The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP009102	Salmonella enterica subsp. enterica serovar Typhimurium strain ATCC 13311 chromosome, complete genome	4793299	944840	953572	4793299	protease,transposase	Dickeya_phage(14.29%)	7	NA	NA
WP_001201751.1|944840_945959_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
WP_000125877.1|945955_947902_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
WP_000447499.1|948031_948253_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000520789.1|948576_948897_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000934063.1|948927_951204_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_000502119.1|951395_951854_+|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
WP_085983316.1|952316_953572_-|transposase	IS3-like element ISSen1 family transposase	transposase	Q6H9S3	Enterobacteria_phage	33.9	5.4e-17
>prophage 2
NZ_CP009102	Salmonella enterica subsp. enterica serovar Typhimurium strain ATCC 13311 chromosome, complete genome	4793299	1003635	1102486	4793299	tRNA,holin,portal,integrase,protease,lysis,terminase,tail	Salmonella_phage(43.64%)	100	1006544:1006563	1078374:1078393
WP_001154025.1|1003635_1004439_+|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_001288828.1|1004431_1005754_+	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_000060025.1|1005734_1006439_+	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_000572724.1|1006438_1010905_+	chromosome partition protein MukB	NA	NA	NA	NA	NA
1006544:1006563	attL	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
WP_000925872.1|1011249_1013091_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000357052.1|1013350_1013899_+	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	1.2e-05
WP_001109471.1|1013926_1014574_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_000462653.1|1014635_1015826_-	aspartate transaminase	NA	NA	NA	NA	NA
WP_000977713.1|1016010_1017102_-	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	51.7	2.2e-99
WP_000117870.1|1017708_1019109_-|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	35.1	4.5e-81
WP_000762342.1|1019309_1019771_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000544849.1|1020087_1021302_+	diaminopropionate ammonia-lyase	NA	NA	NA	NA	NA
WP_000893207.1|1021546_1022983_+	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_000191399.1|1023060_1024263_-	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001262306.1|1024457_1025750_-|integrase	site-specific integrase	integrase	S4TSP2	Salmonella_phage	99.8	1.0e-252
WP_000065276.1|1025794_1026043_-	excisionase family protein	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
WP_001237031.1|1026083_1026323_-	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_001539618.1|1026365_1027523_-	recombinase RecT	NA	S4TTE8	Salmonella_phage	100.0	1.6e-217
WP_038406260.1|1027485_1030413_-	exodeoxyribonuclease	NA	H6WRX1	Salmonella_phage	99.1	0.0e+00
WP_001668146.1|1030539_1030839_-	hypothetical protein	NA	S4TSN6	Salmonella_phage	84.5	8.1e-49
WP_000917564.1|1030860_1031019_-	hypothetical protein	NA	H6WRX3	Salmonella_phage	98.1	1.2e-22
WP_010989002.1|1031011_1031272_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001038966.1|1031321_1031732_-	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	42.4	8.1e-07
WP_000370145.1|1031851_1032091_+	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	47.2	8.3e-12
WP_001574095.1|1032056_1032431_+	hypothetical protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
WP_000062941.1|1032515_1033499_+	hypothetical protein	NA	H6WRX7	Salmonella_phage	100.0	1.9e-163
WP_000800010.1|1033501_1034251_+	ATP-binding protein	NA	S4TNF5	Salmonella_phage	99.6	3.6e-138
WP_025840282.1|1034261_1034609_+	DUF977 family protein	NA	H6WRX9	Salmonella_phage	88.7	1.6e-51
WP_000065108.1|1034605_1034917_+	ead/Ea22-like family protein	NA	A0A220NQV2	Salmonella_phage	97.2	7.2e-32
WP_014343823.1|1034994_1035285_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001217665.1|1035576_1035810_+	DinI family protein	NA	H6WRY5	Salmonella_phage	98.7	2.1e-36
WP_000807548.1|1035921_1036143_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000929805.1|1036225_1036828_+	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	98.5	8.3e-109
WP_001096552.1|1037036_1037648_+	hypothetical protein	NA	A0A0M4RU10	Salmonella_phage	91.6	6.9e-79
WP_001617856.1|1037644_1037791_+	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	97.9	4.3e-19
WP_001047631.1|1037780_1038578_+	antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.6	2.3e-151
WP_010989004.1|1038644_1038962_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001534733.1|1039135_1039261_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000798705.1|1039396_1039846_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001141973.1|1040206_1040893_-|protease	type III secretion system effector protease GtgA	protease	Q9MBM0	Phage_Gifsy-2	100.0	2.1e-132
WP_001574216.1|1041168_1041498_+|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_000984586.1|1041481_1041934_+	lysozyme	NA	A0A0M4R365	Salmonella_phage	97.3	2.3e-79
WP_001541990.1|1041951_1042431_+|lysis	lysis protein	lysis	Q56118	Enterobacteria_phage	77.0	1.4e-55
WP_000371784.1|1042638_1043172_+	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	48.1	1.0e-33
WP_077915889.1|1043128_1045267_+|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	72.5	2.2e-289
WP_000196190.1|1045263_1045470_+	hypothetical protein	NA	A0A1W6JT66	Pseudomonas_phage	53.3	2.9e-05
WP_001009207.1|1045466_1047014_+|portal	phage portal protein	portal	A0A291AWU2	Escherichia_phage	64.3	2.8e-177
WP_010989008.1|1046937_1049019_+|protease	Clp protease ClpP	protease	A0A291AWT6	Escherichia_phage	69.5	4.8e-265
WP_001107908.1|1049109_1049433_+	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	61.3	7.7e-29
WP_000774239.1|1049425_1049725_+	ATP-binding protein	NA	K7PH43	Enterobacteria_phage	45.1	4.5e-15
WP_000453194.1|1049705_1050272_+|tail	phage tail protein	tail	Q9G063	Phage_Gifsy-2	97.8	9.5e-14
WP_000196702.1|1050268_1050670_+|tail	tail protein	tail	K7PHM6	Enterobacterial_phage	60.9	1.5e-42
WP_000132756.1|1050681_1051431_+|tail	tail protein	tail	A0A291AWU6	Escherichia_phage	68.6	3.7e-90
WP_000478859.1|1051476_1051875_+|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	56.8	8.6e-30
WP_010989009.1|1051871_1052201_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	50.9	5.0e-23
WP_077915896.1|1052280_1055268_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.1	1.1e-265
WP_000978296.1|1055264_1055597_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	61.5	3.3e-35
WP_000725267.1|1055695_1056193_+	outer membrane beta-barrel protein	NA	A0A1B0VBR9	Salmonella_phage	36.6	1.4e-16
WP_000877926.1|1056309_1056843_-	superoxide dismutase [Cu-Zn]	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
WP_001152415.1|1056932_1057628_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.7	1.3e-89
WP_000606351.1|1057637_1058375_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	76.1	1.6e-114
WP_000246065.1|1058272_1058977_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	62.6	9.2e-67
WP_038406265.1|1059048_1062399_+	host specificity protein J	NA	A0A0K2FI38	Escherichia_phage	68.6	0.0e+00
WP_000178849.1|1062437_1062680_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001144679.1|1062733_1065172_+|tail	tail protein	tail	A0A0K2FIZ6	Escherichia_phage	63.4	2.9e-91
WP_000143167.1|1065171_1065753_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	89.5	1.7e-95
WP_001533476.1|1066228_1067197_+	SPI-2 type III secretion system effector SseI	NA	Q9MBL9	Phage_Gifsy-2	99.7	7.9e-194
WP_010989011.1|1068539_1068839_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001525490.1|1068823_1069510_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000497441.1|1069780_1069972_-	DinI-like family protein	NA	S4TNM0	Salmonella_phage	95.2	6.2e-26
WP_000193784.1|1070398_1073011_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	6.3e-20
WP_000291723.1|1073218_1074229_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_001220671.1|1074394_1074937_+	cell division protein ZapC	NA	NA	NA	NA	NA
WP_000224069.1|1074933_1076043_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_001086485.1|1076141_1078250_+	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_000053044.1|1078262_1080170_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
1078374:1078393	attR	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
WP_000333152.1|1080184_1081438_+	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000433414.1|1081442_1083083_+	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000759136.1|1083079_1083643_+	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_001537784.1|1083898_1084066_+	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000227928.1|1084165_1084684_-	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_000156454.1|1084752_1086513_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000877172.1|1086698_1087151_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_001674965.1|1087222_1088275_-	porin OmpA	NA	NA	NA	NA	NA
WP_000288732.1|1088631_1089141_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_001202375.1|1089357_1089963_+	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_000950880.1|1089949_1092103_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001261222.1|1092121_1092568_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000420505.1|1092691_1094746_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	8.5e-20
WP_000424187.1|1094781_1095240_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000847719.1|1095334_1095997_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_001537782.1|1096170_1096584_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_000561983.1|1096628_1096946_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000140480.1|1097003_1098215_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000859419.1|1098429_1098978_+	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_000548082.1|1099003_1099783_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000072884.1|1099831_1100113_+	acylphosphatase	NA	NA	NA	NA	NA
WP_000904446.1|1100109_1100439_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000374050.1|1100525_1101185_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	51.9	2.3e-43
WP_000938191.1|1101805_1102486_-|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	70.6	8.3e-81
>prophage 3
NZ_CP009102	Salmonella enterica subsp. enterica serovar Typhimurium strain ATCC 13311 chromosome, complete genome	4793299	1890086	1896895	4793299	integrase,tail	Salmonella_phage(33.33%)	11	1884950:1884972	1894664:1894686
1884950:1884972	attL	AAAAAGAGACCGAATACGATTCC	NA	NA	NA	NA
WP_000275418.1|1890086_1890968_-|tail	tail assembly protein	tail	A0A0M4RTP2	Salmonella_phage	76.0	2.2e-65
WP_001521334.1|1891440_1891629_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000789530.1|1891693_1891861_+	lytic enzyme	NA	NA	NA	NA	NA
WP_001050882.1|1892117_1892651_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	48.3	1.4e-11
WP_001013467.1|1892704_1892935_-	hypothetical protein	NA	Q8HA86	Salmonella_phage	93.7	6.1e-28
WP_010989030.1|1893124_1893619_+	hypothetical protein	NA	A0A0U2I1R6	Escherichia_phage	68.9	8.2e-22
WP_001520095.1|1893678_1894533_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	50.9	3.6e-73
WP_000722368.1|1894906_1895260_-	YebY family protein	NA	NA	NA	NA	NA
1894664:1894686	attR	AAAAAGAGACCGAATACGATTCC	NA	NA	NA	NA
WP_025840204.1|1895276_1896152_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000168393.1|1896152_1896527_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000856224.1|1896664_1896895_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	2.9e-14
>prophage 4
NZ_CP009102	Salmonella enterica subsp. enterica serovar Typhimurium strain ATCC 13311 chromosome, complete genome	4793299	1972345	2053104	4793299	capsid,plate,tail,holin,portal,integrase,protease,lysis,head,terminase,transposase	Salmonella_phage(68.25%)	100	1978883:1978898	2054727:2054742
WP_000502119.1|1972345_1972804_-|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
WP_000659236.1|1972984_1974190_-	lysine-N-methylase	NA	NA	NA	NA	NA
WP_000079805.1|1974268_1975756_-	FliC/FljB family flagellin	NA	NA	NA	NA	NA
WP_000146802.1|1976012_1977416_+	flagellar filament capping protein FliD	NA	NA	NA	NA	NA
WP_000287764.1|1977430_1977838_+	flagellar export chaperone FliS	NA	NA	NA	NA	NA
WP_000204899.1|1977837_1978206_+	flagella biosynthesis regulatory protein FliT	NA	NA	NA	NA	NA
WP_000795487.1|1978277_1979762_+	alpha-amylase	NA	NA	NA	NA	NA
1978883:1978898	attL	TGAAAATATCGATTTT	NA	NA	NA	NA
WP_000754695.1|1979801_1980227_-	lipoprotein	NA	NA	NA	NA	NA
WP_001535233.1|1980412_1981618_+	selenium metabolism membrane protein YedE/FdhT	NA	NA	NA	NA	NA
WP_000790504.1|1981614_1981848_+	sulfurtransferase-like selenium metabolism protein YedF	NA	NA	NA	NA	NA
WP_000639596.1|1982112_1982499_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000719036.1|1982618_1982933_-	flagellar hook-basal body complex protein FliE	NA	NA	NA	NA	NA
WP_001276834.1|1983149_1984832_+	flagellar basal body M-ring protein FliF	NA	NA	NA	NA	NA
WP_000067735.1|1984824_1985820_+	flagellar motor switch protein FliG	NA	NA	NA	NA	NA
WP_000064163.1|1985812_1986520_+	flagellar assembly protein FliH	NA	NA	NA	NA	NA
WP_000213257.1|1986519_1987890_+	flagellum-specific ATP synthase FliI	NA	NA	NA	NA	NA
WP_000046981.1|1987911_1988355_+	flagella biosynthesis chaperone FliJ	NA	NA	NA	NA	NA
WP_000631669.1|1988351_1989569_+	flagellar hook length control protein FliK	NA	NA	NA	NA	NA
WP_000132169.1|1989673_1990141_+	flagellar basal body-associated protein FliL	NA	NA	NA	NA	NA
WP_000502811.1|1990145_1991150_+	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
WP_001282115.1|1991146_1991560_+	flagellar motor switch protein FliN	NA	NA	NA	NA	NA
WP_000978276.1|1991559_1991937_+	flagellar type III secretion system protein FliO	NA	NA	NA	NA	NA
WP_001253410.1|1991936_1992674_+	flagellar type III secretion system pore protein FliP	NA	NA	NA	NA	NA
WP_000187355.1|1992683_1992953_+	flagellar biosynthesis protein FliQ	NA	NA	NA	NA	NA
WP_000616953.1|1992961_1993756_+	flagellar type III secretion system protein FliR	NA	NA	NA	NA	NA
WP_000103974.1|1994037_1994661_+	transcriptional regulator RcsA	NA	NA	NA	NA	NA
WP_071524019.1|1994699_1994948_-	protein DsrB	NA	NA	NA	NA	NA
WP_000844798.1|1995022_1995250_+	YodD family peroxide/acid resistance protein	NA	NA	NA	NA	NA
WP_000948794.1|1995559_1996375_+	mannosyl-3-phosphoglycerate phosphatase-related protein	NA	NA	NA	NA	NA
WP_001119821.1|1996353_1998066_-	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	37.4	1.2e-19
WP_001178599.1|1998230_1998476_-	YodC family protein	NA	NA	NA	NA	NA
WP_000929134.1|1998492_1999404_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_001212264.1|1999579_2000500_+	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_000785978.1|2000488_2000959_-	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	46.9	1.2e-30
WP_001157322.1|2000939_2002370_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
WP_025840256.1|2002443_2003139_-	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	28.2	2.8e-07
WP_000107430.1|2003230_2003530_-	membrane protein	NA	NA	NA	NA	NA
WP_001080680.1|2004179_2005376_+	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.1	1.8e-110
WP_024131109.1|2005636_2005825_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000208509.1|2005835_2006048_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_000457662.1|2006502_2007771_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	92.2	4.2e-227
WP_000394196.1|2007773_2008193_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_000500831.1|2008319_2008481_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001093793.1|2009674_2009887_+	hypothetical protein	NA	A0A192Y5V6	Salmonella_phage	100.0	2.7e-30
WP_000842532.1|2009883_2010297_+	hypothetical protein	NA	A0A192Y6F0	Salmonella_phage	100.0	2.9e-73
WP_122815478.1|2010344_2010458_+	hypothetical protein	NA	A0A1C9IHU6	Salmonella_phage	100.0	4.3e-11
WP_000836773.1|2010532_2010766_+	hypothetical protein	NA	A0A192Y6D5	Salmonella_phage	100.0	1.2e-36
WP_022742744.1|2010879_2011485_-|tail	tail fiber assembly protein	tail	A0A192Y8L2	Salmonella_phage	100.0	2.7e-107
WP_000554735.1|2011454_2013017_-	hypothetical protein	NA	A0A192Y7M1	Salmonella_phage	98.5	1.7e-283
WP_001207832.1|2013003_2013591_-	DUF2313 domain-containing protein	NA	A0A192Y5V3	Salmonella_phage	100.0	2.9e-114
WP_038406279.1|2013593_2014673_-|plate	baseplate J/gp47 family protein	plate	A0A192Y6E4	Salmonella_phage	99.2	2.7e-203
WP_000605051.1|2014665_2015079_-	hypothetical protein	NA	A0A192Y6D0	Salmonella_phage	100.0	3.1e-75
WP_001273652.1|2015083_2015617_-|plate	phage baseplate assembly protein	plate	Q8HAB9	Salmonella_phage	98.3	5.5e-96
WP_001066633.1|2015616_2016675_-|plate	baseplate protein	plate	A0A192Y7L7	Salmonella_phage	99.7	5.0e-202
WP_038406280.1|2016671_2018012_-	DNA circularization protein	NA	A0A192Y5U9	Salmonella_phage	99.1	2.8e-250
WP_001033736.1|2018071_2018521_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000785381.1|2018537_2020463_-|tail	phage tail tape measure protein	tail	Q8HAC2	Salmonella_phage	97.3	0.0e+00
WP_000588852.1|2020547_2020874_-|tail	phage tail assembly protein	tail	Q8HAC3	Salmonella_phage	99.1	2.3e-52
WP_000515952.1|2020870_2021227_-|tail	tail protein	tail	A0A192Y8K0	Salmonella_phage	100.0	2.6e-62
WP_001007988.1|2021226_2022723_-|tail	tail sheath protein	tail	Q8HAC5	Salmonella_phage	99.2	1.2e-276
WP_000497755.1|2022712_2022877_-	DUF2635 domain-containing protein	NA	Q8HAC6	Salmonella_phage	96.3	8.4e-24
WP_001179802.1|2023439_2023952_-	hypothetical protein	NA	Q8HAC8	Salmonella_phage	86.5	3.1e-80
WP_001255650.1|2023923_2024337_-|head	phage head closure protein	head	A0A192Y6C2	Salmonella_phage	74.8	3.5e-50
WP_000901160.1|2024348_2024672_-|head,tail	phage gp6-like head-tail connector protein	head,tail	K7PKT4	Enterobacteria_phage	56.5	8.3e-31
WP_023232348.1|2024671_2024905_-	hypothetical protein	NA	K7PHI6	Enterobacteria_phage	66.0	2.6e-10
WP_000005722.1|2024948_2026166_-|capsid	phage major capsid protein	capsid	K7PM57	Enterobacteria_phage	87.4	1.4e-195
WP_000039021.1|2026175_2027024_-|protease	Clp protease ClpP	protease	K7PH05	Enterobacteria_phage	88.2	4.4e-132
WP_000002707.1|2027037_2028342_-|portal	phage portal protein	portal	K7PJU5	Enterobacteria_phage	85.9	6.2e-218
WP_000229716.1|2028341_2030084_-|terminase	terminase large subunit	terminase	A0A0U2C138	Paracoccus_phage	44.5	5.3e-140
WP_000919034.1|2030037_2030502_-|terminase	phage terminase small subunit P27 family	terminase	Q9B019	Phage_GMSE-1	62.1	1.3e-48
WP_000165395.1|2030634_2031024_-	HNH endonuclease	NA	K7P6U5	Enterobacteria_phage	72.1	1.4e-45
WP_000268746.1|2031074_2031398_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077906432.1|2031882_2032326_-|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	83.9	5.4e-57
WP_001005904.1|2032358_2032973_-	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	97.1	8.2e-112
WP_001668825.1|2032975_2033320_-|holin	phage holin, lambda family	holin	Q8HA87	Salmonella_phage	98.8	3.4e-43
WP_001668823.1|2034954_2035791_-	molecular chaperone	NA	A0A1B5FPA5	Escherichia_phage	80.8	6.5e-128
WP_000609695.1|2035787_2036060_-	hypothetical protein	NA	A0A1B5FPA6	Escherichia_phage	76.3	2.1e-27
WP_071881861.1|2036074_2037064_-	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.0	1.0e-188
WP_024150661.1|2037071_2037932_-	KilA-N domain-containing protein	NA	Q8HA92	Salmonella_phage	99.3	9.2e-162
WP_000767086.1|2037948_2038338_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A192Y8N5	Salmonella_phage	97.7	1.6e-68
WP_001669427.1|2039226_2039709_-	PerC family transcriptional regulator	NA	Q8HA95	Salmonella_phage	98.1	6.0e-86
WP_038406282.1|2039710_2040535_-	helix-turn-helix domain-containing protein	NA	Q8HA96	Salmonella_phage	89.8	2.9e-128
WP_000620702.1|2040531_2040756_-	hypothetical protein	NA	A0A1C9II64	Salmonella_phage	100.0	3.3e-39
WP_023139406.1|2041890_2042445_-	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	99.5	1.2e-101
WP_001191666.1|2042473_2042698_-	helix-turn-helix transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	100.0	1.9e-34
WP_001020640.1|2042795_2043491_+	helix-turn-helix transcriptional regulator	NA	Q8HAA0	Salmonella_phage	99.6	4.6e-127
WP_001067432.1|2043696_2044035_+	hypothetical protein	NA	A0A1C9IHZ4	Salmonella_phage	100.0	7.0e-57
WP_023891434.1|2043997_2044222_-	hypothetical protein	NA	A0A1C9IHY8	Salmonella_phage	100.0	1.6e-33
WP_000997190.1|2044761_2045133_+	hypothetical protein	NA	Q8HAA1	Salmonella_phage	100.0	1.1e-63
WP_000080416.1|2045190_2046018_+	YfdQ family protein	NA	A0A192Y6E5	Salmonella_phage	100.0	2.6e-153
WP_000008351.1|2046154_2046694_+	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	100.0	2.6e-98
WP_025840127.1|2046764_2047298_+	hypothetical protein	NA	A0A192Y7N1	Salmonella_phage	99.4	7.4e-101
WP_000224241.1|2047299_2047557_+	hypothetical protein	NA	A0A192Y5W0	Salmonella_phage	100.0	1.3e-42
WP_000208069.1|2047567_2048401_+	hypothetical protein	NA	Q8HAA7	Salmonella_phage	99.6	4.0e-162
WP_001061334.1|2048404_2048974_+	3'-5' exoribonuclease	NA	A0A192Y6E0	Salmonella_phage	100.0	7.1e-110
WP_000414876.1|2048998_2049241_+	DUF4224 domain-containing protein	NA	Q8HAA9	Salmonella_phage	100.0	9.5e-40
WP_000532847.1|2049242_2050232_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	100.0	8.6e-196
WP_000598920.1|2050523_2051321_+	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_001738920.1|2051692_2051983_+	DUF4102 domain-containing protein	NA	H2BDA3	Pseudomonas_phage	49.1	3.0e-08
WP_001219015.1|2052630_2053104_+	peptidase	NA	A0A0F6TJ61	Escherichia_coli_O157_typing_phage	77.6	7.1e-39
2054727:2054742	attR	TGAAAATATCGATTTT	NA	NA	NA	NA
>prophage 5
NZ_CP009102	Salmonella enterica subsp. enterica serovar Typhimurium strain ATCC 13311 chromosome, complete genome	4793299	2139097	2149603	4793299		Enterobacteria_phage(37.5%)	10	NA	NA
WP_000126349.1|2139097_2140411_-	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
WP_000565905.1|2140437_2141517_-	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	6.6e-16
WP_000648784.1|2141521_2142295_-	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000018226.1|2142291_2143284_-	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000973708.1|2143289_2143841_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	2.2e-52
WP_000857529.1|2143841_2144720_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	9.3e-109
WP_001023662.1|2144767_2145667_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	1.4e-30
WP_000697840.1|2145666_2146752_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.2e-102
WP_000981469.1|2147128_2148022_-	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_001111841.1|2148199_2149603_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	27.1	3.1e-21
>prophage 6
NZ_CP009102	Salmonella enterica subsp. enterica serovar Typhimurium strain ATCC 13311 chromosome, complete genome	4793299	2217910	2227081	4793299	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000195332.1|2217910_2219944_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
WP_000703137.1|2220184_2220643_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_001197952.1|2220814_2221345_+	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000950413.1|2221401_2221869_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_000598637.1|2221915_2222635_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000272845.1|2222631_2224317_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	6.2e-279
WP_001240418.1|2224539_2225271_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_001261696.1|2225330_2225438_+	protein YohO	NA	NA	NA	NA	NA
WP_000824855.1|2225418_2226150_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000569166.1|2226133_2227081_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.7e-23
>prophage 7
NZ_CP009102	Salmonella enterica subsp. enterica serovar Typhimurium strain ATCC 13311 chromosome, complete genome	4793299	2246488	2312884	4793299	holin,lysis,tail	Salmonella_phage(28.57%)	60	NA	NA
WP_000989296.1|2246488_2247184_+|lysis	CidB/LrgB family autolysis modulator	lysis	NA	NA	NA	NA
WP_000553526.1|2247337_2248222_+	cytidine deaminase	NA	NA	NA	NA	NA
WP_000920081.1|2248398_2249118_+	outer membrane permeability protein SanA	NA	NA	NA	NA	NA
WP_000605187.1|2249114_2249360_+	DUF2542 family protein	NA	NA	NA	NA	NA
WP_001136409.1|2249564_2250806_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000956095.1|2250799_2252035_+	NAD-dependent dihydropyrimidine dehydrogenase subunit PreA	NA	NA	NA	NA	NA
WP_001275101.1|2252109_2253120_-	galactose/methyl galactoside ABC transporter permease MglC	NA	NA	NA	NA	NA
WP_000535907.1|2253135_2254656_-	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	31.9	1.0e-09
WP_038406287.1|2254789_2255788_-	galactose/glucose ABC transporter substrate-binding protein MglB	NA	NA	NA	NA	NA
WP_000628631.1|2256286_2257309_-	HTH-type transcriptional regulator GalS	NA	NA	NA	NA	NA
WP_001526153.1|2257458_2258601_-	DUF418 family protein	NA	NA	NA	NA	NA
WP_001139611.1|2258615_2259284_-	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.3	4.1e-56
WP_000425488.1|2259613_2260471_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000876817.1|2260459_2260849_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000443208.1|2260853_2262221_-	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_000022915.1|2262437_2263325_+	phosphoserine phosphatase SerB	NA	NA	NA	NA	NA
WP_000023807.1|2263357_2264680_+	MFS transporter	NA	NA	NA	NA	NA
WP_000488255.1|2264723_2266715_-	catecholate siderophore receptor CirA	NA	A0A0P0I887	Acinetobacter_phage	37.9	6.7e-14
WP_000535000.1|2267060_2268530_-	lysine-specific permease	NA	NA	NA	NA	NA
WP_000548308.1|2268719_2269583_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000137961.1|2269703_2270753_+	YeiH family protein	NA	NA	NA	NA	NA
WP_000873909.1|2270831_2271689_+	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	28.5	2.2e-22
WP_000854414.1|2271753_2273442_-	PTS fructose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_000091249.1|2273458_2274397_-	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_000487287.1|2274396_2275527_-	fused PTS fructose transporter subunit IIA/HPr protein	NA	NA	NA	NA	NA
WP_000551937.1|2275895_2277077_+	sugar efflux transporter SetB	NA	NA	NA	NA	NA
WP_001213882.1|2277141_2277807_-	membrane protein	NA	NA	NA	NA	NA
WP_038406288.1|2277808_2277931_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010989043.1|2278318_2278573_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001136822.1|2278896_2279469_+	elongation factor P-like protein YeiP	NA	NA	NA	NA	NA
WP_000169350.1|2279681_2280668_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_000178095.1|2280697_2281417_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_000241015.1|2281830_2282403_+	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.9	8.1e-13
WP_000957746.1|2282728_2284285_+	cyclic di-GMP phosphodiesterase	NA	NA	NA	NA	NA
WP_000561748.1|2284391_2286197_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000501623.1|2286206_2287301_+	microcin C ABC transporter permease YejB	NA	NA	NA	NA	NA
WP_001137764.1|2287300_2288326_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000203622.1|2288327_2289917_+	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	32.5	8.5e-20
WP_001094639.1|2289920_2290265_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000213347.1|2290655_2291846_-	Bcr/CflA family multidrug efflux MFS transporter	NA	S4TR35	Salmonella_phage	22.2	2.4e-19
WP_001234836.1|2291873_2292569_-	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_000578121.1|2292720_2294481_+	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	41.6	1.9e-100
WP_000494192.1|2294605_2294890_+	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_000033440.1|2294998_2295619_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000050806.1|2295646_2296654_-	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	48.3	4.5e-83
WP_001135904.1|2296833_2297061_+	YejL family protein	NA	NA	NA	NA	NA
WP_000256150.1|2297092_2298853_+	cardiolipin transport protein PbgA	NA	NA	NA	NA	NA
WP_000806401.1|2299133_2299637_-	LexA family transcriptional regulator	NA	Q1MVE7	Enterobacteria_phage	71.3	9.5e-50
WP_000884778.1|2299664_2299955_+	DinI family protein	NA	S4TND2	Salmonella_phage	83.3	4.7e-25
WP_000639473.1|2300302_2302132_+	acyltransferase	NA	C6ZR20	Salmonella_phage	29.6	3.0e-61
WP_000022213.1|2302185_2302629_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	43.9	1.4e-28
WP_001215679.1|2303006_2303534_-|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	31.3	3.1e-11
WP_000554739.1|2303536_2304778_-	hypothetical protein	NA	Q8HAB4	Salmonella_phage	95.3	1.0e-52
WP_001120499.1|2305370_2305700_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	94.6	3.9e-36
WP_000894640.1|2305996_2307328_+	AAA family ATPase	NA	R9TRQ8	Vibrio_phage	28.5	2.1e-19
WP_010989045.1|2307356_2307725_-	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	81.7	7.4e-52
WP_001202279.1|2307739_2308729_-	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.3	6.0e-189
WP_001115840.1|2309057_2311424_-	SPI-2 type III secretion system effector E3 ubiquitin transferase SspH2	NA	Q9MBL9	Phage_Gifsy-2	88.7	2.9e-72
WP_001113462.1|2311592_2311796_-|tail	tail protein	tail	NA	NA	NA	NA
WP_000624225.1|2312092_2312884_-|tail	tail protein	tail	Q1MVL8	Enterobacteria_phage	31.6	1.7e-48
>prophage 8
NZ_CP009102	Salmonella enterica subsp. enterica serovar Typhimurium strain ATCC 13311 chromosome, complete genome	4793299	2653195	2758749	4793299	capsid,tRNA,tail,holin,portal,integrase,lysis,head,terminase,transposase	Salmonella_phage(35.0%)	109	2677740:2677756	2766653:2766669
WP_000940032.1|2653195_2653927_-|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
WP_000553467.1|2654045_2654849_+	inositol-1-monophosphatase	NA	NA	NA	NA	NA
WP_000174944.1|2654993_2655872_+	alpha/beta hydrolase	NA	A0A1C9C5K3	Heterosigma_akashiwo_virus	24.7	3.5e-15
WP_000985204.1|2656053_2657097_+	anaerobic sulfite reductase subunit A	NA	NA	NA	NA	NA
WP_000017587.1|2657100_2657919_+	anaerobic sulfite reductase subunit B	NA	NA	NA	NA	NA
WP_000020685.1|2657929_2658943_+	sulfite reductase subunit C	NA	NA	NA	NA	NA
WP_000111027.1|2658943_2659930_-	nickel/cobalt transporter	NA	NA	NA	NA	NA
WP_000805728.1|2659920_2660559_-	DUF1007 family protein	NA	NA	NA	NA	NA
WP_000982961.1|2660684_2661962_+	stationary phase inducible protein CsiE	NA	NA	NA	NA	NA
WP_001173729.1|2661956_2663096_-	3-phenylpropionate MFS transporter	NA	NA	NA	NA	NA
WP_000919178.1|2663291_2664545_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	53.0	1.3e-100
WP_000883146.1|2664869_2666060_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_001187150.1|2666241_2667786_+	CadC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000100008.1|2668146_2669478_+	cadaverine/lysine antiporter	NA	NA	NA	NA	NA
WP_001100652.1|2669560_2671705_+	lysine decarboxylase CadA	NA	NA	NA	NA	NA
WP_000856793.1|2671760_2673221_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.8	1.7e-46
WP_000717694.1|2673269_2673608_-	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_000625591.1|2673684_2675022_-	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	29.2	1.8e-10
WP_001054236.1|2675018_2675783_-	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_001670672.1|2675784_2677215_-	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	26.1	2.0e-15
2677740:2677756	attL	CGCCTTATCCGGCCTAC	NA	NA	NA	NA
WP_000970045.1|2677864_2681752_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	57.6	1.4e-127
WP_001747289.1|2681773_2682007_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000734248.1|2682007_2683552_+	membrane-bound lytic murein transglycosylase MltF	NA	NA	NA	NA	NA
WP_001134566.1|2683602_2684154_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
WP_000253558.1|2684178_2684814_-	phosphatidylglycerophosphatase C	NA	NA	NA	NA	NA
WP_000361663.1|2684817_2686179_-	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_001048530.1|2686189_2687083_-	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_000995703.1|2687198_2688047_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000684022.1|2688085_2689003_-	oxidoreductase	NA	NA	NA	NA	NA
WP_001276365.1|2689024_2690221_-	OFA family MFS transporter	NA	NA	NA	NA	NA
WP_001022463.1|2690336_2691263_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	24.4	3.0e-09
WP_001196290.1|2691300_2691561_+	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	1.4e-17
WP_000986043.1|2691672_2692053_-	holo-ACP synthase	NA	NA	NA	NA	NA
WP_000818972.1|2692052_2692784_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_000399380.1|2692795_2693524_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_000102232.1|2693535_2694441_-	GTPase Era	NA	NA	NA	NA	NA
WP_001068341.1|2694437_2695118_-	ribonuclease III	NA	A0A2K9L5P0	Tupanvirus	31.8	7.4e-21
WP_000002559.1|2695391_2696366_-	signal peptidase I	NA	NA	NA	NA	NA
WP_000790154.1|2696382_2698182_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	24.9	7.2e-23
WP_010989047.1|2698586_2700080_+	type III secretion effector GogB	NA	Q9MBM1	Phage_Gifsy-1	100.0	3.4e-260
WP_001542312.1|2700552_2700690_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015589559.1|2701402_2701567_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_015701342.1|2702146_2702212_-	DUF4113 domain-containing protein	NA	NA	NA	NA	NA
WP_001738443.1|2702274_2702487_-	helix-turn-helix domain-containing protein	NA	S4TTF2	Salmonella_phage	90.6	3.8e-08
WP_010989049.1|2702593_2702821_+	PagK-like protein	NA	NA	NA	NA	NA
WP_000143154.1|2702917_2703496_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	88.9	3.6e-93
WP_000593433.1|2703485_2704310_-|tail	tail protein	tail	A0A0M4QWS3	Salmonella_phage	92.0	1.2e-145
WP_001144691.1|2704306_2706679_-|tail	tail protein	tail	A0A0K2FIZ6	Escherichia_phage	65.6	1.1e-90
WP_000178853.1|2706732_2706975_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000514917.1|2707013_2710376_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	79.7	0.0e+00
WP_000246126.1|2710437_2711085_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	77.7	2.1e-89
WP_000662739.1|2710982_2711720_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	85.0	5.2e-129
WP_001152689.1|2711726_2712425_-|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	76.3	5.5e-104
WP_000447369.1|2712434_2712764_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	70.4	1.3e-42
WP_000372075.1|2712766_2715862_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	61.7	4.8e-277
WP_010989052.1|2715833_2716172_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	62.4	1.3e-31
WP_000479607.1|2716168_2716564_-|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	56.5	2.3e-30
WP_000971953.1|2716614_2717361_-|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	76.9	1.9e-99
WP_022742782.1|2717368_2717770_-	hypothetical protein	NA	Q9G0F3	Phage_Gifsy-1	99.0	4.0e-51
WP_000677089.1|2717766_2718345_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	80.2	3.7e-82
WP_000083293.1|2718331_2718709_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	55.6	1.5e-28
WP_000201485.1|2718719_2719085_-	DNA packaging protein	NA	NA	NA	NA	NA
WP_022742784.1|2719142_2720171_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.1	1.3e-114
WP_000011260.1|2720225_2720573_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	52.7	9.2e-20
WP_001189498.1|2720585_2722082_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	52.2	1.1e-96
WP_000831821.1|2722071_2723652_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	62.8	9.6e-189
WP_000201415.1|2723648_2723852_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	73.8	1.9e-17
WP_000623088.1|2723835_2725767_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.9	1.3e-259
WP_001102153.1|2725738_2726284_-|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	80.6	1.5e-56
WP_000669689.1|2726569_2726971_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031603581.1|2727227_2727731_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050955063.1|2728058_2728505_-|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	83.9	9.3e-57
WP_022742788.1|2728537_2729152_-	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	93.6	2.2e-109
WP_021000643.1|2729151_2729433_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	80.6	2.6e-36
WP_001294873.1|2729419_2729809_-	membrane protein	NA	K7PHB9	Enterobacterial_phage	72.5	4.8e-41
WP_023221874.1|2729898_2730087_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024150660.1|2730613_2731039_-	subtilase	NA	NA	NA	NA	NA
WP_022742790.1|2731171_2731897_-	hypothetical protein	NA	A0A0U2KD26	Escherichia_phage	66.2	4.0e-81
WP_022742791.1|2732097_2732676_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	57.2	1.1e-49
WP_050196634.1|2732690_2733680_-	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.3	3.5e-189
WP_024150661.1|2733687_2734548_-	KilA-N domain-containing protein	NA	Q8HA92	Salmonella_phage	99.3	9.2e-162
WP_000767086.1|2734564_2734954_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A192Y8N5	Salmonella_phage	97.7	1.6e-68
WP_001669427.1|2735842_2736325_-	PerC family transcriptional regulator	NA	Q8HA95	Salmonella_phage	98.1	6.0e-86
WP_022742797.1|2736326_2737286_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	80.9	1.2e-117
WP_000620702.1|2737282_2737507_-	hypothetical protein	NA	A0A1C9II64	Salmonella_phage	100.0	3.3e-39
WP_031609052.1|2737503_2738646_-	peptidase	NA	A0A1C9IHV9	Salmonella_phage	98.2	1.0e-208
WP_023139406.1|2738642_2739197_-	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	99.5	1.2e-101
WP_001191666.1|2739225_2739450_-	helix-turn-helix transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	100.0	1.9e-34
WP_001020640.1|2739547_2740243_+	helix-turn-helix transcriptional regulator	NA	Q8HAA0	Salmonella_phage	99.6	4.6e-127
WP_000917563.1|2740596_2740755_+	hypothetical protein	NA	H6WRX3	Salmonella_phage	100.0	2.4e-23
WP_022742800.1|2740776_2741127_+	hypothetical protein	NA	S4TSN6	Salmonella_phage	98.3	6.4e-61
WP_022742801.1|2741253_2744181_+	exodeoxyribonuclease VIII	NA	H6WRX1	Salmonella_phage	98.2	0.0e+00
WP_001539618.1|2744143_2745301_+	recombinase RecT	NA	S4TTE8	Salmonella_phage	100.0	1.6e-217
WP_001237031.1|2745343_2745583_+	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_001670787.1|2745623_2745908_+	excisionase Xis	NA	H6WRW8	Salmonella_phage	86.2	3.1e-42
WP_001007937.1|2745885_2747115_-|integrase	site-specific integrase	integrase	H6WRW7	Salmonella_phage	94.1	4.9e-233
WP_000589087.1|2747612_2748092_-	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
WP_000812017.1|2748088_2749045_-	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
WP_001168374.1|2749044_2749695_-	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_000003307.1|2749726_2750302_-	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_014344135.1|2750298_2750463_-	rpoE leader peptide RseD	NA	NA	NA	NA	NA
WP_000989177.1|2750726_2752349_+	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_000083343.1|2752333_2753071_-|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_000219174.1|2753201_2754536_+	ATP-dependent RNA helicase SrmB	NA	A0A1B1IS59	uncultured_Mediterranean_phage	29.7	1.6e-43
WP_001526875.1|2754553_2755453_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000188414.1|2755555_2756143_+	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000627811.1|2756204_2756588_-	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	74.0	6.1e-33
WP_000179978.1|2756906_2757596_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	49.5	4.6e-55
WP_000997368.1|2757711_2758749_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
2766653:2766669	attR	GTAGGCCGGATAAGGCG	NA	NA	NA	NA
>prophage 9
NZ_CP009102	Salmonella enterica subsp. enterica serovar Typhimurium strain ATCC 13311 chromosome, complete genome	4793299	4354491	4374911	4793299	plate,tail	Burkholderia_phage(45.0%)	26	NA	NA
WP_000587738.1|4354491_4355220_-	hypothetical protein	NA	A0A077SLK3	Escherichia_phage	37.3	5.6e-35
WP_010989092.1|4355416_4355707_-	membrane protein	NA	NA	NA	NA	NA
WP_000084331.1|4355955_4356411_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001526208.1|4356407_4357013_-	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
WP_000368196.1|4357017_4358763_-|tail	tail protein	tail	A0A0M3ULF6	Salmonella_phage	52.2	3.2e-52
WP_000359500.1|4358765_4359398_-|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	56.4	6.6e-24
WP_000951736.1|4359390_4360506_-|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	52.2	1.8e-101
WP_001093501.1|4360496_4360856_-|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
WP_001095011.1|4361019_4362567_-	membrane protein	NA	B9UDL6	Salmonella_phage	29.9	1.9e-48
WP_000703632.1|4362566_4363496_-	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	83.8	8.8e-150
WP_000593182.1|4363492_4363855_-	GtrA family protein	NA	I1TED9	Salmonella_phage	70.8	1.2e-43
WP_000679398.1|4364182_4364905_-|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	41.0	3.3e-11
WP_000818154.1|4364914_4365958_-	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	45.1	2.5e-76
WP_001269716.1|4365945_4366155_-	membrane protein	NA	A4JWL2	Burkholderia_virus	60.3	9.8e-17
WP_000271423.1|4366154_4367108_-	methyl-accepting chemotaxis protein	NA	A4JWL1	Burkholderia_virus	50.8	2.3e-36
WP_001262499.1|4367107_4369462_-|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.6	9.0e-66
WP_001185654.1|4369558_4369687_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_001003642.1|4369646_4369964_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_000907494.1|4370015_4370540_-|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	2.8e-68
WP_000729852.1|4370539_4371967_-|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.9	1.1e-194
WP_000875314.1|4371956_4372154_-	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	8.6e-07
WP_000449433.1|4372150_4372606_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000777266.1|4372765_4373080_-	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
WP_001270441.1|4373092_4373698_-	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.9	2.5e-60
WP_001226442.1|4373700_4373988_-	membrane protein	NA	Q6QIC8	Burkholderia_phage	49.1	2.3e-16
WP_000615248.1|4374563_4374911_+	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
