NA	A0A192Y6S9	Salmonella_phage	56.8	7.9e-15
WP_042784827.1|2999410_2999857_-|lysis	lysis protein	lysis	A0A2H4JHL8	uncultured_Caudovirales_phage	46.9	9.1e-20
WP_042784828.1|2999853_3000288_-	lysozyme	NA	Q5G8R3	Enterobacteria_phage	71.0	3.3e-51
WP_042784830.1|3000271_3000604_-|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	72.5	2.5e-43
WP_042784833.1|3001390_3001882_-	DUF1133 family protein	NA	I6S672	Salmonella_phage	78.5	1.8e-69
WP_042784834.1|3002069_3002651_-	protein ninG	NA	A0A2R2Z332	Escherichia_phage	41.1	6.5e-34
WP_042784835.1|3002643_3002823_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042784838.1|3002995_3003328_-	DUF2591 domain-containing protein	NA	G8C7S4	Escherichia_phage	79.2	1.6e-45
WP_042784839.1|3003324_3003549_-	hypothetical protein	NA	R9W0Y3	Serratia_phage	79.7	4.7e-25
WP_156965105.1|3003545_3003716_-	NinE family protein	NA	NA	NA	NA	NA
WP_042784840.1|3003712_3004150_-	recombination protein NinB	NA	A0A2H4J8D9	uncultured_Caudovirales_phage	67.4	6.5e-47
WP_156965106.1|3004340_3004595_-	hypothetical protein	NA	F1C5B5	Cronobacter_phage	65.7	1.9e-06
WP_042784841.1|3004618_3005956_-	AAA family ATPase	NA	A0A2I7S0U1	Vibrio_phage	37.5	7.3e-81
WP_084587966.1|3006007_3006847_-	replication protein	NA	I6PDJ3	Cronobacter_phage	69.7	5.3e-37
WP_004940137.1|3007032_3007311_-	transcriptional regulator	NA	G8EYH8	Enterobacteria_phage	56.7	9.6e-20
WP_004940138.1|3007420_3007651_-	helix-turn-helix domain-containing protein	NA	G8C7U2	Escherichia_phage	63.4	1.4e-16
WP_084587967.1|3007690_3008380_+	LexA family transcriptional regulator	NA	A0A1R3Y604	Salmonella_virus	29.5	1.1e-19
WP_071883557.1|3008988_3009237_+	hypothetical protein	NA	Q9EYB0	Enterobacteria_phage	36.7	1.6e-05
WP_156965107.1|3009251_3009527_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156965108.1|3009691_3009943_+	DUF551 domain-containing protein	NA	S4SIA3	Salmonella_phage	55.7	2.7e-13
WP_020827381.1|3010095_3010230_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	NA	NA	NA	NA
WP_042784842.1|3010339_3010540_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156965109.1|3010536_3010704_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156965110.1|3010713_3010998_+	hypothetical protein	NA	A0A1W6JP21	Morganella_phage	70.2	1.0e-29
WP_042784847.1|3012586_3013045_+	single-stranded DNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	77.2	9.2e-52
WP_042784848.1|3013072_3013405_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042784849.1|3013589_3014072_+	hypothetical protein	NA	R9W085	Serratia_phage	35.9	1.2e-06
WP_042784850.1|3014068_3014317_+	hypothetical protein	NA	A0A1B0VMD8	Pseudomonas_phage	61.6	1.3e-20
WP_049866690.1|3014313_3014673_+	hypothetical protein	NA	A0A2I7RVG6	Vibrio_phage	56.2	1.9e-15
WP_042784851.1|3014665_3014869_+	hypothetical protein	NA	R9VYJ0	Serratia_phage	89.1	4.8e-29
WP_042784852.1|3014865_3015141_+	hypothetical protein	NA	S4TW48	Salmonella_phage	59.0	1.8e-18
WP_042784853.1|3015130_3015697_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042784854.1|3015697_3015952_+	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	51.7	7.7e-16
WP_004940162.1|3016591_3016852_+	hypothetical protein	NA	A0A1V0E5L9	Salmonella_phage	57.9	1.0e-18
WP_042784855.1|3016861_3017116_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	64.3	2.2e-23
WP_004940166.1|3017186_3017408_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042784856.1|3017400_3017610_+	hypothetical protein	NA	E5AGD4	Erwinia_phage	50.0	4.7e-11
WP_042784857.1|3017606_3017798_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071883560.1|3017814_3018063_+	excisionase family protein	NA	S4TND0	Salmonella_phage	62.5	1.5e-19
WP_042784859.1|3018094_3019378_+|integrase	site-specific integrase	integrase	Q20GI2	Phage_258-320	59.1	4.2e-150
3019410:3019431	attR	ATCACACCGGCATATTCATGAT	NA	NA	NA	NA
>prophage 2
NZ_CP003424	Serratia sp. SCBI, complete genome	5034688	3462007	3482761	5034688	holin,tail	Klebsiella_phage(23.53%)	22	NA	NA
WP_071883568.1|3462007_3464029_-|tail	phage tail protein	tail	A0A1I9SF20	Klebsiella_phage	42.5	2.3e-30
WP_042785073.1|3464025_3465186_-|tail	tail fiber domain-containing protein	tail	A0A1V0E5M2	Salmonella_phage	57.8	1.1e-43
WP_042785074.1|3465236_3468824_-	DUF1983 domain-containing protein	NA	F1C571	Cronobacter_phage	66.0	0.0e+00
WP_042785075.1|3468877_3469483_-|tail	tail assembly protein	tail	F1C572	Cronobacter_phage	56.4	2.2e-53
WP_127554718.1|3469516_3469849_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033652515.1|3469886_3470591_-	C40 family peptidase	NA	K7PGR2	Enterobacteria_phage	76.2	6.3e-108
WP_103086416.1|3470600_3471350_-|tail	phage minor tail protein L	tail	K7PGX3	Enterobacteria_phage	64.9	1.0e-95
WP_019453671.1|3471362_3471701_-|tail	phage tail protein	tail	Q6UAW6	Klebsiella_phage	60.9	2.2e-34
WP_042785076.1|3471700_3474040_-|tail	phage tail tape measure protein	tail	Q6UAW7	Klebsiella_phage	42.3	3.8e-16
WP_025160180.1|3474271_3474637_-|tail	phage tail protein	tail	Q7Y401	Yersinia_phage	45.0	6.5e-24
WP_033652513.1|3474763_3475219_-|tail	major tail shaft subunit	tail	Q6UAX0	Klebsiella_phage	75.5	2.5e-57
WP_042785077.1|3475259_3475652_-	hypothetical protein	NA	Q7Y404	Yersinia_phage	45.2	2.3e-19
WP_042785078.1|3475648_3476038_-	hypothetical protein	NA	Q7Y405	Yersinia_phage	42.1	3.7e-25
WP_042785079.1|3476095_3476536_-	lysozyme	NA	A0A0M5M782	Salmonella_phage	62.3	3.4e-43
WP_033652509.1|3476522_3476843_-|holin	holin	holin	F1C5D1	Cronobacter_phage	81.0	1.1e-40
WP_042785760.1|3477744_3478107_-	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	64.6	6.0e-38
WP_042785081.1|3478349_3479027_+	hypothetical protein	NA	K7PK07	Enterobacteria_phage	29.6	3.2e-08
WP_004935874.1|3479445_3479775_-	osmotically-inducible lipoprotein OsmE	NA	NA	NA	NA	NA
WP_033643833.1|3479902_3480370_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_033643834.1|3480478_3481057_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_033651921.1|3481050_3481467_-	glyoxalase	NA	NA	NA	NA	NA
WP_033651922.1|3481624_3482761_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	53.8	4.0e-104
>prophage 3
NZ_CP003424	Serratia sp. SCBI, complete genome	5034688	3755594	3762688	5034688		Salmonella_phage(33.33%)	10	NA	NA
WP_033651533.1|3755594_3755948_+	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	47.0	1.6e-19
WP_033644019.1|3756148_3756379_+	hypothetical protein	NA	J9Q735	Salmonella_phage	50.7	4.2e-13
WP_033644020.1|3756392_3756932_+	DNA-binding protein	NA	J9Q7G7	Salmonella_phage	56.6	4.0e-46
WP_025159568.1|3756945_3757647_-	DnaA inactivator Hda	NA	NA	NA	NA	NA
WP_016926729.1|3757919_3758435_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016926728.1|3758468_3758717_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_033651534.1|3758764_3760054_-	uracil permease	NA	Q9KX94	Enterobacteria_phage	38.2	6.0e-64
WP_004941642.1|3760130_3760757_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_025303843.1|3761012_3762050_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	41.9	3.8e-69
WP_033651535.1|3762049_3762688_+	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	39.2	3.2e-26
