The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	0	3356	2989591		Bacillus_virus(50.0%)	4	NA	NA
WP_003732024.1|92_908_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003723127.1|907_1528_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010989848.1|1543_2542_-	NAD(P)/FAD-dependent oxidoreductase	NA	G3MA85	Bacillus_virus	26.7	8.6e-18
WP_003732025.1|2531_3356_-	ABC transporter ATP-binding protein	NA	F2Y165	Organic_Lake_phycodnavirus	22.4	4.8e-06
>prophage 2
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	7457	21191	2989591		Bacillus_phage(37.5%)	14	NA	NA
WP_012951821.1|7457_8351_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	32.3	1.3e-41
WP_003723601.1|8379_9564_+	phosphopentomutase	NA	NA	NA	NA	NA
WP_003723600.1|9582_10401_+	purine-nucleoside phosphorylase	NA	Q5YBA4	Grouper_iridovirus	43.2	2.3e-61
WP_003732029.1|10581_11892_+	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
WP_003723598.1|11907_12657_+	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	29.0	2.7e-08
WP_003723597.1|12653_13250_+	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	30.8	1.2e-11
WP_003723596.1|13252_13987_+	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_003723595.1|14169_14886_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	40.4	1.2e-45
WP_003723594.1|14986_16777_+	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	36.2	2.3e-37
WP_003723593.1|16792_17311_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_003732031.1|17751_18363_+	ECF transporter S component	NA	NA	NA	NA	NA
WP_003723591.1|18404_18629_-	ferredoxin	NA	A0A127AYY7	Bacillus_phage	46.6	4.6e-12
WP_025370619.1|18783_19791_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012951818.1|19787_21191_+	ATP-dependent DNA helicase RecQ	NA	F2NZ48	Diadromus_pulchellus_ascovirus	38.6	6.5e-56
>prophage 3
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	29455	37458	2989591		Bacillus_phage(16.67%)	10	NA	NA
WP_003720260.1|29455_29731_+	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	69.7	2.0e-25
WP_003724029.1|29965_30535_+	GTP cyclohydrolase I FolE	NA	E7DN69	Pneumococcus_phage	47.2	2.4e-41
WP_010989844.1|30593_31361_+	heptaprenyl diphosphate synthase component 1	NA	NA	NA	NA	NA
WP_003726790.1|31383_32097_+	demethylmenaquinone methyltransferase	NA	NA	NA	NA	NA
WP_012951817.1|32107_33073_+	heptaprenyl diphosphate synthase component II	NA	A0A1V0SE37	Indivirus	21.0	2.3e-07
WP_003723912.1|33091_33535_+	nucleoside-diphosphate kinase	NA	D2E8E1	Anguillid_herpesvirus	48.9	4.8e-29
WP_003723911.1|33738_34905_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	39.0	7.1e-48
WP_012951816.1|34907_36005_+	3-dehydroquinate synthase	NA	NA	NA	NA	NA
WP_009924600.1|36001_36376_+	chorismate mutase	NA	NA	NA	NA	NA
WP_012951815.1|36375_37458_+	histidinol-phosphate transaminase	NA	A0A0H3TLT9	Faustovirus	24.7	1.6e-17
>prophage 4
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	41300	48245	2989591		Bacillus_virus(25.0%)	6	NA	NA
WP_003723904.1|41300_41846_+	YpiB family protein	NA	G3MAV7	Bacillus_virus	39.8	4.8e-31
WP_003732043.1|41933_42530_+	DUF1405 domain-containing protein	NA	NA	NA	NA	NA
WP_003728748.1|42615_43299_+	zinc metallopeptidase	NA	NA	NA	NA	NA
WP_012951811.1|43412_44678_+	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2H4PQX1	Staphylococcus_phage	57.9	1.8e-28
WP_003723027.1|44723_47003_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	37.7	4.8e-141
WP_012951810.1|47237_48245_-	serine hydrolase	NA	A0A1V0SLG8	Klosneuvirus	26.4	3.8e-05
>prophage 5
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	51704	59155	2989591	tRNA	Bacillus_phage(50.0%)	8	NA	NA
WP_003732050.1|51704_52832_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	33.5	2.7e-20
WP_003723021.1|52857_53994_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	34.5	8.8e-19
WP_003723020.1|54313_55420_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_003723019.1|55409_56276_-	YitT family protein	NA	M1Q1P6	Streptococcus_phage	43.0	3.6e-65
WP_003723018.1|56415_56751_+	nucleotide pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_003723017.1|56747_57539_+	4-hydroxy-tetrahydrodipicolinate reductase	NA	NA	NA	NA	NA
WP_003723016.1|57554_57959_+	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_003723015.1|57973_59155_+|tRNA	CCA tRNA nucleotidyltransferase	tRNA	G3MAR3	Bacillus_virus	39.9	2.7e-34
>prophage 6
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	63087	69013	2989591	tRNA	Bacillus_phage(50.0%)	4	NA	NA
WP_003723009.1|63087_65874_+	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	26.0	1.6e-50
WP_003723008.1|65918_66503_+	DUF5590 domain-containg protein	NA	NA	NA	NA	NA
WP_003723007.1|66525_67707_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_003723006.1|67720_69013_+|tRNA	asparagine--tRNA ligase	tRNA	M1PB22	Moumouvirus	30.8	7.1e-57
>prophage 7
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	73592	74198	2989591		Bacillus_phage(100.0%)	1	NA	NA
WP_012951806.1|73592_74198_-	Holliday junction resolvase RecU	NA	A0A1C8E9C3	Bacillus_phage	35.5	1.7e-24
>prophage 8
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	82922	90636	2989591		Bacillus_phage(40.0%)	8	NA	NA
WP_003732065.1|82922_83795_+	5'-3' exonuclease	NA	A0A0N7ACJ6	Bacillus_phage	36.2	2.0e-39
WP_003732066.1|83812_84214_-	ribonuclease HI family protein	NA	NA	NA	NA	NA
WP_003728273.1|84336_84537_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	63.6	8.4e-18
WP_003725831.1|84901_85330_+	transcriptional regulator MntR	NA	NA	NA	NA	NA
WP_003732067.1|85486_87169_+	formate--tetrahydrofolate ligase	NA	NA	NA	NA	NA
WP_003732068.1|87288_89181_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	30.2	1.8e-56
WP_012951803.1|89193_90138_+	thymidylate synthase	NA	A0A0N9SH48	Staphylococcus_phage	64.4	8.1e-119
WP_012951802.1|90153_90636_+	dihydrofolate reductase	NA	J9PU01	Bacillus_phage	47.6	9.8e-28
>prophage 9
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	95414	98054	2989591		Stenotrophomonas_phage(100.0%)	1	NA	NA
WP_012951799.1|95414_98054_-	pyruvate, phosphate dikinase	NA	A0A2D2W2B1	Stenotrophomonas_phage	41.4	6.0e-87
>prophage 10
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	107038	112449	2989591		uncultured_virus(33.33%)	5	NA	NA
WP_003733071.1|107038_109252_+	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	36.5	4.6e-112
WP_003723406.1|109264_109471_+	heavy-metal-associated domain-containing protein	NA	NA	NA	NA	NA
WP_012951795.1|109624_111115_+	S41 family peptidase	NA	A0A0R6PIZ1	Moraxella_phage	30.1	1.9e-21
WP_003733073.1|111151_111568_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003733074.1|111726_112449_+	metal ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	24.4	3.9e-12
>prophage 11
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	117612	125234	2989591		Bodo_saltans_virus(25.0%)	8	NA	NA
WP_003724126.1|117612_118524_+	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	29.8	1.4e-11
WP_003733835.1|118543_119368_-	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_003733083.1|119455_119686_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003729510.1|119916_120468_+	bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR	NA	NA	NA	NA	NA
WP_003723083.1|120596_121883_+	uracil transporter	NA	Q9KX94	Enterobacteria_phage	35.8	2.3e-60
WP_012951792.1|121966_122878_+	aspartate carbamoyltransferase catalytic subunit	NA	A0A1J0F9B8	Only_Syngen_Nebraska_virus	30.3	5.4e-27
WP_012951791.1|122865_124146_+	dihydroorotase	NA	NA	NA	NA	NA
WP_003723080.1|124142_125234_+	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	37.6	1.1e-61
>prophage 12
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	130831	144556	2989591	tRNA	Pandoravirus(33.33%)	12	NA	NA
WP_003723075.1|130831_131461_+	orotate phosphoribosyltransferase	NA	S4VS55	Pandoravirus	34.1	3.0e-29
WP_012951789.1|131501_132101_-	short chain dehydrogenase	NA	NA	NA	NA	NA
WP_012951788.1|132188_133901_-	fibronectin/fibrinogen-binding protein	NA	Q84500	Paramecium_bursaria_Chlorella_virus	36.6	3.4e-06
WP_003723072.1|134057_134933_+	YicC family protein	NA	NA	NA	NA	NA
WP_003723071.1|134951_135569_+	guanylate kinase	NA	S4W1R9	Pandoravirus	32.9	1.0e-13
WP_003728294.1|135568_135772_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_003733092.1|135926_137126_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	31.7	1.7e-41
WP_003733093.1|137130_139524_+	primosomal protein N'	NA	NA	NA	NA	NA
WP_012951786.1|139537_140476_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	37.9	4.3e-11
WP_012951785.1|140476_141811_+	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_003723065.1|141833_142592_+	Stp1/IreP family PP2C-type Ser/Thr phosphatase	NA	NA	NA	NA	NA
WP_003723064.1|142588_144556_+	Stk1 family PASTA domain-containing Ser/Thr kinase	NA	A0A2H4UVE2	Bodo_saltans_virus	33.2	2.1e-23
>prophage 13
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	155928	157895	2989591		Acanthamoeba_polyphaga_mimivirus(33.33%)	3	NA	NA
WP_003723867.1|155928_156672_+	3-oxoacyl-[acyl-carrier-protein] reductase	NA	A0A0G2Y924	Acanthamoeba_polyphaga_mimivirus	31.8	3.3e-06
WP_003723866.1|156778_157012_+	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	39.3	1.7e-06
WP_012951781.1|157205_157895_+	ribonuclease III	NA	J2YAN1	Acanthamoeba_polyphaga_lentillevirus	31.2	1.5e-24
>prophage 14
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	178229	183941	2989591		Agrobacterium_phage(25.0%)	9	NA	NA
WP_010958948.1|178229_178745_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	38.7	4.1e-16
WP_003720098.1|178766_178967_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_003720097.1|179006_179366_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_003733284.1|179406_180162_-	exodeoxyribonuclease III	NA	E3T4M6	Cafeteria_roenbergensis_virus	47.7	6.8e-60
WP_003733285.1|180245_180776_+	DUF1697 domain-containing protein	NA	NA	NA	NA	NA
WP_012951774.1|180833_182066_+	peptidase T	NA	NA	NA	NA	NA
WP_009925961.1|182084_182447_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009930637.1|182496_183270_-	ABC transporter ATP-binding protein	NA	F2Y302	Organic_Lake_phycodnavirus	29.5	8.4e-13
WP_003723983.1|183335_183941_+	HD domain-containing protein	NA	A0A1D6Y7U0	Golden_Marseillevirus	25.9	4.9e-08
>prophage 15
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	190060	201505	2989591		Synechococcus_phage(25.0%)	11	NA	NA
WP_003722253.1|190060_190549_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	42.0	8.1e-22
WP_003733237.1|190541_191666_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_003729814.1|191684_192977_+	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	33.0	2.5e-17
WP_012951773.1|193057_193771_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3F9V5	Synechococcus_phage	38.3	1.2e-42
WP_003722248.1|193782_194028_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_003722247.1|194031_194715_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_012951772.1|194707_196927_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	41.1	5.0e-159
WP_003722245.1|196911_198339_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	34.6	1.1e-53
WP_012951771.1|198357_199407_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	43.5	4.6e-62
WP_003722243.1|199403_199970_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	35.9	7.0e-25
WP_003722242.1|199975_201505_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	49.3	3.8e-73
>prophage 16
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	205845	210081	2989591		Bacillus_phage(50.0%)	2	NA	NA
WP_072215745.1|205845_208041_+	DNA helicase PcrA	NA	A7KV33	Bacillus_phage	41.5	2.9e-135
WP_003722235.1|208065_210081_+	NAD-dependent DNA ligase LigA	NA	A0A0A8J9A9	Ralstonia_phage	38.8	1.8e-115
>prophage 17
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	214668	220910	2989591		Catovirus(33.33%)	7	NA	NA
WP_003722230.1|214668_215601_+	diacylglycerol kinase	NA	A0A1V0SBJ0	Catovirus	30.6	1.4e-17
WP_003722229.1|215748_216504_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012951767.1|216527_217889_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	50.1	1.9e-121
WP_003722227.1|218223_218778_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003722226.1|218808_219282_-	shikimate kinase	NA	NA	NA	NA	NA
WP_003722225.1|219505_220015_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009926027.1|220142_220910_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.7	5.4e-28
>prophage 18
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	226824	232097	2989591		Feldmannia_irregularis_virus(33.33%)	6	NA	NA
WP_003722218.1|226824_227865_+	sensor histidine kinase	NA	Q6XLV6	Feldmannia_irregularis_virus	28.7	3.4e-09
WP_003729791.1|228262_228904_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_012951762.1|228914_229562_+	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.8	2.4e-29
WP_010989800.1|229563_230379_+	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010989799.1|230469_231576_+	iron-containing alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_009932115.1|231578_232097_+	N-acetyltransferase	NA	A0A1P8CWJ6	Bacillus_phage	41.6	1.6e-28
>prophage 19
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	250736	253551	2989591		Amsacta_moorei_entomopoxvirus(50.0%)	3	NA	NA
WP_003722201.1|250736_251417_+	ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	34.2	4.6e-15
WP_003722200.1|251409_252183_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003722199.1|252225_253551_+	DEAD/DEAH box helicase	NA	A0A1V0SBR7	Catovirus	30.0	3.2e-36
>prophage 20
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	267590	272140	2989591		Lactobacillus_virus(33.33%)	7	NA	NA
WP_012951751.1|267590_268235_-	deoxynucleoside kinase	NA	Q5ULP7	Lactobacillus_virus	44.4	1.4e-42
WP_003733117.1|268341_268722_+	OsmC family protein	NA	NA	NA	NA	NA
WP_003733116.1|268786_270166_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	38.9	3.7e-88
WP_012951695.1|270180_270582_+	FosX/FosE/FosI family fosfomycin resistance thiol transferase	NA	NA	NA	NA	NA
WP_012951694.1|270610_270964_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003724102.1|271003_271210_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003733114.1|271237_272140_-	PAS domain S-box protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	45.2	7.8e-10
>prophage 21
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	279463	282985	2989591		Clostridium_botulinum_D_phage(50.0%)	4	NA	NA
WP_009924860.1|279463_279925_+	dUTP diphosphatase	NA	Q2WG49	Clostridium_botulinum_D_phage	58.3	5.1e-42
WP_003723878.1|279956_280937_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_072215809.1|281137_282235_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_003723876.1|282238_282985_+	enoyl-[acyl-carrier-protein] reductase FabL	NA	Q06VL0	Trichoplusia_ni_ascovirus	27.3	1.3e-10
>prophage 22
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	299013	301303	2989591		Pandoravirus(100.0%)	2	NA	NA
WP_003733294.1|299013_300138_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	A0A0B5JD48	Pandoravirus	30.8	7.4e-18
WP_012951690.1|300130_301303_+	cystathionine beta-lyase	NA	A0A0B5JD48	Pandoravirus	26.5	5.0e-17
>prophage 23
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	309085	312430	2989591		Staphylococcus_phage(100.0%)	4	NA	NA
WP_012951688.1|309085_310495_+	o-succinylbenzoate--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	33.7	1.7e-67
WP_012951687.1|310513_311467_-	zinc ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003723261.1|311616_311883_-	membrane protein insertion efficiency factor YidD	NA	NA	NA	NA	NA
WP_003723260.1|311956_312430_+	nucleoside triphosphatase YtkD	NA	A0A2H4PQM4	Staphylococcus_phage	42.4	5.7e-20
>prophage 24
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	319643	327223	2989591	tRNA	Staphylococcus_phage(80.0%)	5	NA	NA
WP_012951684.1|319643_320843_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	70.0	6.6e-150
WP_009930749.1|320979_322845_+	asparagine synthase (glutamine-hydrolyzing)	NA	A0A1V0SGM7	Hokovirus	29.4	1.8e-37
WP_012951683.1|322870_323446_-	methyltransferase domain-containing protein	NA	A0A2H4PQV0	Staphylococcus_phage	45.5	2.7e-40
WP_008948020.1|323442_324408_-	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	64.2	3.1e-49
WP_031645484.1|324811_327223_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	70.4	0.0e+00
>prophage 25
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	333991	337550	2989591		Bacillus_phage(100.0%)	2	NA	NA
WP_014600887.1|333991_335761_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	30.6	2.1e-51
WP_003723513.1|335744_337550_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.5	7.9e-46
>prophage 26
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	344395	347614	2989591		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_038406020.1|344395_347614_+	DEAD/DEAH box helicase family protein	NA	A0A1B1ISM1	uncultured_Mediterranean_phage	27.0	2.1e-33
>prophage 27
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	354719	355640	2989591		Staphylococcus_phage(100.0%)	1	NA	NA
WP_003733218.1|354719_355640_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	38.7	1.5e-37
>prophage 28
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	361319	363671	2989591		Acinetobacter_phage(100.0%)	3	NA	NA
WP_012951669.1|361319_361925_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	46.4	1.7e-40
WP_012951668.1|361896_362916_+	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	36.8	3.6e-56
WP_012951667.1|362912_363671_+	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	38.3	2.5e-33
>prophage 29
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	382051	386136	2989591		Staphylococcus_phage(50.0%)	3	NA	NA
WP_003732542.1|382051_382852_+	DUF1444 domain-containing protein	NA	A0A2H4PQY3	Staphylococcus_phage	58.6	1.9e-36
WP_012951663.1|382857_383475_+	DUF4479 domain-containing protein	NA	NA	NA	NA	NA
WP_012951662.1|383784_386136_+	DNA translocase FtsK	NA	Q853W3	Mycobacterium_phage	52.0	1.0e-90
>prophage 30
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	392413	395002	2989591	tRNA	Enterobacteria_phage(50.0%)	2	NA	NA
WP_003727369.1|392413_393421_+	catabolite control protein A	NA	C6ZCU4	Enterobacteria_phage	27.7	1.4e-20
WP_003727370.1|393742_395002_+|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	44.4	2.5e-91
>prophage 31
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	405531	409666	2989591		Mycobacterium_phage(33.33%)	4	NA	NA
WP_003723317.1|405531_406692_+	acetylornithine transaminase	NA	A0A249XSK4	Mycobacterium_phage	25.3	2.5e-13
WP_010989752.1|406688_407639_+	ornithine carbamoyltransferase	NA	A0A1J0F9B8	Only_Syngen_Nebraska_virus	26.6	3.7e-18
WP_003723315.1|407670_408474_-	NAD kinase	NA	NA	NA	NA	NA
WP_010989751.1|408652_409666_+	signal peptide peptidase SppA	NA	F8QZT1	Wolbachia_phage	31.2	2.5e-17
>prophage 32
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	418406	422790	2989591		Bacillus_virus(50.0%)	2	NA	NA
WP_010989747.1|418406_419342_+	bifunctional oligoribonuclease/PAP phosphatase NrnA	NA	G3MA01	Bacillus_virus	24.8	8.9e-17
WP_010989746.1|419463_422790_+	DNA polymerase III subunit alpha	NA	A0A1C9LWZ5	Streptomyces_phage	30.6	1.5e-146
>prophage 33
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	430410	441059	2989591	tRNA	Phage_21(20.0%)	8	NA	NA
WP_010989744.1|430410_431673_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	64.2	1.7e-10
WP_003723249.1|431838_434466_+	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	32.5	7.7e-50
WP_010989743.1|434489_435311_+	DNA-formamidopyrimidine glycosylase	NA	G3MA33	Bacillus_virus	35.5	3.1e-34
WP_009926374.1|435327_435930_+	dephospho-CoA kinase	NA	NA	NA	NA	NA
WP_003723246.1|436007_436472_+	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_010989742.1|436477_437854_+	helicase DnaB	NA	NA	NA	NA	NA
WP_003732568.1|437863_438787_+	primosomal protein DnaI	NA	S5MU12	Brevibacillus_phage	28.9	6.2e-31
WP_012951649.1|439136_441059_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	34.2	1.0e-104
>prophage 34
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	447433	450085	2989591	tRNA	Catovirus(100.0%)	1	NA	NA
WP_012951647.1|447433_450085_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	41.9	9.2e-160
>prophage 35
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	459557	459875	2989591	protease	Enterococcus_phage(100.0%)	1	NA	NA
WP_003732583.1|459557_459875_+|protease	ribosomal-processing cysteine protease Prp	protease	D2J003	Enterococcus_phage	31.4	1.4e-06
>prophage 36
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	467881	503793	2989591	tRNA	Bacillus_phage(33.33%)	29	NA	NA
WP_003723536.1|467881_468889_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	24.7	1.6e-08
WP_012951644.1|468892_469921_+|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_003723534.1|470007_471147_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	45.4	2.2e-86
WP_003723533.1|471180_471510_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	42.5	1.4e-09
WP_003723532.1|471652_471943_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012951643.1|472043_474308_+	protein translocase subunit SecDF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	31.2	9.3e-20
WP_003723530.1|474403_474748_+	DUF1049 domain-containing protein	NA	NA	NA	NA	NA
WP_003733816.1|474853_477205_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	32.6	3.3e-84
WP_003723528.1|477194_477716_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	44.8	2.5e-29
WP_003723527.1|477921_480138_+	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	S4TRQ0	Salmonella_phage	40.5	4.0e-07
WP_003723526.1|480153_480606_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_003723525.1|480642_481926_-	SH3 domain-containing protein	NA	A0A067ZJB6	Vibrio_phage	35.5	3.1e-20
WP_003730164.1|482376_483654_+|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_003723523.1|483656_485432_+|tRNA	aspartate--tRNA ligase	tRNA	A0A1V0SJ84	Klosneuvirus	24.6	1.1e-12
WP_003727404.1|485470_485851_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003723521.1|486000_486366_-	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_003723520.1|486379_487585_-	ammonium transporter	NA	NA	NA	NA	NA
WP_003732594.1|487829_488252_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_003723700.1|488400_489684_+	replication-associated recombination protein A	NA	A0A127AWE7	Bacillus_phage	50.7	1.2e-112
WP_010990149.1|490063_491212_+	cysteine desulfurase	NA	H7BUW1	unidentified_phage	38.1	5.8e-34
WP_003723698.1|491230_492346_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_012951642.1|492463_493204_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_010990147.1|493244_493883_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_012951641.1|493910_496307_+	ATP-dependent RecD-like DNA helicase	NA	A0A1P8DII4	Virus_Rctr197k	32.6	9.8e-44
WP_010990146.1|496348_497788_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	33.1	5.0e-35
WP_003723693.1|497784_498471_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.1	3.1e-35
WP_012951640.1|498637_500143_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_012951639.1|500151_500847_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_025370604.1|501153_503793_+|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L3D8	Tupanvirus	33.8	1.4e-67
>prophage 37
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	507558	508188	2989591		Tupanvirus(100.0%)	1	NA	NA
WP_003722006.1|507558_508188_+	uridine kinase	NA	A0A2K9L178	Tupanvirus	37.6	7.3e-31
>prophage 38
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	519379	525695	2989591		Bacillus_phage(33.33%)	5	NA	NA
WP_012951630.1|519379_519940_+	ComE operon protein 2	NA	A0A127AWN5	Bacillus_phage	57.5	3.8e-31
WP_012951629.1|519974_522197_+	DNA internalization-related competence protein ComEC/Rec2	NA	Q332C0	Clostridium_botulinum_C_phage	37.0	4.8e-37
WP_012951628.1|522264_523296_+	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_003726526.1|523381_523636_-	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_003721987.1|523868_525695_+	elongation factor 4	NA	A0A1S5SF82	Streptococcus_phage	23.9	6.2e-22
>prophage 39
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	530399	537285	2989591		Catovirus(50.0%)	7	NA	NA
WP_003721980.1|530399_532241_+	molecular chaperone DnaK	NA	A0A1V0SAK3	Catovirus	46.7	6.2e-139
WP_010990134.1|532382_533516_+	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	27.2	1.1e-26
WP_010990133.1|533588_534533_+	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_012951624.1|534533_535301_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_003719762.1|535498_535672_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_003736634.1|535691_536138_+	GatB/YqeY domain-containing protein	NA	G3MAQ0	Bacillus_virus	38.5	1.6e-16
WP_012951623.1|536325_537285_+	PhoH family protein	NA	L7TP00	Rhizobium_phage	48.1	1.5e-48
>prophage 40
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	547973	551073	2989591		Caulobacter_phage(50.0%)	2	NA	NA
WP_003721961.1|547973_549854_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	36.4	5.9e-60
WP_003721960.1|549948_551073_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	37.6	8.4e-38
>prophage 41
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	554149	558223	2989591		Diachasmimorpha_longicaudata_entomopoxvirus(33.33%)	4	NA	NA
WP_003721956.1|554149_555457_+	DEAD-box ATP-dependent RNA helicase CshB	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	30.7	4.8e-45
WP_012951618.1|555471_556365_+	deoxyribonuclease IV	NA	A0A2H4UU70	Bodo_saltans_virus	32.7	5.7e-21
WP_003727434.1|556380_557307_+	manganese-dependent inorganic pyrophosphatase	NA	NA	NA	NA	NA
WP_010990125.1|557449_558223_+	metal ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.6	3.1e-15
>prophage 42
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	563964	564573	2989591		Bacillus_thuringiensis_phage(100.0%)	1	NA	NA
WP_003732335.1|563964_564573_+	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	58.6	1.4e-68
>prophage 43
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	574085	578505	2989591	holin	Tupanvirus(50.0%)	4	NA	NA
WP_003721936.1|574085_575687_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	26.5	1.9e-51
WP_009926352.1|575826_576210_+	MmcQ/YjbR family DNA-binding protein	NA	NA	NA	NA	NA
WP_012951614.1|576458_577019_+	energy-coupled thiamine transporter ThiT	NA	NA	NA	NA	NA
WP_003725371.1|577311_578505_+|holin	betaine/proline/choline family ABC transporter ATP-binding protein	holin	F2Y1V5	Organic_Lake_phycodnavirus	29.6	3.2e-11
>prophage 44
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	598862	607321	2989591		Enterobacter_phage(25.0%)	5	NA	NA
WP_003721912.1|598862_599609_-	pyruvate formate lyase-activating protein	NA	E5DI79	Enterobacter_phage	35.3	2.5e-06
WP_003721911.1|599685_601917_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	43.4	2.5e-182
WP_003721910.1|602342_602891_-	glycerol-3-phosphate responsive antiterminator	NA	NA	NA	NA	NA
WP_012951605.1|602907_604719_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	34.6	1.5e-73
WP_010990113.1|604738_607321_-	DNA mismatch repair protein MutS	NA	A0A1V0SC35	Catovirus	24.9	8.7e-38
>prophage 45
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	611092	612139	2989591		Bacillus_phage(100.0%)	1	NA	NA
WP_003732286.1|611092_612139_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	68.5	6.0e-131
>prophage 46
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	617462	628488	2989591		Streptococcus_phage(50.0%)	8	NA	NA
WP_012951601.1|617462_618755_-	insulinase family protein	NA	A0A1X9I714	Streptococcus_phage	30.8	2.5e-54
WP_003723916.1|618872_619823_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003723915.1|619819_620872_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003732280.1|620864_622406_-	ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	29.3	2.0e-13
WP_003722514.1|622838_623912_-	BMP family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003722513.1|624263_625103_+	pyrroline-5-carboxylate reductase	NA	NA	NA	NA	NA
WP_012951599.1|625136_627410_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.0	2.4e-84
WP_003727465.1|627561_628488_-	YitT family protein	NA	M1Q1P6	Streptococcus_phage	31.0	5.0e-28
>prophage 47
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	632879	636617	2989591		Bacillus_phage(66.67%)	3	NA	NA
WP_003727467.1|632879_634331_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	27.7	1.4e-24
WP_003719652.1|634327_635008_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	32.3	8.7e-30
WP_003722503.1|635198_636617_-	NADP-dependent phosphogluconate dehydrogenase	NA	A0A0P0C6S9	Ostreococcus_lucimarinus_virus	28.9	3.5e-41
>prophage 48
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	650342	654068	2989591		Lactococcus_phage(33.33%)	5	NA	NA
WP_003719639.1|650342_650543_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	75.8	1.3e-21
WP_003732268.1|650741_651623_-	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_003722489.1|651625_651853_-	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_012951590.1|651842_653195_-	exodeoxyribonuclease VII large subunit	NA	A0A1B3AYB4	Gordonia_phage	34.5	2.7e-30
WP_003722487.1|653213_654068_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	40.9	3.5e-36
>prophage 49
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	660628	663438	2989591		Prochlorococcus_phage(100.0%)	2	NA	NA
WP_003722477.1|660628_662095_-	glycine dehydrogenase subunit 2	NA	E3ST28	Prochlorococcus_phage	43.0	2.1e-89
WP_012951589.1|662091_663438_-	aminomethyl-transferring glycine dehydrogenase subunit GcvPA	NA	E3SN07	Prochlorococcus_phage	39.0	2.6e-62
>prophage 50
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	678859	754095	2989591	protease,tRNA	Streptococcus_phage(18.18%)	70	NA	NA
WP_012951584.1|678859_679804_-	bifunctional riboflavin kinase/FAD synthetase	NA	A0A1V0SD03	Indivirus	33.3	1.8e-09
WP_012951583.1|679873_680788_-|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_003719600.1|680881_681226_-	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_003722457.1|681242_681521_-	DUF503 domain-containing protein	NA	NA	NA	NA	NA
WP_003732820.1|681517_683863_-	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	23.4	3.0e-21
WP_003732819.1|683885_684185_-	YlxQ family RNA-binding protein	NA	NA	NA	NA	NA
WP_003722454.1|684177_684462_-	YlxR family protein	NA	NA	NA	NA	NA
WP_003722453.1|684476_685595_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_003732818.1|685624_686092_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_003732817.1|686273_690608_-	DNA polymerase III subunit alpha	NA	A0A0A7RWA3	Clostridium_phage	35.1	8.6e-22
WP_003732816.1|690712_692419_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_003723454.1|692458_693721_-|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
WP_010989733.1|693734_694877_-	1-deoxy-D-xylulose-5-phosphate reductoisomerase	NA	NA	NA	NA	NA
WP_003732813.1|694891_695680_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_003732812.1|695693_696452_-	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	42.1	4.4e-22
WP_003723450.1|696681_697239_-	ribosome recycling factor	NA	NA	NA	NA	NA
WP_003723449.1|697238_697967_-	UMP kinase	NA	NA	NA	NA	NA
WP_003723448.1|698259_698634_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072217143.1|698611_699817_+	helicase SNF2	NA	L0P6E9	Lactobacillus_phage	47.1	3.7e-92
WP_003723446.1|699806_701111_+	DUF3440 domain-containing protein	NA	A0A220GKF8	Streptococcus_phage	52.1	9.5e-134
WP_003723445.1|701120_701627_+	ParB-like nuclease domain-containing protein	NA	A0A220GKT8	Streptococcus_phage	66.7	4.0e-56
WP_003723443.1|702398_703241_+	DUF2785 domain-containing protein	NA	NA	NA	NA	NA
WP_003723442.1|703291_703531_-	YneF family protein	NA	NA	NA	NA	NA
WP_003732809.1|703751_705746_-	transketolase	NA	NA	NA	NA	NA
WP_003723440.1|705892_706120_-	DUF896 domain-containing protein	NA	NA	NA	NA	NA
WP_003723439.1|706211_706541_-	cell division suppressor protein YneA	NA	NA	NA	NA	NA
WP_003723438.1|706698_707313_+	transcriptional repressor LexA	NA	A0A1B2APZ1	Phage_Wrath	62.1	9.3e-15
WP_003723437.1|707342_707864_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_012951579.1|707907_709203_-	arsenic transporter	NA	A0A2H4PQU3	Staphylococcus_phage	61.9	2.8e-146
WP_003723435.1|709346_710681_-	type I glutamate--ammonia ligase	NA	A0A1V0SJ53	Klosneuvirus	26.4	2.0e-06
WP_003719570.1|710751_711120_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010989728.1|711322_712549_-	methionine gamma-lyase family protein	NA	NA	NA	NA	NA
WP_003733804.1|712541_713765_-	GTPase HflX	NA	NA	NA	NA	NA
WP_003719566.1|713875_714109_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_012951578.1|714231_715149_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_003723738.1|715274_716951_-	glycerol-3-phosphate dehydrogenase/oxidase	NA	NA	NA	NA	NA
WP_012951577.1|717183_717882_-	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	32.4	9.9e-13
WP_012951576.1|718094_719963_+	acetyltransferase	NA	B5WZU0	Pseudomonas_phage	31.9	6.5e-43
WP_012951575.1|719996_721793_-	class 1 internalin InlK	NA	NA	NA	NA	NA
WP_012951574.1|722124_723858_-	LapB repeat-containing protein	NA	NA	NA	NA	NA
WP_009913867.1|724184_724652_-	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
WP_010989723.1|724734_727194_-	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	31.6	4.7e-102
WP_003723731.1|727190_729158_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	42.5	6.7e-123
WP_003732802.1|729338_729746_-	CoA-binding protein	NA	NA	NA	NA	NA
WP_003724132.1|729903_730500_+	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_009932949.1|730541_731414_-	aldose 1-epimerase family protein	NA	NA	NA	NA	NA
WP_003724130.1|731416_731728_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012951573.1|731750_732170_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_003726695.1|732272_733052_-	GTP-sensing pleiotropic transcriptional regulator CodY	NA	NA	NA	NA	NA
WP_003732800.1|733072_734482_-|protease	ATP-dependent protease ATPase subunit HslU	protease	W6AS21	Erwinia_phage	28.7	3.7e-43
WP_003724001.1|734495_735035_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_009911635.1|735055_735958_-	tyrosine recombinase XerC	NA	A0A097EYL9	Mycobacterium_phage	28.6	1.2e-13
WP_009924616.1|736240_737545_-|tRNA	FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))- methyltransferase TrmFO	tRNA	NA	NA	NA	NA
WP_012951572.1|737607_739686_-	type I DNA topoisomerase	NA	A0A1V0SB35	Catovirus	37.5	3.2e-107
WP_003723892.1|739957_740818_-	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_003723891.1|740951_741737_-	ribonuclease HII	NA	G4YAY0	Emiliania_huxleyi_virus	39.2	3.0e-26
WP_003723890.1|741733_742597_-	ribosome biogenesis GTPase YlqF	NA	NA	NA	NA	NA
WP_003723889.1|742606_743149_-	type I signal peptidase SipZ	NA	NA	NA	NA	NA
WP_009924619.1|743250_743820_-	type I signal peptidase SipY	NA	NA	NA	NA	NA
WP_003723887.1|743854_744421_-	type I signal peptidase SipX	NA	NA	NA	NA	NA
WP_003723886.1|744539_745799_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	63.2	1.4e-145
WP_003723884.1|745983_747267_-	trigger factor	NA	NA	NA	NA	NA
WP_003732796.1|747381_748320_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003732795.1|748581_749247_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010989719.1|749264_749798_-|protease	matrixin family metalloprotease	protease	NA	NA	NA	NA
WP_003727524.1|749916_750132_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003723563.1|750282_750678_+	helix-turn-helix transcriptional regulator	NA	A9D9J6	Lactobacillus_prophage	57.4	1.3e-14
WP_003723562.1|750758_751898_+|protease	PrsW family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003723561.1|752033_752864_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	42.4	4.3e-47
WP_003723560.1|752847_754095_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	51.8	1.2e-106
>prophage 51
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	765247	767675	2989591		Diachasmimorpha_longicaudata_entomopoxvirus(50.0%)	3	NA	NA
WP_010989717.1|765247_766660_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	31.8	8.3e-51
WP_003723543.1|766783_767044_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009924169.1|767075_767675_-	histidine phosphatase family protein	NA	A0A1X9IGJ2	Lactococcus_phage	41.0	5.8e-30
>prophage 52
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	771040	812640	2989591	protease,capsid,terminase,integrase,tail,holin,portal	Listeria_phage(97.62%)	53	770754:770775	812736:812757
770754:770775	attL	ATATTACGTCCTGAGAGGGATT	NA	NA	NA	NA
WP_012951563.1|771040_771274_-	hypothetical protein	NA	A8ATC5	Listeria_phage	98.7	1.6e-36
WP_012951561.1|771714_771897_+	hypothetical protein	NA	A0A059T7Z0	Listeria_phage	96.6	2.3e-22
WP_038406024.1|772149_772449_-	STAS-like domain-containing protein	NA	NA	NA	NA	NA
WP_120137519.1|772442_773354_-	ATP-binding protein	NA	J7KDG8	Streptococcus_phage	30.1	1.2e-31
WP_038406027.1|773503_774349_-	peptidase M15	NA	A0A059T7Y8	Listeria_phage	85.2	1.4e-133
WP_038406028.1|774348_774615_-|holin	phage holin	holin	A0A059T684	Listeria_phage	94.3	1.5e-38
WP_012951557.1|774614_774917_-	hypothetical protein	NA	A0A059T5E6	Listeria_phage	93.0	1.7e-38
WP_038406029.1|774964_776065_-	hypothetical protein	NA	A0A059T7R4	Listeria_phage	87.7	1.1e-183
WP_038406030.1|776054_778349_-	hypothetical protein	NA	A0A059T7Y6	Listeria_phage	95.9	0.0e+00
WP_038406031.1|778361_780011_-|tail	phage tail protein	tail	A0A059T682	Listeria_phage	99.5	0.0e+00
WP_038406033.1|780007_784924_-|tail	phage tail tape measure protein	tail	A0A059T5F4	Listeria_phage	95.7	0.0e+00
WP_023548918.1|785139_785472_-	hypothetical protein	NA	A8ATA5	Listeria_phage	97.3	4.3e-51
WP_003731641.1|785543_786131_-|tail	phage tail protein	tail	A8ATA4	Listeria_phage	99.0	9.9e-107
WP_003731642.1|786152_786536_-	hypothetical protein	NA	A8ATA3	Listeria_phage	99.2	8.5e-67
WP_003731643.1|786532_786934_-	hypothetical protein	NA	A8ATA2	Listeria_phage	100.0	2.1e-68
WP_003731644.1|786930_787296_-	hypothetical protein	NA	A8ATA1	Listeria_phage	100.0	1.3e-64
WP_003731645.1|787279_787579_-	hypothetical protein	NA	A8ATA0	Listeria_phage	100.0	5.3e-48
WP_038406034.1|787765_788917_-|capsid	phage major capsid protein	capsid	A0A059T678	Listeria_phage	93.2	2.3e-200
WP_023548924.1|788943_789741_-|protease	Clp protease ClpP	protease	A0A059T5F2	Listeria_phage	95.1	1.2e-136
WP_023552368.1|789737_790868_-|portal	phage portal protein	portal	A8AT96	Listeria_phage	93.1	2.2e-203
WP_023552366.1|790879_792523_-|terminase	terminase large subunit	terminase	A8AT95	Listeria_phage	98.7	0.0e+00
WP_031646261.1|792519_792876_-	hypothetical protein	NA	A8AT94	Listeria_phage	98.0	2.6e-46
WP_038406036.1|792924_793239_-	HNH endonuclease	NA	A8ATF8	Listeria_phage	98.1	1.5e-56
WP_012951542.1|793734_794478_-	DUF559 domain-containing protein	NA	NA	NA	NA	NA
WP_003731654.1|794575_795001_-	DUF722 domain-containing protein	NA	A0A059T6H4	Listeria_phage	99.3	1.8e-73
WP_003731655.1|795013_795241_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038406037.1|795485_795755_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038406038.1|795751_796291_-	DUF3310 domain-containing protein	NA	A8ATF5	Listeria_phage	78.9	4.9e-76
WP_020830767.1|796738_796951_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012951539.1|796952_797270_-	VRR-NUC domain-containing protein	NA	A8ATF4	Listeria_phage	89.3	7.3e-48
WP_038406039.1|797597_799871_-	DNA primase	NA	R4IBW2	Listeria_phage	95.8	0.0e+00
WP_023553839.1|799893_800379_-	DUF669 domain-containing protein	NA	R4ICE5	Listeria_phage	98.8	1.1e-87
WP_074471730.1|800403_801645_-	DEAD/DEAH box helicase	NA	A8ATF1	Listeria_phage	96.1	1.2e-213
WP_012951536.1|801723_802413_-	AAA family ATPase	NA	R4IDY8	Listeria_phage	96.9	3.1e-128
WP_003731665.1|802432_802912_-	siphovirus Gp157 family protein	NA	R4IBM0	Listeria_phage	76.7	7.6e-57
WP_012951535.1|802913_803297_-	hypothetical protein	NA	A8ATE8	Listeria_phage	92.9	5.3e-61
WP_038406040.1|803463_803643_-	hypothetical protein	NA	A8ATE3	Listeria_phage	78.0	1.2e-18
WP_038406041.1|803639_804083_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012951528.1|804085_804319_-	DUF1642 domain-containing protein	NA	B6D7L5	Listeria_phage	55.6	6.8e-11
WP_012951527.1|804315_804996_-	hypothetical protein	NA	A8ATD7	Listeria_phage	95.6	9.0e-120
WP_012951526.1|805008_805953_-|integrase	site-specific integrase	integrase	A8ATD6	Listeria_phage	97.8	1.1e-176
WP_038406042.1|805963_806677_-	SAM-dependent DNA methyltransferase	NA	A8ATD5	Listeria_phage	98.3	9.1e-131
WP_158423219.1|806890_807103_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038406044.1|807478_807664_-	hypothetical protein	NA	A0A059T7Z3	Listeria_phage	86.9	3.9e-25
WP_038406045.1|807666_807909_-	hypothetical protein	NA	A8ATD2	Listeria_phage	92.5	4.3e-40
WP_003730995.1|807930_808122_-	helix-turn-helix transcriptional regulator	NA	A0A059T5F8	Listeria_phage	87.1	5.4e-22
WP_009931099.1|808136_808460_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031660120.1|808528_809125_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049963070.1|809199_809382_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012951519.1|809650_809974_+	helix-turn-helix transcriptional regulator	NA	R4IDX0	Listeria_phage	75.7	6.3e-39
WP_026747145.1|809990_810443_+	ImmA/IrrE family metallo-endopeptidase	NA	R4IBK9	Listeria_phage	87.3	9.1e-76
WP_014930257.1|810494_811358_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012951516.1|811485_812640_+|integrase	site-specific integrase	integrase	A0A059T688	Listeria_phage	95.8	1.6e-209
812736:812757	attR	ATATTACGTCCTGAGAGGGATT	NA	NA	NA	NA
>prophage 53
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	819648	826823	2989591		Staphylococcus_phage(25.0%)	7	NA	NA
WP_003723853.1|819648_819960_-	thioredoxin	NA	A0A1X9I9P5	Staphylococcus_phage	39.6	5.4e-19
WP_010989713.1|820040_822398_-	endonuclease MutS2	NA	Q94M10	Lactobacillus_phage	50.4	1.0e-21
WP_003723851.1|822420_824133_-	DNA polymerase/3'-5' exonuclease PolX	NA	A0A2H4UV14	Bodo_saltans_virus	24.8	5.1e-18
WP_012951513.1|824225_824768_-	CvpA family protein	NA	NA	NA	NA	NA
WP_003740576.1|824767_825031_-	cell division protein ZapA	NA	NA	NA	NA	NA
WP_072215733.1|825184_826111_+	ribonuclease HIII	NA	NA	NA	NA	NA
WP_003732773.1|826148_826823_-	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	47.7	7.5e-50
>prophage 54
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	834119	838442	2989591	tRNA	Planktothrix_phage(50.0%)	3	NA	NA
WP_003721621.1|834119_834821_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.8	3.0e-33
WP_012951511.1|834981_837390_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_003736387.1|837389_838442_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	34.9	1.3e-29
>prophage 55
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	841668	845587	2989591		Clostridium_phage(33.33%)	5	NA	NA
WP_010989709.1|841668_842655_-	GW domain-containing glycosaminoglycan-binding protein	NA	A0A0A7RU71	Clostridium_phage	42.8	1.1e-25
WP_003734016.1|842951_843821_-	GW domain-containing glycosaminoglycan-binding protein	NA	S5M633	Brevibacillus_phage	51.6	8.5e-38
WP_003721612.1|844160_844712_-	DUF2812 domain-containing protein	NA	NA	NA	NA	NA
WP_003724743.1|844714_845026_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012951510.1|845056_845587_-	AAA family ATPase	NA	A0A097BYE2	Leuconostoc_phage	35.3	2.9e-09
>prophage 56
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	848715	849522	2989591		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_003721605.1|848715_849522_-	ATP-binding cassette domain-containing protein	NA	A0A2I4R674	Erysipelothrix_phage	28.3	2.0e-09
>prophage 57
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	906472	907045	2989591	protease	Salicola_phage(100.0%)	1	NA	NA
WP_003721539.1|906472_907045_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A248SJ97	Salicola_phage	37.6	4.7e-29
>prophage 58
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	911602	914966	2989591		Bodo_saltans_virus(50.0%)	2	NA	NA
WP_009932493.1|911602_913249_-	ABC transporter ATP-binding protein	NA	A0A2H4UU96	Bodo_saltans_virus	28.6	1.6e-16
WP_012951476.1|913250_914966_-	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	23.2	2.3e-18
>prophage 59
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	934179	943732	2989591		Hokovirus(28.57%)	9	NA	NA
WP_012951455.1|934179_936093_-	site-specific DNA-methyltransferase	NA	A0A2K5B2C1	Erysipelothrix_phage	36.9	1.3e-59
WP_012951454.1|936310_937867_-	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	28.1	3.0e-17
WP_003730540.1|937995_938400_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_012951453.1|938459_938768_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_003727000.1|938780_939605_-	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	52.6	9.7e-68
WP_003721509.1|939616_941107_-	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	49.7	9.5e-114
WP_010989660.1|941315_942329_-	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	32.0	7.9e-11
WP_003732709.1|942343_943327_-	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	34.6	4.1e-12
WP_003721506.1|943348_943732_-	glycerol-3-phosphate cytidylyltransferase	NA	A0A1V0SGE7	Hokovirus	40.7	1.4e-16
>prophage 60
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	949731	952164	2989591		Enterobacteria_phage(66.67%)	3	NA	NA
WP_003721500.1|949731_950718_-	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	46.8	4.7e-77
WP_003721499.1|950718_951279_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	44.8	1.1e-38
WP_003721498.1|951297_952164_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	62.5	7.5e-103
>prophage 61
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	957233	962948	2989591		Bacillus_phage(66.67%)	4	NA	NA
WP_003721495.1|957233_958106_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	50.2	4.5e-79
WP_003721494.1|958147_959836_-	glycosyl transferase group 2	NA	NA	NA	NA	NA
WP_003732702.1|960051_961770_-	GW domain-containing glycosaminoglycan-binding protein	NA	Q9ZXE4	Bacillus_phage	44.1	4.3e-17
WP_003722702.1|961946_962948_-	teichoic acids export ABC transporter ATP-binding subunit TagH	NA	A0A2H4PQG7	Staphylococcus_phage	27.4	2.1e-16
>prophage 62
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	972006	984988	2989591		Streptococcus_phage(25.0%)	13	NA	NA
WP_003722695.1|972006_973845_-	translational GTPase TypA	NA	A0A1S5SF82	Streptococcus_phage	24.2	7.3e-23
WP_003722694.1|974036_974810_-	inositol monophosphatase family protein	NA	NA	NA	NA	NA
WP_003722693.1|974940_975555_+	YktB family protein	NA	NA	NA	NA	NA
WP_003722692.1|975755_976700_+	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_003722690.1|976766_977435_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.0	3.7e-25
WP_012951447.1|977447_978869_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003734007.1|978955_980401_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_003722687.1|980375_981038_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.7	2.8e-33
WP_003722686.1|981179_981710_-	DsbA family protein	NA	NA	NA	NA	NA
WP_003722685.1|981731_982004_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012951446.1|982003_982957_-	malate dehydrogenase	NA	NA	NA	NA	NA
WP_003732693.1|983085_983397_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003722682.1|983584_984988_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	30.1	2.3e-48
>prophage 63
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	989666	990218	2989591		Synechococcus_phage(100.0%)	1	NA	NA
WP_003722677.1|989666_990218_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	35.7	1.1e-14
>prophage 64
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	997991	998654	2989591		Bacillus_virus(100.0%)	1	NA	NA
WP_003722664.1|997991_998654_+	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	30.1	4.6e-20
>prophage 65
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	1005694	1009230	2989591		Micromonas_pusilla_virus(50.0%)	3	NA	NA
WP_003722656.1|1005694_1006519_-	transketolase	NA	G9E5U1	Micromonas_pusilla_virus	31.4	5.2e-13
WP_012951439.1|1006534_1007938_-	L-fucose/L-arabinose isomerase family protein	NA	NA	NA	NA	NA
WP_010989641.1|1008201_1009230_+	LacI family transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	22.3	2.9e-05
>prophage 66
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	1022793	1023987	2989591		Bacillus_virus(100.0%)	1	NA	NA
WP_003722878.1|1022793_1023987_-	glycine betaine/L-proline ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	36.3	7.6e-29
>prophage 67
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	1038761	1041431	2989591	protease	Enterobacteria_phage(50.0%)	2	NA	NA
WP_012951433.1|1038761_1040936_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	H6X3M6	Enterobacteria_phage	41.5	4.5e-128
WP_003722861.1|1040951_1041431_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	50.5	1.7e-19
>prophage 68
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	1044505	1051778	2989591		Bacillus_phage(50.0%)	7	NA	NA
WP_003732442.1|1044505_1045273_-	TerC family protein	NA	A0A068EP98	Bacillus_phage	38.5	9.2e-28
WP_003722856.1|1045375_1046143_-	TerC family protein	NA	A0A068EP98	Bacillus_phage	40.7	2.6e-30
WP_012951432.1|1046424_1047786_-	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_003732440.1|1047837_1048263_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003722853.1|1048369_1049938_-	peptide chain release factor 3	NA	A0A1S5SF82	Streptococcus_phage	27.5	2.1e-31
WP_003732439.1|1050019_1050874_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003732438.1|1050866_1051778_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	28.6	7.3e-24
>prophage 69
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	1056730	1057495	2989591		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_009931919.1|1056730_1057495_-	ATP-binding cassette domain-containing protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.9	1.5e-22
>prophage 70
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	1061241	1063955	2989591		Tupanvirus(50.0%)	2	NA	NA
WP_003732429.1|1061241_1062774_+	D-alanine--poly(phosphoribitol) ligase subunit DltA	NA	A0A2K9KZV5	Tupanvirus	29.5	1.0e-46
WP_003722795.1|1062770_1063955_+	D-alanyl-lipoteichoic acid biosynthesis protein DltB	NA	A0A125RNP0	Pseudomonas_phage	28.3	4.1e-19
>prophage 71
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	1072683	1073910	2989591		Phage_TP(100.0%)	1	NA	NA
WP_012951425.1|1072683_1073910_-	U32 family peptidase	NA	Q6DW11	Phage_TP	32.3	8.6e-44
>prophage 72
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	1086502	1090759	2989591		Clostridium_botulinum_C_phage(50.0%)	4	NA	NA
WP_003732419.1|1086502_1087633_-	MBL fold metallo-hydrolase	NA	Q332C0	Clostridium_botulinum_C_phage	37.6	3.3e-42
WP_003722764.1|1087745_1088048_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003719147.1|1088280_1088751_-	DNA starvation/stationary phase protection protein	NA	NA	NA	NA	NA
WP_012951420.1|1088953_1090759_+	HSP90 family protein	NA	A0A1V0SHA7	Hokovirus	29.6	1.1e-15
>prophage 73
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	1097313	1098261	2989591		Salmonella_phage(100.0%)	1	NA	NA
WP_003722755.1|1097313_1098261_+	glycosyltransferase family 2 protein	NA	A0A2H5BFL1	Salmonella_phage	39.0	1.9e-59
>prophage 74
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	1102554	1107063	2989591		Streptococcus_phage(50.0%)	4	NA	NA
WP_003722749.1|1102554_1104516_+	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	45.2	4.0e-136
WP_003734004.1|1104546_1105203_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003733783.1|1105225_1106341_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_012951409.1|1106340_1107063_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	31.0	3.4e-24
>prophage 75
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	1110208	1111780	2989591		Streptococcus_phage(100.0%)	1	NA	NA
WP_025370553.1|1110208_1111780_-	ABC-F type ribosomal protection protein	NA	A0A1B0RXA0	Streptococcus_phage	34.6	7.3e-64
>prophage 76
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	1125698	1126196	2989591		Pseudomonas_phage(100.0%)	1	NA	NA
WP_003721473.1|1125698_1126196_-	hypothetical protein	NA	A0A1Y0SYU1	Pseudomonas_phage	31.0	7.5e-07
>prophage 77
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	1133929	1137141	2989591		uncultured_Caudovirales_phage(50.0%)	3	NA	NA
WP_003732387.1|1133929_1135555_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	27.5	8.4e-47
WP_012951400.1|1135761_1136361_-	SpoIIE family protein phosphatase	NA	NA	NA	NA	NA
WP_003721462.1|1136361_1137141_-	RNA polymerase sigma factor SigB	NA	A0A0A0RV91	Bacillus_phage	34.6	4.3e-25
>prophage 78
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	1140953	1144651	2989591		Lactobacillus_phage(33.33%)	5	NA	NA
WP_003743775.1|1140953_1141301_-	type II toxin-antitoxin system PemK/MazF family toxin	NA	A0A1S5RCS0	Lactobacillus_phage	40.4	9.9e-14
WP_003721454.1|1141304_1141583_-	CopG family ribbon-helix-helix protein	NA	NA	NA	NA	NA
WP_012951399.1|1141788_1142895_-	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	30.5	4.1e-37
WP_003721452.1|1142913_1143270_-	holo-ACP synthase	NA	NA	NA	NA	NA
WP_010989606.1|1143271_1144651_-	protoporphyrinogen oxidase	NA	A0A2K9L6U6	Tupanvirus	23.8	2.4e-10
>prophage 79
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	1160287	1163975	2989591		Diachasmimorpha_longicaudata_entomopoxvirus(50.0%)	2	NA	NA
WP_003732374.1|1160287_1161850_-	ATP-dependent RNA helicase CshA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	37.4	7.0e-67
WP_026745098.1|1162301_1163975_-	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	42.1	2.0e-120
>prophage 80
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	1180206	1184848	2989591		Planktothrix_phage(50.0%)	4	NA	NA
WP_003724779.1|1180206_1180935_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.3	2.4e-30
WP_009917534.1|1180927_1182370_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_003721411.1|1182539_1183640_-	excinuclease ABC subunit C	NA	NA	NA	NA	NA
WP_009930625.1|1183744_1184848_-	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	A0A218MNE0	uncultured_virus	49.5	1.9e-98
>prophage 81
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	1192560	1195203	2989591		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_003721406.1|1192560_1195203_-	cation-translocating P-type ATPase	NA	M1HJQ2	Paramecium_bursaria_Chlorella_virus	29.8	2.4e-91
>prophage 82
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	1199018	1200689	2989591		Bacillus_phage(100.0%)	1	NA	NA
WP_072215871.1|1199018_1200689_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.5	1.9e-57
>prophage 83
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	1217665	1223855	2989591		Staphylococcus_phage(50.0%)	6	NA	NA
WP_009924976.1|1217665_1218490_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	50.0	5.5e-71
WP_003721389.1|1218610_1219000_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012951379.1|1219015_1219678_-	DUF3153 domain-containing protein	NA	NA	NA	NA	NA
WP_010989584.1|1219694_1220252_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_012951378.1|1220361_1221210_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010989583.1|1221224_1223855_-	cation-translocating P-type ATPase	NA	M1I547	Acanthocystis_turfacea_Chlorella_virus	29.5	9.3e-80
>prophage 84
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	1231864	1232959	2989591		Mycoplasma_phage(100.0%)	1	NA	NA
WP_072215848.1|1231864_1232959_-	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	45.8	3.0e-40
>prophage 85
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	1265334	1266264	2989591		Catovirus(100.0%)	1	NA	NA
WP_010989568.1|1265334_1266264_-	diacylglycerol kinase family lipid kinase	NA	A0A1V0SBJ0	Catovirus	28.2	3.2e-19
>prophage 86
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	1283457	1284363	2989591		Staphylococcus_phage(100.0%)	1	NA	NA
WP_009925081.1|1283457_1284363_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	38.6	1.2e-37
>prophage 87
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	1288559	1296620	2989591		Planktothrix_phage(50.0%)	11	NA	NA
WP_003721866.1|1288559_1288766_-	helix-turn-helix transcriptional regulator	NA	A0A1V0E021	Clostridioides_phage	50.9	2.5e-09
WP_012951362.1|1288762_1289050_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003733767.1|1289156_1289498_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003733766.1|1289561_1289861_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003732907.1|1290011_1290515_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012951361.1|1290543_1292544_-	ABC transporter ATP-binding protein/permease	NA	G9BWD6	Planktothrix_phage	38.4	4.4e-29
WP_010989555.1|1292558_1293263_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009925969.1|1293259_1293949_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	24.4	3.4e-05
WP_003721861.1|1293932_1294310_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010989554.1|1294573_1295233_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_003732903.1|1295246_1296620_-	glycoside hydrolase family 1 protein	NA	A0A0B5JD41	Pandoravirus	23.7	6.9e-26
>prophage 88
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	1301952	1302462	2989591		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_003721853.1|1301952_1302462_-	helix-turn-helix transcriptional regulator	NA	A0A2H4J4N8	uncultured_Caudovirales_phage	46.7	6.5e-06
>prophage 89
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	1307716	1317723	2989591		Paramecium_bursaria_Chlorella_virus(25.0%)	10	NA	NA
WP_025370547.1|1307716_1309522_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	M1HQK2	Paramecium_bursaria_Chlorella_virus	38.6	5.2e-98
WP_003721846.1|1309968_1310181_+	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_003721845.1|1310223_1310952_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003721844.1|1310964_1312770_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	20.9	1.7e-08
WP_010989552.1|1312931_1314662_-	pyruvate oxidase	NA	H8ZJ31	Ostreococcus_tauri_virus	22.4	6.5e-13
WP_010989551.1|1314932_1315580_+	elongation factor G-binding protein	NA	NA	NA	NA	NA
WP_003721841.1|1315625_1315949_-	DUF1048 domain-containing protein	NA	NA	NA	NA	NA
WP_003721840.1|1315948_1316275_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010989550.1|1316396_1317041_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003721838.1|1317054_1317723_-	lytic transglycosylase domain-containing protein	NA	A0A0H3V0Q1	Geobacillus_virus	55.6	2.9e-30
>prophage 90
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	1339867	1344437	2989591		Bacillus_phage(33.33%)	4	NA	NA
WP_003721812.1|1339867_1340227_-	response regulator	NA	W8CYM9	Bacillus_phage	36.9	7.6e-09
WP_003721811.1|1340501_1341365_-	FliC/FljB family flagellin	NA	NA	NA	NA	NA
WP_003721810.1|1341602_1342511_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	34.7	2.6e-45
WP_012951346.1|1342523_1344437_-	glycosyltransferase	NA	A0A1V0SEC5	Indivirus	25.8	2.9e-06
>prophage 91
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	1358969	1361810	2989591		Diadromus_pulchellus_ascovirus(50.0%)	3	NA	NA
WP_023549204.1|1358969_1359854_-	SDR family oxidoreductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	44.0	8.9e-59
WP_003721786.1|1360111_1360882_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003721785.1|1360874_1361810_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.3	4.4e-24
>prophage 92
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	1368671	1369379	2989591		Enterococcus_phage(100.0%)	1	NA	NA
WP_012951342.1|1368671_1369379_-	serine/threonine protein phosphatase	NA	A0A249Y183	Enterococcus_phage	27.8	2.5e-19
>prophage 93
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	1379359	1384717	2989591		Streptococcus_phage(66.67%)	4	NA	NA
WP_072215777.1|1379359_1381180_+	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	28.6	2.9e-48
WP_012951340.1|1381219_1381870_-	hypothetical protein	NA	A0A0E3HJ81	Synechococcus_phage	27.6	3.4e-15
WP_003722841.1|1382012_1382741_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012951339.1|1382836_1384717_-	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	38.5	1.7e-107
>prophage 94
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	1406620	1413892	2989591		Oenococcus_phage(25.0%)	9	NA	NA
WP_012951289.1|1406620_1407361_-	sulfite exporter TauE/SafE family protein	NA	Q6A1Z9	Oenococcus_phage	31.9	4.5e-16
WP_003722816.1|1407457_1407850_-	DUF1398 family protein	NA	NA	NA	NA	NA
WP_003722815.1|1407905_1408361_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010989529.1|1408467_1409610_+	serine/threonine protein kinase	NA	G9BWE0	Planktothrix_phage	31.6	2.0e-15
WP_003722813.1|1409689_1410184_+	DUF5067 domain-containing protein	NA	NA	NA	NA	NA
WP_012951288.1|1410224_1411976_-	glycerophosphodiester phosphodiesterase	NA	M1HJV8	Acanthocystis_turfacea_Chlorella_virus	25.3	5.2e-10
WP_003722811.1|1412082_1412325_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009911193.1|1412321_1412855_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003722809.1|1412950_1413892_-	NADP-dependent oxidoreductase	NA	A0A2P1EIJ9	Megavirus	25.2	3.2e-06
>prophage 95
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	1417528	1421067	2989591		Bacillus_phage(100.0%)	2	NA	NA
WP_003732630.1|1417528_1419346_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.7	1.1e-58
WP_012951286.1|1419342_1421067_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.5	5.8e-46
>prophage 96
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	1429215	1430493	2989591		Pandoravirus(100.0%)	1	NA	NA
WP_003723401.1|1429215_1430493_+	O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase	NA	A0A0B5JD48	Pandoravirus	26.7	4.0e-12
>prophage 97
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	1436442	1437846	2989591		Megavirus(100.0%)	1	NA	NA
WP_012951279.1|1436442_1437846_-	deoxyribodipyrimidine photo-lyase	NA	K7Y8W8	Megavirus	33.0	1.6e-62
>prophage 98
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	1446549	1450182	2989591		Clostridioides_phage(33.33%)	4	NA	NA
WP_072215780.1|1446549_1447992_+	invasion associated endopeptidase	NA	A0A1V0DZX6	Clostridioides_phage	50.0	1.1e-18
WP_012951274.1|1448079_1449264_+	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	44.6	8.4e-81
WP_003732650.1|1449294_1449951_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_009925352.1|1449972_1450182_-	hypothetical protein	NA	A0A172JI00	Bacillus_phage	53.0	1.2e-14
>prophage 99
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	1455999	1458740	2989591		Moraxella_phage(50.0%)	3	NA	NA
WP_003721367.1|1455999_1457295_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	32.4	4.8e-53
WP_012951272.1|1457335_1458367_-	nucleoid-associated protein	NA	NA	NA	NA	NA
WP_003732653.1|1458443_1458740_+	MGMT family protein	NA	M1PFU9	Streptococcus_phage	34.0	4.5e-07
>prophage 100
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	1465457	1465775	2989591		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_003721356.1|1465457_1465775_+	phosphoribosyl-AMP cyclohydrolase	NA	A0A2H4UVM0	Bodo_saltans_virus	38.1	5.8e-13
>prophage 101
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	1471917	1473396	2989591		Acinetobacter_phage(100.0%)	1	NA	NA
WP_003732659.1|1471917_1473396_-	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	40.1	1.2e-79
>prophage 102
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	1486844	1488038	2989591		Mycobacterium_virus(100.0%)	1	NA	NA
WP_012951264.1|1486844_1488038_-	serine hydrolase	NA	G1BSP8	Mycobacterium_virus	22.8	3.9e-09
>prophage 103
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	1505143	1506475	2989591		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_003733179.1|1505143_1506475_-	DUF1254 domain-containing protein	NA	M1I2Z8	Paramecium_bursaria_Chlorella_virus	29.0	6.2e-40
>prophage 104
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	1512622	1516374	2989591	integrase	Listeria_phage(50.0%)	3	1503199:1503213	1522844:1522858
1503199:1503213	attL	TTTTTGATAAAAATT	NA	NA	NA	NA
WP_012951257.1|1512622_1513552_+|integrase	site-specific integrase	integrase	A8ATM2	Listeria_phage	47.8	3.3e-80
WP_031673293.1|1513594_1514788_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_012951255.1|1514784_1516374_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	40.2	7.8e-98
1522844:1522858	attR	AATTTTTATCAAAAA	NA	NA	NA	NA
>prophage 105
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	1531516	1532452	2989591		Hokovirus(100.0%)	1	NA	NA
WP_003733190.1|1531516_1532452_-	ribose-phosphate pyrophosphokinase	NA	A0A1V0SHF7	Hokovirus	32.3	1.7e-39
>prophage 106
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	1536800	1540226	2989591		Tetraselmis_virus(50.0%)	3	NA	NA
WP_012951244.1|1536800_1537403_-	SIS domain-containing protein	NA	A0A2P0VNK5	Tetraselmis_virus	24.2	2.0e-14
WP_003733193.1|1537406_1539467_-	BglG family transcription antiterminator	NA	NA	NA	NA	NA
WP_012951243.1|1539575_1540226_-	transaldolase	NA	A0A0C5AMY8	Cyanophage	29.7	2.1e-17
>prophage 107
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	1552132	1553791	2989591		Lactobacillus_phage(50.0%)	2	NA	NA
WP_010989491.1|1552132_1553026_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	24.0	3.6e-07
WP_009932174.1|1553062_1553791_-	NUDIX hydrolase	NA	G3MA14	Bacillus_virus	34.9	2.4e-25
>prophage 108
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	1573403	1574351	2989591		Acidianus_two-tailed_virus(100.0%)	1	NA	NA
WP_012581921.1|1573403_1574351_+	MoxR family ATPase	NA	A0A1C9EGB9	Acidianus_two-tailed_virus	27.8	3.2e-06
>prophage 109
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	1602363	1603110	2989591		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_012951220.1|1602363_1603110_-	SDR family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	26.0	2.1e-05
>prophage 110
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	1616239	1616539	2989591		Bacillus_virus(100.0%)	1	NA	NA
WP_003722968.1|1616239_1616539_+	hypothetical protein	NA	G3MBF7	Bacillus_virus	63.4	1.4e-27
>prophage 111
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	1621470	1624074	2989591		Hokovirus(100.0%)	1	NA	NA
WP_012951209.1|1621470_1624074_+	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	31.2	2.5e-40
>prophage 112
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	1638736	1642121	2989591		Bacillus_phage(50.0%)	5	NA	NA
WP_003723106.1|1638736_1639420_-	SH3 domain-containing protein	NA	A7KUS1	Bacillus_phage	34.7	3.6e-07
WP_003723105.1|1639563_1640013_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003723104.1|1640047_1640992_-	flotillin-like protein FloA	NA	NA	NA	NA	NA
WP_003738085.1|1640988_1641288_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025370536.1|1641455_1642121_-	uracil-DNA glycosylase	NA	A0A2K9QQR6	Equid_alphaherpesvirus	47.5	1.6e-49
>prophage 113
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	1653679	1654600	2989591		Streptococcus_phage(100.0%)	1	NA	NA
WP_012951194.1|1653679_1654600_+	YafY family transcriptional regulator	NA	A0A1B0RXM1	Streptococcus_phage	27.1	1.8e-06
>prophage 114
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	1671107	1672628	2989591		Lactobacillus_phage(100.0%)	1	NA	NA
WP_003723206.1|1671107_1672628_-	flavocytochrome c	NA	A0A2P0ZL82	Lactobacillus_phage	31.9	5.3e-51
>prophage 115
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	1680857	1681514	2989591		Synechococcus_phage(100.0%)	1	NA	NA
WP_003723193.1|1680857_1681514_+	fructose-6-phosphate aldolase	NA	A0A0E3HJ81	Synechococcus_phage	46.7	2.6e-47
>prophage 116
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	1724191	1748738	2989591		Bacillus_phage(27.27%)	22	NA	NA
WP_010989403.1|1724191_1725694_-	PDZ domain-containing protein	NA	W5SAB9	Pithovirus	32.6	4.7e-12
WP_010989402.1|1725791_1726622_-	MBL fold metallo-hydrolase	NA	A0A0A0RVF5	Bacillus_phage	29.0	8.4e-19
WP_003722910.1|1726741_1727581_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003722909.1|1727583_1728906_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_003722908.1|1728902_1730735_-	cell wall metabolism sensor histidine kinase WalK	NA	W8CYF6	Bacillus_phage	33.3	4.1e-34
WP_003722907.1|1730919_1731633_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	41.4	2.6e-45
WP_012951156.1|1731845_1733027_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_003722905.1|1733408_1734230_+	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003722904.1|1734244_1735261_+	methionine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.4	1.3e-29
WP_003722903.1|1735257_1735920_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_012582042.1|1736009_1736789_+	carbon-nitrogen family hydrolase	NA	M1I0W4	Acanthocystis_turfacea_Chlorella_virus	25.5	2.7e-11
WP_012951154.1|1736950_1737622_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_003722900.1|1737879_1738431_-	anaerobic ribonucleoside-triphosphate reductase activating protein	NA	A0A0C5K925	Enterococcus_phage	60.8	3.3e-56
WP_012951153.1|1738423_1740574_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A0C5KKX3	Enterococcus_phage	63.2	3.6e-263
WP_003732853.1|1740864_1741965_+	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	Q6GZ03	Mycoplasma_phage	40.6	5.0e-19
WP_009924288.1|1742003_1742975_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_012951151.1|1743091_1743913_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_003722895.1|1743929_1744772_+	MBL fold metallo-hydrolase	NA	Q0H255	Geobacillus_phage	63.1	1.5e-87
WP_009924286.1|1745030_1745693_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_012951150.1|1745729_1746233_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003729164.1|1746368_1747181_+	sugar-phosphatase	NA	NA	NA	NA	NA
WP_003722891.1|1747301_1748738_+	glycoside hydrolase family 1 protein	NA	A0A0B5JD41	Pandoravirus	31.2	5.3e-53
>prophage 117
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	1764163	1771494	2989591		Aureococcus_anophage(50.0%)	2	NA	NA
WP_003732839.1|1764163_1767769_-	DNA-directed RNA polymerase subunit beta'	NA	A0A076FGB9	Aureococcus_anophage	25.4	9.9e-56
WP_003723045.1|1767939_1771494_-	DNA-directed RNA polymerase subunit beta	NA	A0A1B1ISA9	uncultured_Mediterranean_phage	23.5	2.6e-48
>prophage 118
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	1778756	1781075	2989591		Enterobacteria_phage(50.0%)	2	NA	NA
WP_012951134.1|1778756_1779752_-	LacI family transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	27.9	3.7e-21
WP_012951133.1|1779896_1781075_-	RNA-splicing ligase RtcB	NA	X2JMN6	Bacillus_phage	55.1	1.3e-118
>prophage 119
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	1785470	1790371	2989591	tRNA	Bacillus_virus(50.0%)	8	NA	NA
WP_003726896.1|1785470_1786004_-	transcription termination/antitermination protein NusG	NA	G3MAW2	Bacillus_virus	32.1	2.0e-13
WP_003728078.1|1786133_1786313_-	preprotein translocase subunit SecE	NA	NA	NA	NA	NA
WP_003728079.1|1786332_1786482_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_003732831.1|1786585_1787191_-	RNA polymerase sporulation sigma factor SigH	NA	NA	NA	NA	NA
WP_003724086.1|1787271_1787784_-	NYN domain-containing protein	NA	NA	NA	NA	NA
WP_003724085.1|1787786_1788542_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_003732830.1|1788541_1788952_-	Mini-ribonuclease 3	NA	NA	NA	NA	NA
WP_012951130.1|1788955_1790371_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	30.8	1.2e-52
>prophage 120
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	1796793	1799256	2989591	protease	Enterobacteria_phage(100.0%)	1	NA	NA
WP_003723897.1|1796793_1799256_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	H6X3M6	Enterobacteria_phage	38.7	7.3e-127
>prophage 121
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	1812829	1814326	2989591	tRNA	Catovirus(100.0%)	1	NA	NA
WP_010989378.1|1812829_1814326_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	40.4	2.1e-92
>prophage 122
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	1817879	1825084	2989591	tRNA	Streptococcus_phage(33.33%)	5	NA	NA
WP_003723745.1|1817879_1818806_-	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	69.5	2.1e-119
WP_003723744.1|1818921_1819806_-	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
WP_012952050.1|1819821_1820601_-	type III pantothenate kinase	NA	NA	NA	NA	NA
WP_003733155.1|1820716_1822792_-	ATP-dependent metallopeptidase FtsH/Yme1/Tma family protein	NA	G8DDJ2	Micromonas_pusilla_virus	47.7	3.6e-111
WP_003723741.1|1823137_1825084_-|tRNA	bifunctional tRNA lysidine(34) synthetase TilS/hypoxanthine phosphoribosyltransferase HprT	tRNA	A0A2K9L634	Tupanvirus	24.5	2.6e-10
>prophage 123
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	1835977	1836310	2989591		Rhodobacter_phage(100.0%)	1	NA	NA
WP_003725735.1|1835977_1836310_+	putative heavy metal-binding protein	NA	M4STD1	Rhodobacter_phage	43.5	5.7e-11
>prophage 124
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	1846048	1848429	2989591		Tupanvirus(50.0%)	2	NA	NA
WP_003722728.1|1846048_1847005_-	ribose-phosphate diphosphokinase	NA	A0A2K9L2G2	Tupanvirus	35.5	3.3e-43
WP_003722727.1|1847055_1848429_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0G2Y8M0	Acanthamoeba_polyphaga_mimivirus	36.5	3.5e-30
>prophage 125
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	1851440	1853852	2989591		Planktothrix_phage(50.0%)	3	NA	NA
WP_003722723.1|1851440_1852133_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.7	7.2e-32
WP_003722722.1|1852181_1852859_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_003722721.1|1853033_1853852_-	pur operon repressor	NA	A0A1V0SKE5	Klosneuvirus	25.4	3.1e-05
>prophage 126
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	1857728	1858955	2989591		Bacillus_phage(100.0%)	1	NA	NA
WP_003733142.1|1857728_1858955_-	DUF348 domain-containing protein	NA	A0A0S2SXZ8	Bacillus_phage	58.4	2.0e-24
>prophage 127
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	1871884	1873882	2989591	tRNA	Hokovirus(100.0%)	1	NA	NA
WP_003722707.1|1871884_1873882_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SEZ7	Hokovirus	33.6	1.1e-101
>prophage 128
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	1880376	1883886	2989591		Paramecium_bursaria_Chlorella_virus(33.33%)	4	NA	NA
WP_072215767.1|1880376_1881642_-	DUF1254 domain-containing protein	NA	M1H738	Paramecium_bursaria_Chlorella_virus	25.5	1.0e-23
WP_003723496.1|1881703_1882561_-	glucose transporter GlcU	NA	NA	NA	NA	NA
WP_003723495.1|1882675_1882960_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A2I7SC16	Paenibacillus_phage	51.4	5.8e-12
WP_012952065.1|1883004_1883886_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	45.9	2.9e-62
>prophage 129
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	1888268	1889984	2989591		Streptococcus_phage(100.0%)	1	NA	NA
WP_003733311.1|1888268_1889984_-	collagen binding domain-containing protein	NA	F8HGQ4	Streptococcus_phage	33.9	1.3e-13
>prophage 130
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	1897726	1898431	2989591		Bacillus_virus(100.0%)	1	NA	NA
WP_003723481.1|1897726_1898431_-	metal ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.1	2.5e-19
>prophage 131
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	1913312	1914821	2989591		Klosneuvirus(100.0%)	1	NA	NA
WP_003728204.1|1913312_1914821_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	34.0	1.3e-57
>prophage 132
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	1918220	1928947	2989591	holin,tail	Listeria_phage(33.33%)	17	NA	NA
WP_003732227.1|1918220_1918949_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A0N9SGH1	Paenibacillus_phage	42.5	4.3e-35
WP_003721755.1|1918929_1919352_-|holin	holin family protein	holin	Q2I8E7	Bacillus_phage	46.3	1.1e-27
WP_003732226.1|1919370_1919907_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009931691.1|1919903_1920383_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012952080.1|1920397_1920973_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003721751.1|1920987_1921287_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010958675.1|1921276_1922413_-	minor structural protein	NA	A8ATA9	Listeria_phage	28.9	5.0e-54
WP_003734720.1|1922422_1923241_-|tail	phage tail family protein	tail	A0A060AFE1	Staphylococcus_phage	35.0	7.2e-39
WP_012952081.1|1923237_1925106_-	membrane protein	NA	A0A097PAU2	Streptococcus_pyogenes_phage	45.8	3.5e-20
WP_012952082.1|1925092_1925497_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003721745.1|1925538_1925841_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003721744.1|1925888_1926401_-|tail	phage major tail protein, TP901-1 family	tail	A0A097PBF4	Streptococcus_pyogenes_phage	62.7	1.2e-47
WP_012952083.1|1926413_1926803_-	DUF5072 domain-containing protein	NA	NA	NA	NA	NA
WP_003732220.1|1927080_1927497_-	hypothetical protein	NA	A8ASQ1	Listeria_phage	39.3	1.3e-20
WP_003732219.1|1927508_1927937_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003721740.1|1928153_1928489_+	helix-turn-helix transcriptional regulator	NA	A0A2H4JAR9	uncultured_Caudovirales_phage	52.5	4.0e-20
WP_003721739.1|1928494_1928947_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A059T7S0	Listeria_phage	47.9	4.0e-31
>prophage 133
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	1932771	1939588	2989591		Bacillus_phage(66.67%)	4	NA	NA
WP_003721734.1|1932771_1934514_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.1	5.3e-55
WP_003732216.1|1934506_1936288_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.8	1.7e-53
WP_003721732.1|1936312_1937215_-	ROK family protein	NA	NA	NA	NA	NA
WP_072215839.1|1937317_1939588_-	chitinase	NA	A0A2K9L3D4	Tupanvirus	32.1	5.8e-38
>prophage 134
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	1964228	1965185	2989591		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_012952094.1|1964228_1965185_-	NAD(P)-binding domain-containing protein	NA	M1H502	Paramecium_bursaria_Chlorella_virus	29.3	1.4e-30
>prophage 135
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	1977898	1982404	2989591		Mycobacterium_phage(100.0%)	1	NA	NA
WP_012952109.1|1977898_1982404_-	type VII secretion protein EssC	NA	V5UPA0	Mycobacterium_phage	22.7	2.0e-37
>prophage 136
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	1988374	1994620	2989591		Megavirus(33.33%)	5	NA	NA
WP_003721679.1|1988374_1989667_-	adenylosuccinate synthase	NA	G5CQQ4	Megavirus	35.9	4.9e-66
WP_003721677.1|1989925_1991278_-	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	54.2	1.0e-122
WP_003724881.1|1991302_1991749_-	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_003721675.1|1991751_1993725_-	cyclic-di-AMP phosphodiesterase PdeA	NA	NA	NA	NA	NA
WP_003721674.1|1993891_1994620_-	response regulator transcription factor	NA	A0A2H4J4Z6	uncultured_Caudovirales_phage	29.2	6.0e-29
>prophage 137
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	1998093	1998630	2989591		Listeria_phage(100.0%)	1	NA	NA
WP_003721668.1|1998093_1998630_-	single-stranded DNA-binding protein	NA	A8ATZ7	Listeria_phage	66.3	1.2e-53
>prophage 138
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	2002129	2007859	2989591		Acanthocystis_turfacea_Chlorella_virus(66.67%)	5	NA	NA
WP_009911777.1|2002129_2003239_-	agmatine deiminase	NA	M1HI51	Acanthocystis_turfacea_Chlorella_virus	51.8	4.0e-109
WP_003721662.1|2003340_2004282_-	carbamate kinase	NA	NA	NA	NA	NA
WP_012952112.1|2004294_2005389_-	agmatine deiminase	NA	M1HES8	Acanthocystis_turfacea_Chlorella_virus	53.5	7.7e-113
WP_003732183.1|2005375_2006761_-	APC family permease	NA	NA	NA	NA	NA
WP_003721659.1|2006833_2007859_-	putrescine carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	26.1	1.1e-15
>prophage 139
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	2014117	2019949	2989591		Enterobacteria_phage(33.33%)	8	NA	NA
WP_012952115.1|2014117_2015173_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	26.4	3.3e-20
WP_012952116.1|2015189_2015999_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_003721652.1|2016034_2016373_-	DUF4064 domain-containing protein	NA	A0A0S2MVJ2	Bacillus_phage	32.7	2.1e-05
WP_025370520.1|2016595_2017045_+	DUF2712 domain-containing protein	NA	NA	NA	NA	NA
WP_003721649.1|2017115_2017880_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003732181.1|2017866_2018580_+	WxPxxD family membrane protein	NA	NA	NA	NA	NA
WP_003721647.1|2018581_2019304_+	DUF2705 family protein	NA	NA	NA	NA	NA
WP_003732180.1|2019319_2019949_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	37.2	1.5e-28
>prophage 140
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	2042078	2050805	2989591		Bacillus_virus(50.0%)	6	NA	NA
WP_003723770.1|2042078_2044607_-	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	37.6	5.8e-111
WP_003723769.1|2044701_2046642_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	45.4	6.1e-145
WP_003723768.1|2046690_2047803_-	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_010958651.1|2047806_2048028_-	S4 domain-containing protein YaaA	NA	A0A1X9I5V8	Streptococcus_phage	45.6	2.6e-07
WP_012952124.1|2048207_2049551_-	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_003725616.1|2049659_2050805_-	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	25.7	1.7e-25
>prophage 141
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	2062484	2063897	2989591		Mycobacterium_phage(100.0%)	1	NA	NA
WP_038406087.1|2062484_2063897_-	MFS transporter	NA	A0A0M3UL24	Mycobacterium_phage	27.2	1.8e-29
>prophage 142
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	2078029	2085784	2989591		Streptococcus_phage(50.0%)	9	NA	NA
WP_003723837.1|2078029_2079151_+	glycerate kinase	NA	W6LM47	Streptococcus_phage	48.9	1.1e-66
WP_003723836.1|2079147_2079810_+	beta-phosphoglucomutase	NA	M1I080	Acanthocystis_turfacea_Chlorella_virus	27.0	5.3e-08
WP_003723835.1|2079932_2080253_+	thioredoxin family protein	NA	A0A0K2FIM3	Achromobacter_phage	31.1	2.7e-10
WP_003732155.1|2080308_2080908_-	nitroreductase family protein	NA	NA	NA	NA	NA
WP_003733897.1|2081101_2081455_+	hypothetical protein	NA	A0A1S7FZ87	Listeria_phage	41.3	2.5e-12
WP_003722186.1|2081557_2081980_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003722185.1|2081993_2083142_+	MFS transporter	NA	NA	NA	NA	NA
WP_012951057.1|2083512_2084604_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	61.1	2.0e-121
WP_009918143.1|2084596_2085784_+	phosphoglycerate dehydrogenase	NA	M1NSB9	Streptococcus_phage	54.2	6.2e-116
>prophage 143
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	2116701	2120613	2989591		Bifidobacterium_phage(66.67%)	5	NA	NA
WP_010990072.1|2116701_2117556_+	nucleoid occlusion protein	NA	I3NLC2	Bifidobacterium_phage	31.6	4.9e-14
WP_003722152.1|2117567_2117867_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003732136.1|2118025_2118784_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003722150.1|2119007_2119769_+	ParA family protein	NA	Q8JL10	Natrialba_phage	29.0	4.4e-22
WP_003722149.1|2119761_2120613_+	ParB/RepB/Spo0J family partition protein	NA	I3NLC2	Bifidobacterium_phage	32.7	2.5e-18
>prophage 144
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	2124988	2126455	2989591		Tupanvirus(100.0%)	1	NA	NA
WP_038406091.1|2124988_2126455_+	catalase	NA	A0A2K9L572	Tupanvirus	47.8	2.4e-109
>prophage 145
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	2144152	2145040	2989591		Amsacta_moorei_entomopoxvirus(100.0%)	1	NA	NA
WP_003722129.1|2144152_2145040_+	ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	27.4	3.3e-13
>prophage 146
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	2150734	2160766	2989591		Tupanvirus(33.33%)	7	NA	NA
WP_009924391.1|2150734_2152189_-	glycoside hydrolase family 1 protein	NA	A0A0B5JD41	Pandoravirus	30.3	1.9e-50
WP_072215787.1|2152216_2152525_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012951082.1|2152703_2154314_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	29.5	1.2e-45
WP_012951083.1|2154371_2154902_+	ADP-ribose-binding protein	NA	A0A0K1L687	Scale_drop_disease_virus	49.3	3.4e-29
WP_003722118.1|2155189_2156656_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	40.0	8.0e-97
WP_003732117.1|2156816_2158589_+	DNA helicase RecQ	NA	A0A2K9L3P7	Tupanvirus	37.1	6.3e-80
WP_012951084.1|2158612_2160766_+	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	34.1	6.7e-44
>prophage 147
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	2164591	2182812	2989591	tRNA	Bacillus_phage(33.33%)	17	NA	NA
WP_003732112.1|2164591_2166364_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.0	4.0e-50
WP_003732111.1|2166363_2168085_-	ABC transporter ATP-binding protein	NA	A0A076FI99	Aureococcus_anophage	23.4	2.3e-10
WP_012951087.1|2168245_2169952_-	aminodeoxychorismate synthase component I	NA	A0A0B5J984	Pandoravirus	31.1	1.2e-46
WP_003722109.1|2169948_2170521_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	46.8	2.2e-42
WP_003722108.1|2170650_2171070_+	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
WP_003722107.1|2171404_2172688_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	44.7	5.0e-95
WP_003722106.1|2172707_2172959_+	TfoX/Sxy family protein	NA	NA	NA	NA	NA
WP_010990058.1|2173012_2174740_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	53.3	2.5e-150
WP_003722104.1|2175069_2175759_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_003722103.1|2175901_2176546_+	fructose-6-phosphate aldolase	NA	H8ZMU3	Synechococcus_phage	47.7	1.0e-48
WP_003722102.1|2176564_2176912_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010990057.1|2177028_2178237_+	multidrug efflux MFS transporter Lde	NA	NA	NA	NA	NA
WP_003722100.1|2178226_2178517_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012951090.1|2178509_2179199_+	NAD-dependent protein deacylase	NA	A0A068EPD4	Bacillus_phage	31.1	8.0e-23
WP_003732103.1|2179316_2180651_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_012951091.1|2180718_2181675_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_012951092.1|2181678_2182812_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	37.6	3.3e-42
>prophage 148
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	2197603	2199181	2989591		Staphylococcus_phage(100.0%)	1	NA	NA
WP_012951097.1|2197603_2199181_-	acyl--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	36.9	4.1e-83
>prophage 149
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	2202633	2206097	2989591		Bodo_saltans_virus(50.0%)	2	NA	NA
WP_014931743.1|2202633_2204358_+	thiol reductant ABC exporter subunit CydD	NA	A0A2H4UU96	Bodo_saltans_virus	33.0	3.5e-19
WP_003732089.1|2204357_2206097_+	thiol reductant ABC exporter subunit CydC	NA	W8CYL7	Bacillus_phage	25.9	4.1e-23
>prophage 150
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	2214982	2218922	2989591		Streptococcus_virus(50.0%)	5	NA	NA
WP_003732084.1|2214982_2216722_+	DNA polymerase III subunit gamma/tau	NA	A0A1U9WR94	Streptococcus_virus	39.2	1.9e-57
WP_003722063.1|2216751_2217069_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_003722062.1|2217177_2217774_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_003722061.1|2217788_2218034_+	YaaL family protein	NA	NA	NA	NA	NA
WP_009931159.1|2218079_2218922_-	aldo/keto reductase	NA	A0A1V0SKP9	Klosneuvirus	26.9	6.1e-25
>prophage 151
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	2224558	2231484	2989591		Streptococcus_phage(33.33%)	6	NA	NA
WP_009930435.1|2224558_2225185_+	dTMP kinase	NA	M1PSC7	Streptococcus_phage	47.5	5.5e-47
WP_003722052.1|2225292_2225622_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012951104.1|2225858_2227631_-	1,4-beta-N-acetylmuramoylhydrolase	NA	Q9ZXE4	Bacillus_phage	42.1	2.0e-17
WP_009925488.1|2227792_2228359_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003734068.1|2228487_2228742_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012951105.1|2228913_2231484_+	magnesium-translocating P-type ATPase	NA	M1IAU8	Acanthocystis_turfacea_Chlorella_virus	25.9	2.0e-42
>prophage 152
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	2238998	2247140	2989591		Paramecium_bursaria_Chlorella_virus(25.0%)	6	NA	NA
WP_003733062.1|2238998_2241044_+	potassium-transporting ATPase subunit KdpB	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	25.0	3.2e-27
WP_012951108.1|2241058_2241631_+	K(+)-transporting ATPase subunit C	NA	NA	NA	NA	NA
WP_010990039.1|2241646_2244337_+	sensor histidine kinase KdpD	NA	Q8QKV7	Ectocarpus_siliculosus_virus	26.5	1.8e-09
WP_003722035.1|2244333_2245029_+	response regulator transcription factor	NA	Q56AR1	Bacillus_thuringiensis_phage	29.9	1.2e-05
WP_003722034.1|2245069_2245882_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_009924327.1|2245883_2247140_-	Y-family DNA polymerase	NA	O64031	Bacillus_phage	41.9	3.4e-80
>prophage 153
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	2255885	2257971	2989591		Synechococcus_phage(50.0%)	2	NA	NA
WP_012951112.1|2255885_2256938_+	galactitol-1-phosphate 5-dehydrogenase	NA	E3SJ82	Synechococcus_phage	24.1	7.4e-12
WP_003733054.1|2256939_2257971_+	zinc-binding dehydrogenase	NA	A0A2K9L7I1	Tupanvirus	30.7	1.3e-16
>prophage 154
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	2265176	2268560	2989591		Streptococcus_phage(50.0%)	2	NA	NA
WP_003724965.1|2265176_2267264_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.8	1.0e-65
WP_003723640.1|2267372_2268560_+	elongation factor Tu	NA	A0A1V0SLW6	Klosneuvirus	26.7	1.2e-13
>prophage 155
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	2279626	2280607	2989591		Indivirus(100.0%)	1	NA	NA
WP_003733043.1|2279626_2280607_-	polyprenyl synthetase family protein	NA	A0A1V0SE37	Indivirus	24.0	9.3e-09
>prophage 156
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	2305243	2307718	2989591		Bacillus_phage(66.67%)	3	NA	NA
WP_003723672.1|2305243_2305906_-	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	45.6	1.8e-19
WP_012951123.1|2306036_2306876_+	energy-coupling factor ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	32.1	1.2e-17
WP_003728531.1|2306851_2307718_+	energy-coupling factor ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	31.5	1.3e-14
>prophage 157
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	2312547	2314967	2989591		Staphylococcus_phage(50.0%)	2	NA	NA
WP_012951125.1|2312547_2313399_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	38.0	2.3e-48
WP_012951126.1|2313440_2314967_-	GW domain-containing glycosaminoglycan-binding protein	NA	A0A0K2CP65	Brevibacillus_phage	49.0	1.5e-26
>prophage 158
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	2331786	2335675	2989591		Bacillus_phage(66.67%)	4	NA	NA
WP_012952041.1|2331786_2332464_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	48.0	3.4e-58
WP_012952040.1|2332460_2333840_+	HAMP domain-containing sensor histidine kinase	NA	W8CYF6	Bacillus_phage	43.7	7.1e-55
WP_010990019.1|2333918_2335007_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003723280.1|2335006_2335675_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	42.0	5.0e-38
>prophage 159
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	2350788	2352111	2989591		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_009924630.1|2350788_2352111_+	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	33.2	2.6e-30
>prophage 160
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	2356522	2362155	2989591		Only_Syngen_Nebraska_virus(33.33%)	3	NA	NA
WP_003723607.1|2356522_2358121_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	52.2	6.5e-153
WP_012952034.1|2358164_2360918_-	GW domain-containing glycosaminoglycan-binding protein	NA	A0A288WFW6	Bacillus_phage	29.4	2.2e-23
WP_003732527.1|2361234_2362155_+	diacylglycerol kinase family lipid kinase	NA	A0A1V0SBJ0	Catovirus	28.4	2.6e-21
>prophage 161
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	2369723	2370671	2989591		Shigella_phage(100.0%)	1	NA	NA
WP_012952032.1|2369723_2370671_+	glycosyltransferase family 2 protein	NA	U5P087	Shigella_phage	43.6	5.2e-65
>prophage 162
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	2374995	2380627	2989591		Pectobacterium_bacteriophage(33.33%)	6	NA	NA
WP_003729255.1|2374995_2375571_+	thymidine kinase	NA	A0A0A0Q2F0	Pectobacterium_bacteriophage	51.4	8.6e-47
WP_003726351.1|2375593_2376670_+	peptide chain release factor 1	NA	NA	NA	NA	NA
WP_003723474.1|2376656_2377508_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_009925391.1|2377808_2378846_+	threonylcarbamoyl-AMP synthase	NA	S4VW33	Pandoravirus	42.3	7.4e-65
WP_009911254.1|2378842_2379250_+	low molecular weight protein arginine phosphatase	NA	NA	NA	NA	NA
WP_003732521.1|2379385_2380627_+	serine hydroxymethyltransferase	NA	A0A240F2Y9	Aeromonas_phage	53.1	5.9e-101
>prophage 163
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	2394088	2395678	2989591		Lactococcus_phage(50.0%)	2	NA	NA
WP_003732514.1|2394088_2394454_+	single-stranded DNA-binding protein	NA	Q0ILF5	Lactococcus_phage	48.7	2.2e-27
WP_012952029.1|2394844_2395678_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A217ER34	Bacillus_phage	60.4	1.3e-22
>prophage 164
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	2400542	2404635	2989591		Streptococcus_phage(66.67%)	4	NA	NA
WP_010990008.1|2400542_2401178_-	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	45.0	2.1e-41
WP_003722647.1|2401562_2402249_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_003722646.1|2402269_2403121_+	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	37.1	9.9e-15
WP_009924458.1|2403315_2404635_+	DEAD/DEAH box helicase	NA	A0A1X9I5S6	Streptococcus_phage	37.4	2.1e-72
>prophage 165
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	2408870	2421025	2989591	protease	Planktothrix_phage(28.57%)	10	NA	NA
WP_096807916.1|2408870_2409971_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	38.7	3.2e-05
WP_003722640.1|2409977_2410841_+	YitT family protein	NA	M1Q1P6	Streptococcus_phage	34.5	1.2e-39
WP_003720823.1|2411344_2412031_+	cell division ATP-binding protein FtsE	NA	G9BWD6	Planktothrix_phage	30.7	5.0e-25
WP_003732506.1|2412020_2412905_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003722638.1|2412980_2414186_+	peptidase P60	NA	A0A0K0NL58	Gordonia_phage	40.7	1.2e-05
WP_012952025.1|2414305_2415616_+	peptidoglycan DD-metalloendopeptidase family protein	NA	G9BW84	Planktothrix_phage	35.5	6.6e-10
WP_003722636.1|2415738_2417187_+	cardiolipin synthase	NA	NA	NA	NA	NA
WP_003732505.1|2417214_2418390_+|protease	serine protease	protease	NA	NA	NA	NA
WP_009924808.1|2418539_2419250_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	39.7	7.4e-40
WP_012952023.1|2419249_2421025_+	PAS domain-containing protein	NA	W8CYF6	Bacillus_phage	37.1	1.0e-37
>prophage 166
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	2424114	2426969	2989591		Bacillus_virus(66.67%)	4	NA	NA
WP_003725427.1|2424114_2424930_+	phosphate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.1	1.9e-15
WP_003722628.1|2424944_2425724_+	phosphate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.2	2.4e-15
WP_003722627.1|2425736_2426396_+	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_003722626.1|2426663_2426969_+	winged helix-turn-helix transcriptional regulator	NA	A0A218MNF3	uncultured_virus	40.6	9.6e-05
>prophage 167
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	2430624	2433495	2989591		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_025370655.1|2430624_2433495_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	58.6	0.0e+00
>prophage 168
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	2441712	2449556	2989591		Streptococcus_phage(50.0%)	7	NA	NA
WP_003722610.1|2441712_2442672_+	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	53.7	2.0e-88
WP_012952019.1|2442790_2443774_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	37.2	5.8e-51
WP_012952018.1|2443790_2444852_+	galactose mutarotase	NA	NA	NA	NA	NA
WP_012952017.1|2444893_2446624_+	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	54.0	3.0e-175
WP_003722606.1|2446731_2447607_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	29.7	1.9e-08
WP_003722605.1|2447608_2448577_+	YvcK family protein	NA	A1IMD5	Streptococcus_phage	43.3	6.7e-68
WP_003722604.1|2448584_2449556_+	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	39.4	5.2e-52
>prophage 169
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	2453472	2456242	2989591		Agrobacterium_phage(33.33%)	3	NA	NA
WP_003722600.1|2453472_2454069_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	57.4	6.6e-58
WP_012952014.1|2454225_2455659_+	hypothetical protein	NA	A0A2D1GD28	Mycobacterium_phage	29.1	8.3e-06
WP_012952013.1|2455906_2456242_-	membrane protein	NA	S5MNN8	Brevibacillus_phage	76.6	6.0e-16
>prophage 170
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	2468568	2469861	2989591		Streptococcus_phage(100.0%)	1	NA	NA
WP_003727923.1|2468568_2469861_+	phosphopyruvate hydratase	NA	W6LP63	Streptococcus_phage	71.7	2.3e-172
>prophage 171
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	2473286	2476148	2989591		Lactococcus_phage(50.0%)	2	NA	NA
WP_012952006.1|2473286_2475668_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	40.9	2.3e-93
WP_003723350.1|2475683_2476148_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	68.1	1.6e-51
>prophage 172
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	2487880	2489588	2989591		Streptococcus_phage(50.0%)	3	NA	NA
WP_012952000.1|2487880_2488777_+	YafY family transcriptional regulator	NA	A0A1B0RXM1	Streptococcus_phage	28.2	1.6e-07
WP_003732474.1|2488831_2489215_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009925285.1|2489246_2489588_-	YxeA family protein	NA	A0A0K2CYS5	Paenibacillus_phage	40.7	8.0e-08
>prophage 173
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	2496909	2506136	2989591		Bacillus_phage(40.0%)	11	NA	NA
WP_010989991.1|2496909_2497701_+	ABC transporter ATP-binding protein	NA	A0A1V0SJ29	Klosneuvirus	30.0	9.2e-15
WP_003723330.1|2497843_2499013_+	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_038406111.1|2499088_2500264_+	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_003723328.1|2500419_2500773_+	arsenate reductase family protein	NA	M1PLC0	Streptococcus_phage	57.8	6.5e-29
WP_003723327.1|2500813_2501191_+	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_003723326.1|2501275_2501560_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_003732468.1|2501752_2502628_+	cation transporter	NA	NA	NA	NA	NA
WP_003722450.1|2502702_2503398_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	42.7	3.8e-41
WP_012951998.1|2503387_2504530_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	25.7	5.0e-22
WP_003722448.1|2504608_2504797_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003722447.1|2505113_2506136_+	methionine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.2	5.0e-29
>prophage 174
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	2509158	2515565	2989591		Cedratvirus(25.0%)	7	NA	NA
WP_003722442.1|2509158_2509944_+	Fe-S cluster assembly ATPase SufC	NA	A0A285PWH2	Cedratvirus	28.1	2.1e-11
WP_012951997.1|2509962_2511264_+	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_012951996.1|2511264_2512491_+	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	44.9	4.3e-104
WP_003722439.1|2512487_2512931_+	SUF system NifU family Fe-S cluster assembly protein	NA	A0A2P1CJL8	Mycobacterium_phage	35.8	1.6e-13
WP_003722438.1|2512953_2514348_+	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_025370652.1|2514413_2514587_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003732461.1|2514722_2515565_+	DUF72 domain-containing protein	NA	A0A1D6Y809	Golden_Marseillevirus	28.6	2.7e-17
>prophage 175
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	2521249	2521750	2989591		Bacillus_virus(100.0%)	1	NA	NA
WP_003722422.1|2521249_2521750_-	phosphatidylglycerophosphatase A	NA	G3MBC5	Bacillus_virus	54.2	3.4e-39
>prophage 176
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	2527505	2528501	2989591		Streptococcus_phage(100.0%)	1	NA	NA
WP_012951989.1|2527505_2528501_-	NAD(P)/FAD-dependent oxidoreductase	NA	Q9JRK7	Streptococcus_phage	61.3	2.1e-40
>prophage 177
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	2541224	2544976	2989591		Aureococcus_anophage(50.0%)	5	NA	NA
WP_003722402.1|2541224_2541809_+	peptidyl-prolyl cis-trans isomerase	NA	A0A076FI46	Aureococcus_anophage	40.3	2.4e-28
WP_003733277.1|2541895_2542291_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012951985.1|2542332_2543694_-	aspartate kinase	NA	NA	NA	NA	NA
WP_003741107.1|2543938_2544253_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_003722398.1|2544295_2544976_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.2	1.1e-35
>prophage 178
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	2569409	2570651	2989591		Staphylococcus_phage(100.0%)	1	NA	NA
WP_012951979.1|2569409_2570651_+	MFS transporter	NA	A0A2H4PQR6	Staphylococcus_phage	36.8	6.2e-58
>prophage 179
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	2578876	2579656	2989591		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
WP_012951976.1|2578876_2579656_+	amino acid ABC transporter ATP-binding protein	NA	M1HV27	Acanthocystis_turfacea_Chlorella_virus	23.1	4.1e-07
>prophage 180
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	2585673	2586999	2989591		Phaeocystis_globosa_virus(100.0%)	1	NA	NA
WP_003731859.1|2585673_2586999_-	aminopeptidase C	NA	R4TV59	Phaeocystis_globosa_virus	38.0	8.6e-82
>prophage 181
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	2590891	2630991	2989591	terminase,holin,tail	Listeria_phage(96.23%)	59	NA	NA
WP_003739618.1|2590891_2591239_+	helix-turn-helix transcriptional regulator	NA	A0A0A7RTK4	Clostridium_phage	40.7	9.9e-06
WP_031645473.1|2591293_2591770_-	competence protein ComK	NA	NA	NA	NA	NA
WP_012951970.1|2591760_2593119_-	recombinase family protein	NA	Q8LTD8	Listeria_phage	99.8	1.1e-257
WP_012951969.1|2593179_2594694_-	ATP-dependent DNA helicase RecG	NA	NA	NA	NA	NA
WP_012951968.1|2594898_2595333_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038406113.1|2595391_2596099_-	hypothetical protein	NA	A0A0B5CTT6	Listeria_phage	98.7	1.5e-122
WP_012951966.1|2596125_2596617_-	hypothetical protein	NA	A8ATX4	Listeria_phage	99.4	2.9e-91
WP_012951965.1|2596647_2596953_-	helix-turn-helix transcriptional regulator	NA	A8ASM2	Listeria_phage	68.5	1.8e-27
WP_012951964.1|2597115_2597367_+	helix-turn-helix transcriptional regulator	NA	A8ASM3	Listeria_phage	76.7	9.3e-22
WP_003733687.1|2597370_2597565_+	hypothetical protein	NA	A0A059T6E5	Listeria_phage	95.3	1.4e-25
WP_012951963.1|2597523_2597883_-	DUF2513 domain-containing protein	NA	A0A2H4J4K9	uncultured_Caudovirales_phage	26.3	2.1e-06
WP_012951962.1|2597947_2598184_+	hypothetical protein	NA	A0A059T5E9	Listeria_phage	97.4	2.8e-36
WP_012951961.1|2598180_2598462_+	hypothetical protein	NA	A8ATX8	Listeria_phage	96.7	3.6e-38
WP_003733685.1|2598467_2598743_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012951960.1|2598724_2599501_+	phage antirepressor Ant	NA	A0A0B5D0I2	Listeria_phage	99.2	9.6e-142
WP_012951959.1|2599624_2600158_+	hypothetical protein	NA	A0A059T5F0	Listeria_phage	87.9	1.5e-77
WP_012951958.1|2600154_2600370_+	hypothetical protein	NA	Q9T176	Listeria_phage	93.0	9.7e-28
WP_003722564.1|2600478_2600667_+	hypothetical protein	NA	Q9T175	Listeria_phage	82.3	1.8e-22
WP_003734953.1|2600972_2601167_+	hypothetical protein	NA	A0A059T6E8	Listeria_phage	100.0	1.6e-29
WP_012951957.1|2601163_2601640_+	siphovirus Gp157 family protein	NA	A0A059T5F1	Listeria_phage	100.0	9.5e-76
WP_012951956.1|2601645_2602305_+	ERF family protein	NA	A8ASN3	Listeria_phage	94.1	5.3e-93
WP_012951955.1|2602321_2603305_+	DnaD domain protein	NA	A8ASN4	Listeria_phage	91.7	1.4e-166
WP_012951954.1|2603301_2603589_+	hypothetical protein	NA	A0A059T7V3	Listeria_phage	88.4	1.7e-40
WP_012951953.1|2603585_2604116_+	hypothetical protein	NA	A0A059T5F9	Listeria_phage	95.5	8.4e-97
WP_031645470.1|2604251_2604482_+	DUF3850 domain-containing protein	NA	A0A059T699	Listeria_phage	73.8	1.1e-18
WP_012951951.1|2604503_2604863_+	hypothetical protein	NA	A0A059T801	Listeria_phage	92.0	6.6e-45
WP_012951950.1|2604859_2605261_+	hypothetical protein	NA	A8ATZ6	Listeria_phage	75.9	1.4e-48
WP_012951949.1|2605257_2605737_+	single-stranded DNA-binding protein	NA	A8ATZ7	Listeria_phage	91.2	1.4e-74
WP_012951948.1|2605758_2606136_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031645468.1|2606163_2606346_+	hypothetical protein	NA	A8ASP6	Listeria_phage	81.0	2.9e-17
WP_012951947.1|2606290_2606695_+	DUF1064 domain-containing protein	NA	A8ASP7	Listeria_phage	89.6	1.9e-61
WP_012951946.1|2606698_2607082_+	DUF2481 family protein	NA	A0A0B5CYS3	Listeria_phage	96.1	5.7e-63
WP_012951945.1|2607222_2607657_+	hypothetical protein	NA	A8AU03	Listeria_phage	97.2	1.6e-74
WP_012951944.1|2607942_2608170_+	hypothetical protein	NA	A8AU06	Listeria_phage	100.0	1.5e-34
WP_012951943.1|2608209_2608950_+	hypothetical protein	NA	A0A0B5CTX0	Listeria_phage	99.6	2.4e-134
WP_012951942.1|2608942_2610262_+|terminase	PBSX family phage terminase large subunit	terminase	A8ATU6	Listeria_phage	99.3	2.9e-263
WP_012951941.1|2610276_2611833_+	hypothetical protein	NA	A8ATU7	Listeria_phage	97.9	9.4e-298
WP_012951940.1|2611837_2612881_+	hypothetical protein	NA	A0A0B5D111	Listeria_phage	96.5	1.9e-193
WP_003744996.1|2612976_2613531_+	hypothetical protein	NA	A8ATU9	Listeria_phage	99.5	1.1e-88
WP_012951939.1|2613553_2614426_+	hypothetical protein	NA	A8ATV0	Listeria_phage	99.0	3.0e-160
WP_012951937.1|2614607_2614961_+	hypothetical protein	NA	A8ATV2	Listeria_phage	100.0	7.6e-62
WP_003733695.1|2614960_2615326_+	hypothetical protein	NA	A8ATV3	Listeria_phage	99.2	9.9e-65
WP_012951936.1|2615315_2615633_+	HK97 gp10 family phage protein	NA	A8ATV4	Listeria_phage	98.1	2.4e-51
WP_010991155.1|2615629_2616001_+	hypothetical protein	NA	A0A0B5CTY4	Listeria_phage	99.2	5.5e-63
WP_012951935.1|2616005_2616692_+	Ig domain-containing protein	NA	A0A0B5CYK8	Listeria_phage	97.4	2.6e-114
WP_012951934.1|2616747_2617179_+	hypothetical protein	NA	A8ATV7	Listeria_phage	95.8	3.2e-70
WP_074046934.1|2617175_2617487_+	hypothetical protein	NA	A0A0B5D116	Listeria_phage	96.7	1.3e-41
WP_012951932.1|2617491_2622291_+|tail	phage tail tape measure protein	tail	A8ATV9	Listeria_phage	89.1	0.0e+00
WP_012951931.1|2622287_2623856_+	hypothetical protein	NA	A8ATW0	Listeria_phage	99.2	2.0e-303
WP_012951930.1|2623868_2626031_+	hypothetical protein	NA	A8ATW1	Listeria_phage	98.8	0.0e+00
WP_003722523.1|2626069_2626435_+	hypothetical protein	NA	Q9T1A0	Listeria_phage	100.0	7.4e-12
WP_003722522.1|2626447_2626729_+|holin	holin	holin	A8ASL4	Listeria_phage	94.6	3.4e-41
WP_012951929.1|2626728_2627574_+	peptidase M15	NA	A0A059T7Y8	Listeria_phage	92.6	1.4e-133
WP_003722520.1|2627614_2628388_-	DUF3825 domain-containing protein	NA	A8ATW5	Listeria_phage	100.0	9.5e-150
WP_012951928.1|2628662_2629160_-	AP2 domain-containing protein	NA	A8ATW6	Listeria_phage	90.9	4.9e-83
WP_012951927.1|2629171_2629600_-	transcriptional regulator	NA	A8ATJ2	Listeria_phage	87.3	3.9e-28
WP_012951926.1|2629601_2630006_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012951925.1|2630107_2630317_-	hypothetical protein	NA	A0A059T7Z0	Listeria_phage	97.1	5.5e-28
WP_012951924.1|2630757_2630991_+	hypothetical protein	NA	A0A059T6E1	Listeria_phage	94.8	8.0e-36
>prophage 182
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	2635575	2639283	2989591		Bacillus_virus(100.0%)	1	NA	NA
WP_038406114.1|2635575_2639283_+	helicase-exonuclease AddAB subunit AddA	NA	G3MA40	Bacillus_virus	27.6	1.8e-20
>prophage 183
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	2646748	2650835	2989591		Moraxella_phage(33.33%)	4	NA	NA
WP_003733871.1|2646748_2648041_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	33.1	4.2e-49
WP_003731867.1|2648213_2648843_+	HAD family hydrolase	NA	G3MA51	Bacillus_virus	34.4	4.0e-05
WP_038406115.1|2648885_2650034_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_003724134.1|2650109_2650835_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.0	4.4e-32
>prophage 184
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	2654499	2658524	2989591		Indivirus(33.33%)	6	NA	NA
WP_012951917.1|2654499_2655384_+	aldo/keto reductase	NA	A0A1V0SDE7	Indivirus	29.7	9.5e-29
WP_003723378.1|2655380_2656037_+	DNA alkylation repair protein	NA	NA	NA	NA	NA
WP_003723377.1|2656038_2656431_+	hypothetical protein	NA	V5UQY3	Oenococcus_phage	51.2	1.1e-32
WP_003731874.1|2656443_2657313_-	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_010989933.1|2657329_2657896_-	methylphosphotriester-DNA--protein-cysteine methyltransferase family protein	NA	NA	NA	NA	NA
WP_012951915.1|2658041_2658524_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A0G2Y3R2	Acanthamoeba_polyphaga_mimivirus	42.6	3.7e-19
>prophage 185
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	2674253	2675159	2989591		Staphylococcus_phage(100.0%)	1	NA	NA
WP_003731881.1|2674253_2675159_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	39.7	4.7e-31
>prophage 186
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	2678705	2679059	2989591		Streptococcus_phage(100.0%)	1	NA	NA
WP_003723354.1|2678705_2679059_+	YlbF/YmcA family competence regulator	NA	A0A1X9I5Y8	Streptococcus_phage	32.4	3.1e-07
>prophage 187
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	2686295	2687631	2989591		Mycobacterium_phage(50.0%)	2	NA	NA
WP_003723834.1|2686295_2686718_-	HIT family protein	NA	B5LJ12	Mycobacterium_phage	33.6	9.9e-08
WP_003723833.1|2686878_2687631_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	31.1	2.9e-26
>prophage 188
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	2694742	2699851	2989591		Cronobacter_phage(50.0%)	4	NA	NA
WP_012951904.1|2694742_2697343_+	ATP-dependent chaperone ClpB	NA	K4FB40	Cronobacter_phage	37.7	8.8e-123
WP_003723823.1|2697433_2698123_+	2,3-diphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_003763532.1|2698212_2698401_-	YjzD family protein	NA	NA	NA	NA	NA
WP_012951903.1|2698723_2699851_+	GW domain-containing glycosaminoglycan-binding protein	NA	S5M633	Brevibacillus_phage	45.5	1.1e-24
>prophage 189
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	2709617	2716377	2989591		Planktothrix_phage(33.33%)	6	NA	NA
WP_012951901.1|2709617_2710694_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.3	8.4e-19
WP_003722315.1|2710690_2711659_+	ATP-binding cassette domain-containing protein	NA	F2Y1V6	Organic_Lake_phycodnavirus	28.0	6.6e-07
WP_003720569.1|2711977_2712373_+	transcriptional regulator Spx	NA	NA	NA	NA	NA
WP_003722314.1|2712604_2713258_+	adaptor protein MecA	NA	NA	NA	NA	NA
WP_003734058.1|2713383_2714499_+	CoiA	NA	NA	NA	NA	NA
WP_003722312.1|2714571_2716377_+	oligoendopeptidase F	NA	A0A1X9I5X5	Streptococcus_phage	28.5	1.1e-66
>prophage 190
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	2721412	2723473	2989591		Klosneuvirus(50.0%)	3	NA	NA
WP_009914264.1|2721412_2722192_+	ABC transporter ATP-binding protein	NA	A0A1V0SJ29	Klosneuvirus	29.2	9.6e-17
WP_003731903.1|2722195_2722936_+	class B sortase	NA	NA	NA	NA	NA
WP_038406117.1|2722996_2723473_+	siphovirus Gp157 family protein	NA	A0A059T5F1	Listeria_phage	48.1	2.9e-32
>prophage 191
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	2733361	2735369	2989591		Acanthamoeba_polyphaga_mimivirus(50.0%)	2	NA	NA
WP_003722299.1|2733361_2734123_+	SDR family oxidoreductase	NA	A0A0G2Y8L6	Acanthamoeba_polyphaga_mimivirus	31.9	6.3e-05
WP_003722298.1|2734295_2735369_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	36.8	5.8e-20
>prophage 192
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	2741575	2742193	2989591		Streptococcus_phage(100.0%)	1	NA	NA
WP_003731912.1|2741575_2742193_+	MBL fold metallo-hydrolase	NA	A0A1X9I5D3	Streptococcus_phage	47.1	6.4e-48
>prophage 193
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	2749888	2758032	2989591		Listeria_phage(80.0%)	8	NA	NA
WP_038406118.1|2749888_2751808_+	MBL fold metallo-hydrolase	NA	A0A2P0VMX1	Tetraselmis_virus	46.6	6.9e-157
WP_003722280.1|2751862_2752204_-	YxeA family protein	NA	NA	NA	NA	NA
WP_003722279.1|2752740_2755032_+	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A060AGL6	Listeria_phage	72.8	0.0e+00
WP_003729560.1|2755087_2756137_+	ribonucleotide-diphosphate reductase subunit beta	NA	A0A059T7I4	Listeria_phage	85.1	2.1e-168
WP_003722277.1|2756133_2756571_+	flavodoxin	NA	A0A060AFY8	Listeria_phage	38.6	2.5e-22
WP_003722276.1|2756567_2756894_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_003722274.1|2757339_2757516_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003722273.1|2757714_2758032_+	nucleoside triphosphate pyrophosphohydrolase family protein	NA	A0A1S7FYY8	Listeria_phage	58.4	2.2e-28
>prophage 194
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	2767645	2768548	2989591		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_003722263.1|2767645_2768548_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.9	2.0e-21
>prophage 195
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	2794142	2798221	2989591		Lactobacillus_phage(50.0%)	4	NA	NA
WP_009931149.1|2794142_2794604_-	GNAT family N-acetyltransferase	NA	E9LUK4	Lactobacillus_phage	41.4	1.1e-23
WP_012951887.1|2794664_2795489_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003722375.1|2795526_2797467_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003722374.1|2797453_2798221_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.0	3.7e-29
>prophage 196
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	2810662	2812108	2989591		Streptococcus_phage(100.0%)	1	NA	NA
WP_009925710.1|2810662_2812108_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	24.1	4.9e-22
>prophage 197
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	2818274	2823812	2989591		Vibrio_phage(50.0%)	4	NA	NA
WP_012951881.1|2818274_2819798_-	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	24.9	3.9e-22
WP_003722348.1|2819965_2821336_-	argininosuccinate lyase	NA	NA	NA	NA	NA
WP_003722347.1|2821339_2822554_-	argininosuccinate synthase	NA	NA	NA	NA	NA
WP_012951880.1|2822768_2823812_+	alpha/beta hydrolase	NA	M1PGN2	Moumouvirus	31.5	2.0e-33
>prophage 198
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	2829780	2865439	2989591	capsid,terminase,head,integrase,tail,portal	Enterococcus_phage(20.69%)	43	2829594:2829645	2866640:2866691
2829594:2829645	attL	TGCGGCCGAGAGGACTTGAACCTCCACGGGTTTTACCCCACTAGGCCCTCAA	NA	NA	NA	NA
WP_038406120.1|2829780_2830929_-|integrase	site-specific integrase	integrase	A0A1S7FYW5	Listeria_phage	39.8	3.1e-72
WP_051962043.1|2830966_2831608_-	DUF4428 domain-containing protein	NA	X5JB37	Clostridium_phage	46.2	5.7e-15
WP_038406122.1|2831951_2832443_-	helix-turn-helix transcriptional regulator	NA	A0A059T6G1	Listeria_phage	49.5	7.4e-23
WP_038406123.1|2832710_2832896_+	helix-turn-helix domain-containing protein	NA	Q5YAA3	Bacillus_phage	46.7	3.6e-07
WP_038406124.1|2832909_2833161_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_144242132.1|2833169_2833349_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038406126.1|2833539_2833725_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038406127.1|2833721_2834102_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038406128.1|2834108_2834720_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038406129.1|2834716_2835877_+	DUF2800 domain-containing protein	NA	S5MUB5	Brevibacillus_phage	54.5	6.3e-105
WP_038406130.1|2835893_2836463_+	DUF2815 family protein	NA	D2J040	Enterococcus_phage	60.0	8.8e-52
WP_038406132.1|2836695_2838723_+	hypothetical protein	NA	D2J043	Enterococcus_phage	53.2	8.5e-198
WP_038406134.1|2838735_2839275_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038406136.1|2839464_2840271_+	hypothetical protein	NA	A0A0A7NQP6	Lactobacillus_phage	51.9	1.5e-09
WP_038406138.1|2840813_2843231_+	phage-like protein	NA	D2J048	Enterococcus_phage	57.9	6.8e-287
WP_038406139.1|2843498_2843777_+	VRR-NUC domain-containing protein	NA	Q4ZD25	Staphylococcus_phage	50.0	6.2e-19
WP_038406140.1|2843773_2845135_+	DEAD/DEAH box helicase	NA	D2J050	Enterococcus_phage	63.4	2.8e-168
WP_038406141.1|2845127_2845322_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038406142.1|2845321_2845864_+	hypothetical protein	NA	A0A1S7FZ07	Listeria_phage	36.7	2.6e-21
WP_051962044.1|2845978_2846296_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A1X9I661	Streptococcus_phage	55.1	1.5e-16
WP_038406144.1|2846265_2846772_+	hypothetical protein	NA	A0A090DCM3	Clostridium_phage	48.5	5.6e-34
WP_038406145.1|2846771_2848208_+|terminase	phage terminase large subunit	terminase	A0A1S5SAP0	Streptococcus_phage	58.9	8.5e-160
WP_144242136.1|2848365_2849916_+|portal	phage portal protein	portal	A0A097BY86	Enterococcus_phage	57.7	3.6e-132
WP_051962045.1|2849902_2851525_+|capsid	minor capsid protein	capsid	A0A1P8BKT0	Lactococcus_phage	42.6	3.7e-55
WP_077915871.1|2851798_2852386_+	DUF4355 domain-containing protein	NA	NA	NA	NA	NA
WP_038406149.1|2852401_2853295_+|capsid	phage major capsid protein	capsid	A0A1B1V000	Enterococcus_phage	61.0	9.8e-98
WP_051962047.1|2853309_2853606_+	hypothetical protein	NA	A0A0S2SXV2	Bacillus_phage	55.9	4.5e-07
WP_038406151.1|2853613_2853937_+|head,tail	phage head-tail connector protein	head,tail	A0A1P8BMC5	Lactococcus_phage	51.7	1.8e-17
WP_038406152.1|2853933_2854233_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038406153.1|2854232_2854565_+	hypothetical protein	NA	A0A1L2K255	Streptococcus_phage	50.0	2.0e-16
WP_038406154.1|2854561_2854948_+	DUF3168 domain-containing protein	NA	A0A2P1JTV2	Anoxybacillus_phage	42.9	9.9e-23
WP_038406155.1|2854960_2855476_+|tail	phage major tail protein, TP901-1 family	tail	L0P2Q8	Streptococcus_phage	61.0	2.7e-44
WP_038406156.1|2855543_2855888_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038406157.1|2856001_2856301_+	hypothetical protein	NA	A0A1P8BLR3	Lactococcus_phage	45.7	1.1e-10
WP_051962049.1|2856293_2860814_+	tape measure protein	NA	A0A0B5CU25	Listeria_phage	58.6	3.3e-69
WP_051962050.1|2860815_2861580_+	hypothetical protein	NA	A0A286QN36	Streptococcus_phage	41.0	1.7e-45
WP_038406160.1|2861580_2863023_+	hypothetical protein	NA	A0A1X9IGI5	Lactococcus_phage	38.3	4.3e-71
WP_051962051.1|2863023_2863650_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144242135.1|2863646_2864021_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038406163.1|2864025_2864520_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039847054.1|2864536_2864866_+	DUF2977 domain-containing protein	NA	NA	NA	NA	NA
WP_077915873.1|2864866_2864992_+	XkdX family protein	NA	A0A059T6D9	Listeria_phage	72.5	1.2e-09
WP_038406164.1|2865016_2865439_+	hypothetical protein	NA	D7RWK5	Brochothrix_phage	34.7	2.7e-05
2866640:2866691	attR	TGCGGCCGAGAGGACTTGAACCTCCACGGGTTTTACCCCACTAGGCCCTCAA	NA	NA	NA	NA
>prophage 199
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	2872664	2882460	2989591	protease,tRNA	uncultured_virus(40.0%)	9	NA	NA
WP_003731954.1|2872664_2873687_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	42.3	8.1e-64
WP_012951871.1|2874230_2875190_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_012951870.1|2875213_2877166_-	ABC-F type ribosomal protection protein	NA	A0A2K9L0W2	Tupanvirus	29.3	7.4e-58
WP_003722329.1|2877476_2878124_+	redox-sensing transcriptional repressor Rex	NA	NA	NA	NA	NA
WP_003722328.1|2878150_2878354_-	DUF4305 domain-containing protein	NA	NA	NA	NA	NA
WP_003731957.1|2878355_2879042_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003726504.1|2879277_2879562_+	co-chaperone GroES	NA	A0A221S3C8	uncultured_virus	54.3	9.8e-20
WP_003726503.1|2879597_2881226_+	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	57.0	1.8e-158
WP_012951869.1|2881482_2882460_+	choloylglycine hydrolase family protein	NA	M1HS66	Paramecium_bursaria_Chlorella_virus	29.2	7.8e-24
>prophage 200
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	2887095	2896498	2989591		uncultured_Mediterranean_phage(50.0%)	10	NA	NA
WP_012951866.1|2887095_2887839_-	potassium channel family protein	NA	A0A1B0Y2S3	Lactobacillus_phage	32.4	4.7e-13
WP_003731964.1|2887946_2888864_-	heme A synthase	NA	NA	NA	NA	NA
WP_003731965.1|2889100_2890006_+	protoheme IX farnesyltransferase	NA	NA	NA	NA	NA
WP_031645478.1|2890152_2891208_+	CAP domain-containing protein	NA	A0A0E3T7R5	Bacillus_phage	34.9	2.5e-15
WP_003724095.1|2891255_2891705_+	YlbF family regulator	NA	NA	NA	NA	NA
WP_003726138.1|2891735_2892017_+	YlbG family protein	NA	NA	NA	NA	NA
WP_003731966.1|2892113_2892671_+	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_012951864.1|2892673_2893156_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	43.5	1.4e-26
WP_012951863.1|2893174_2894215_+	PDZ domain-containing protein	NA	NA	NA	NA	NA
WP_012951862.1|2894257_2896498_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	34.6	1.6e-141
>prophage 201
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	2923578	2932765	2989591	tRNA	Paramecium_bursaria_Chlorella_virus(25.0%)	8	NA	NA
WP_012951847.1|2923578_2925033_-	L-aspartate oxidase	NA	M1HTN0	Paramecium_bursaria_Chlorella_virus	27.3	4.0e-24
WP_012951846.1|2925164_2926271_+	cysteine desulfurase	NA	A0A2K9L2Y3	Tupanvirus	23.5	7.8e-12
WP_012951845.1|2926275_2926797_+	transcription repressor NadR	NA	NA	NA	NA	NA
WP_003723184.1|2926890_2927418_+	DivIVA domain-containing protein	NA	NA	NA	NA	NA
WP_038406165.1|2927700_2930466_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SJ93	Klosneuvirus	27.9	2.8e-87
WP_010989871.1|2930577_2931567_+	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_003739396.1|2931580_2932276_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_003723180.1|2932564_2932765_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	66.2	1.7e-18
>prophage 202
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	2959882	2961184	2989591		Geobacillus_virus(100.0%)	1	NA	NA
WP_012951836.1|2959882_2961184_+	pyrimidine-nucleoside phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	59.2	2.3e-132
>prophage 203
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	2966432	2971435	2989591		Micromonas_sp._RCC1109_virus(50.0%)	4	NA	NA
WP_003723152.1|2966432_2967971_-	2-isopropylmalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	25.5	8.6e-09
WP_012951833.1|2968128_2969124_-	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_003723150.1|2969221_2969713_-	acetolactate synthase small subunit	NA	NA	NA	NA	NA
WP_012951831.1|2969713_2971435_-	biosynthetic-type acetolactate synthase large subunit	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	29.1	9.5e-57
>prophage 204
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	2975524	2977000	2989591		Cyanophage(100.0%)	1	NA	NA
WP_012951829.1|2975524_2977000_-	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	36.2	8.6e-83
>prophage 205
NZ_CP009258	Listeria monocytogenes strain Lm60 chromosome, complete genome	2989591	2985529	2988199	2989591		Lactobacillus_phage(100.0%)	3	NA	NA
WP_003723133.1|2985529_2986729_-	toxic anion resistance protein	NA	A0A291I9K4	Lactobacillus_phage	29.1	8.4e-36
WP_003723132.1|2986706_2987366_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003723131.1|2987641_2988199_+	NUDIX hydrolase	NA	A0A2K9VDH1	Lactobacillus_phage	34.8	5.3e-17
