The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP007626	Bacillus pseudomycoides strain 219298 chromosome, complete genome	5228024	735538	742658	5228024		Bacillus_phage(33.33%)	8	NA	NA
WP_006097713.1|735538_735838_-	hypothetical protein	NA	A0A1B1P853	Bacillus_phage	74.5	9.4e-13
WP_006097712.1|737571_738159_-	GTP cyclohydrolase I FolE	NA	E7DN69	Pneumococcus_phage	48.4	1.1e-44
WP_018767833.1|738202_738919_-	7-carboxy-7-deazaguanine synthase QueE	NA	A0A1U9WRB6	Streptococcus_virus	43.3	2.0e-53
WP_006097709.1|738911_739403_-	6-carboxytetrahydropterin synthase QueD	NA	J9PV91	Bacillus_phage	71.1	4.0e-61
WP_003203747.1|739402_740068_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	56.0	2.8e-65
WP_006097707.1|740080_740869_-	hypothetical protein	NA	NA	NA	NA	NA
WP_018782253.1|740871_741663_-	hypothetical protein	NA	NA	NA	NA	NA
WP_018767830.1|741659_742658_-	ATP-binding cassette domain-containing protein	NA	A0A2R8FG22	Brazilian_cedratvirus	28.2	7.3e-17
>prophage 2
NZ_CP007626	Bacillus pseudomycoides strain 219298 chromosome, complete genome	5228024	756820	846192	5228024	integrase,coat,tRNA,plate,bacteriocin,terminase,transposase,tail,protease	Bacillus_phage(60.53%)	88	829855:829871	831773:831789
WP_040118942.1|756820_757813_-|protease	collagenolytic protease	protease	NA	NA	NA	NA
WP_003203117.1|758126_758729_-	DUF2812 domain-containing protein	NA	NA	NA	NA	NA
WP_018782267.1|758733_759036_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003210015.1|759335_759755_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_018782268.1|760202_761132_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_080548478.1|761294_761498_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	51.6	6.4e-13
WP_033794526.1|761463_761988_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_018782271.1|763192_763918_-	metallophosphoesterase family protein	NA	NA	NA	NA	NA
WP_018782272.1|764112_764376_+	DUF4352 domain-containing protein	NA	A0A1B1P898	Bacillus_phage	44.3	2.4e-12
WP_018764670.1|764660_764762_+	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_003203100.1|765068_766463_-	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	25.0	7.7e-25
WP_018782273.1|766570_767476_+	DMT family transporter	NA	NA	NA	NA	NA
WP_018782275.1|768418_769048_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003203089.1|770217_770415_+	aspartyl-phosphate phosphatase Spo0E family protein	NA	NA	NA	NA	NA
WP_003203088.1|770676_770928_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040118943.1|772214_774830_-	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	33.8	1.1e-37
WP_018782278.1|775615_777547_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	30.7	6.2e-65
WP_018782279.1|777555_780228_-	DNA mismatch repair protein MutS	NA	A0A1V0SGG8	Hokovirus	23.2	2.1e-34
WP_003199431.1|780406_780949_-|coat	outer spore coat protein CotE	coat	NA	NA	NA	NA
WP_006095670.1|781078_781510_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003199427.1|781513_783043_-|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_018764680.1|783492_784359_-	2-oxoacid:ferredoxin oxidoreductase subunit beta	NA	NA	NA	NA	NA
WP_018782280.1|784345_786103_-	2-oxoacid:acceptor oxidoreductase subunit alpha	NA	NA	NA	NA	NA
WP_033794533.1|786361_787285_-	membrane dipeptidase	NA	NA	NA	NA	NA
WP_000404341.1|787347_787608_-	stage V sporulation protein SpoVS	NA	J9PTX7	Bacillus_phage	43.8	8.4e-10
WP_003199419.1|787757_788552_-	TIGR00282 family metallophosphoesterase	NA	NA	NA	NA	NA
WP_016115916.1|788734_790303_-	ribonuclease Y	NA	NA	NA	NA	NA
WP_006095669.1|790734_791760_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	73.6	7.2e-137
WP_018782282.1|791902_793141_-	competence/damage-inducible protein A	NA	NA	NA	NA	NA
WP_018782283.1|793161_793740_-	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_080740049.1|793804_794731_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016115921.1|794743_795529_-	DUF3388 domain-containing protein	NA	NA	NA	NA	NA
WP_003199403.1|795665_795914_-	DUF3243 domain-containing protein	NA	NA	NA	NA	NA
WP_018782285.1|795993_796707_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_003209671.1|796891_798178_-	insulinase family protein	NA	A0A2H4UVM3	Bodo_saltans_virus	27.7	9.1e-12
WP_018782286.1|798178_799453_-	insulinase family protein	NA	A0A1X9I714	Streptococcus_phage	30.3	5.9e-56
WP_003199393.1|799655_800615_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_018764690.1|800615_801674_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003199388.1|801666_803199_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	27.6	8.3e-12
WP_003199386.1|803304_804381_-	BMP family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000114183.1|804469_805195_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_029427439.1|805733_808133_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	51.4	2.6e-89
WP_018782288.1|808346_808550_-	ribonuclease	NA	NA	NA	NA	NA
WP_003203721.1|808546_809296_-	translocation-enhancing protein TepA	NA	NA	NA	NA	NA
WP_029427442.1|809397_811068_-	ribonuclease J	NA	NA	NA	NA	NA
WP_003203717.1|811512_812391_-	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
WP_018782290.1|812402_813635_-	aspartate kinase	NA	NA	NA	NA	NA
WP_003203711.1|813658_814705_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_003203709.1|814854_815031_-	dipicolinate synthase	NA	NA	NA	NA	NA
WP_018782292.1|815772_816345_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006095700.1|816429_816636_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003203698.1|816635_817730_-	tetratricopeptide repeat protein	NA	A0A2H4J8G3	uncultured_Caudovirales_phage	53.8	1.0e-101
WP_006095702.1|817888_818947_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B1P878	Bacillus_phage	83.1	1.3e-168
WP_018782293.1|818948_819209_-|bacteriocin	bacteriocin biosynthesis protein	bacteriocin	A0A1B1P7Q9	Bacillus_phage	46.0	5.9e-11
WP_018782294.1|819253_819742_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003210100.1|819895_820120_-	hypothetical protein	NA	A0A1B1P780	Bacillus_phage	91.9	2.9e-27
WP_018782698.1|820263_821658_-|plate	BppU family phage baseplate upper protein	plate	A0A1C8E978	Bacillus_phage	51.0	9.1e-58
WP_080740052.1|821654_822620_-|tail	tail fiber domain-containing protein	tail	A0A1B1P770	Bacillus_phage	56.7	1.1e-94
WP_018782701.1|824178_824634_-	hypothetical protein	NA	NA	NA	NA	NA
WP_123767182.1|824862_826467_-|terminase	terminase large subunit	terminase	A0A1B1P766	Bacillus_phage	73.3	1.4e-232
WP_018782703.1|826498_827020_-	DNA-directed RNA polymerase sigma-70 factor	NA	E2ELI1	Clostridium_phage	48.8	3.5e-31
WP_018780956.1|827209_827524_-	hypothetical protein	NA	A0A1B1P767	Bacillus_phage	88.5	9.8e-45
WP_003199584.1|827526_827721_-	HNH endonuclease	NA	A0A1B1P757	Bacillus_phage	90.6	7.9e-29
WP_018780954.1|827834_828077_-	hypothetical protein	NA	A0A1B1P743	Bacillus_phage	65.0	3.4e-21
WP_003199580.1|828285_828477_-	hypothetical protein	NA	A0A0Y0AUI4	Bacillus_phage	58.1	5.2e-17
WP_018780953.1|829111_829627_-	DUF3231 family protein	NA	NA	NA	NA	NA
829855:829871	attL	TAATAATAGAAATTAAA	NA	NA	NA	NA
WP_018780952.1|829972_830275_+	WGxxGxxG-CTERM domain-containing protein	NA	NA	NA	NA	NA
WP_018780951.1|830637_831180_-|integrase	site-specific integrase	integrase	D2XR58	Bacillus_phage	92.2	2.0e-90
WP_003199569.1|831176_831647_-	ArpU family transcriptional regulator	NA	D2XR57	Bacillus_phage	85.3	7.7e-70
WP_003208133.1|832971_833166_+	hypothetical protein	NA	NA	NA	NA	NA
831773:831789	attR	TTTAATTTCTATTATTA	NA	NA	NA	NA
WP_003208136.1|833323_833797_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003199563.1|833849_834041_-	DUF3954 domain-containing protein	NA	D2XR48	Bacillus_phage	92.1	1.1e-25
WP_018780949.1|834117_834480_-	hypothetical protein	NA	D2XR47	Bacillus_phage	77.5	3.7e-48
WP_003199559.1|834454_834643_-	hypothetical protein	NA	D2XR45	Bacillus_phage	81.1	1.7e-12
WP_018780948.1|834642_835965_-	replicative DNA helicase	NA	D2XR44	Bacillus_phage	84.3	1.4e-209
WP_018780947.1|835961_836888_-	DnaD domain protein	NA	D2XR43	Bacillus_phage	85.5	1.4e-139
WP_040118944.1|837168_837453_-	hypothetical protein	NA	D2XR42	Bacillus_phage	55.3	1.6e-22
WP_040118945.1|837639_837861_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040118946.1|837874_838462_-	helix-turn-helix transcriptional regulator	NA	D2XR41	Bacillus_phage	71.5	2.0e-75
WP_040118947.1|838550_838799_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040118948.1|838851_839040_-	helix-turn-helix transcriptional regulator	NA	A0A2H4J4N8	uncultured_Caudovirales_phage	54.2	1.9e-11
WP_040118949.1|839195_839630_+	helix-turn-helix domain-containing protein	NA	A0A2P1JU09	Anoxybacillus_phage	53.1	7.0e-33
WP_040118950.1|839646_840087_+	ImmA/IrrE family metallo-endopeptidase	NA	D2XR38	Bacillus_phage	78.2	8.9e-60
WP_040118951.1|840110_840833_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040118952.1|841189_842737_+	recombinase family protein	NA	I3VYZ3	Thermoanaerobacterium_phage	53.8	9.2e-144
WP_018780935.1|843191_844094_-	dipicolinic acid synthetase subunit A	NA	NA	NA	NA	NA
WP_029426914.1|844504_844756_-	YlmC/YmxH family sporulation protein	NA	NA	NA	NA	NA
WP_018780934.1|844953_846192_-	insulinase family protein	NA	G3MBJ8	Bacillus_virus	34.0	3.4e-56
>prophage 3
NZ_CP007626	Bacillus pseudomycoides strain 219298 chromosome, complete genome	5228024	2417119	2467576	5228024	integrase,tRNA,transposase,holin,protease	Bacillus_virus(14.29%)	50	2440325:2440343	2470183:2470201
WP_003202485.1|2417119_2417812_-|holin	antiholin-like protein LrgB	holin	NA	NA	NA	NA
WP_018782431.1|2417847_2418279_-|holin	antiholin-like murein hydrolase modulator LrgA	holin	NA	NA	NA	NA
WP_018782432.1|2418411_2419152_-	response regulator	NA	NA	NA	NA	NA
WP_018782433.1|2419129_2420902_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	29.6	7.2e-68
WP_003202478.1|2420976_2421132_+	hypothetical protein	NA	NA	NA	NA	NA
WP_018782435.1|2421178_2422249_-	nitric oxide synthase oxygenase	NA	NA	NA	NA	NA
WP_018782436.1|2422600_2423470_-	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_006096751.1|2423602_2424193_-	transporter	NA	NA	NA	NA	NA
WP_018782437.1|2424671_2425085_+	hypothetical protein	NA	NA	NA	NA	NA
WP_018782438.1|2425259_2425907_-	hemolysin III family protein	NA	NA	NA	NA	NA
WP_018782439.1|2426061_2426622_+	DUF1836 domain-containing protein	NA	NA	NA	NA	NA
WP_144569328.1|2426698_2426845_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_018782441.1|2427490_2428105_-	hypothetical protein	NA	NA	NA	NA	NA
WP_018764839.1|2428094_2428646_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_018782442.1|2428754_2430200_-	DEAD/DEAH box helicase	NA	A0A1B1IS59	uncultured_Mediterranean_phage	33.6	1.0e-56
WP_018782443.1|2430636_2431899_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029427504.1|2432336_2433626_-	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_018782446.1|2433746_2434445_-	response regulator	NA	NA	NA	NA	NA
WP_018782447.1|2434434_2436036_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_006096762.1|2436123_2437197_+	DctP family TRAP transporter solute-binding subunit	NA	NA	NA	NA	NA
WP_018782448.1|2437495_2438479_+	GMP reductase	NA	G3MBI2	Bacillus_virus	85.0	2.4e-158
WP_018782449.1|2438575_2439454_-	radical SAM protein	NA	NA	NA	NA	NA
WP_003209320.1|2439806_2440286_-	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
2440325:2440343	attL	TTATCCACATATCCACAAG	NA	NA	NA	NA
WP_026008486.1|2440345_2440531_-	CxxH/CxxC protein	NA	NA	NA	NA	NA
WP_018782450.1|2440586_2441771_-|protease	serine protease	protease	W5SAB9	Pithovirus	30.8	3.9e-09
WP_003202558.1|2441834_2442629_-	MBL fold metallo-hydrolase	NA	A0A0C5AJ83	Bacteriophage	36.9	2.1e-43
WP_018782451.1|2442635_2443463_-	hypothetical protein	NA	NA	NA	NA	NA
WP_018782452.1|2443443_2444787_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003202552.1|2444783_2446619_-	cell wall metabolism sensor histidine kinase WalK	NA	W8CYF6	Bacillus_phage	35.0	1.0e-37
WP_000971870.1|2446622_2447330_-	cell wall metabolism DNA-binding response regulator WalR	NA	W8CYM9	Bacillus_phage	43.1	3.4e-45
WP_003202567.1|2448142_2449432_-	adenylosuccinate synthase	NA	A0A160ER07	Powai_lake_megavirus	36.8	5.1e-71
WP_006096771.1|2449648_2451010_-	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	52.8	1.3e-122
WP_018764827.1|2451037_2451484_-	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_018764826.1|2451480_2453454_-	DHH family phosphoesterase	NA	NA	NA	NA	NA
WP_003202592.1|2453606_2454545_-	YybS family protein	NA	NA	NA	NA	NA
WP_000918874.1|2454625_2454859_-	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_016112819.1|2454904_2455417_-	single-stranded DNA-binding protein	NA	A0A290GHL8	Caldibacillus_phage	64.1	2.7e-52
WP_003209337.1|2455444_2455735_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_006096782.1|2455927_2457028_-	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_018782453.1|2457143_2457341_-	DUF951 domain-containing protein	NA	NA	NA	NA	NA
WP_003202583.1|2457361_2458243_-	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_018782454.1|2458515_2459112_+|protease	spore protease YyaC	protease	G3M9W0	Bacillus_virus	38.2	5.8e-22
WP_018782455.1|2459132_2459984_-	ParB/RepB/Spo0J family partition protein	NA	I3NLC2	Bifidobacterium_phage	34.6	2.8e-17
WP_003202576.1|2459976_2460738_-	sporulation initiation inhibitor protein Soj	NA	Q8JL10	Natrialba_phage	30.1	4.7e-24
WP_003209340.1|2460927_2461800_-	nucleoid occlusion protein	NA	S5VTK0	Leptospira_phage	45.0	2.4e-16
WP_006096787.1|2461905_2462625_-	16S rRNA (guanine(527)-N(7))-methyltransferase RsmG	NA	NA	NA	NA	NA
WP_018782456.1|2462646_2464536_-|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
WP_003202594.1|2464581_2465958_-|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE	tRNA	NA	NA	NA	NA
WP_018764823.1|2466194_2466812_-	protein jag	NA	NA	NA	NA	NA
WP_018782457.1|2466808_2467576_-|integrase	YidC family membrane integrase SpoIIIJ	integrase	NA	NA	NA	NA
2470183:2470201	attR	TTATCCACATATCCACAAG	NA	NA	NA	NA
>prophage 4
NZ_CP007626	Bacillus pseudomycoides strain 219298 chromosome, complete genome	5228024	2714744	2722745	5228024		uncultured_virus(33.33%)	6	NA	NA
WP_000917305.1|2714744_2715029_+	co-chaperone GroES	NA	A0A221S3C8	uncultured_virus	54.8	8.9e-21
WP_006093172.1|2715066_2716701_+	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	57.8	3.8e-156
WP_050774399.1|2717070_2718669_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	31.2	2.3e-20
WP_003194563.1|2719062_2720388_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	31.4	4.4e-46
WP_016117050.1|2720530_2721232_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.4	6.2e-39
WP_040119628.1|2721227_2722745_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	32.6	1.5e-34
>prophage 5
NZ_CP007626	Bacillus pseudomycoides strain 219298 chromosome, complete genome	5228024	3375888	3385584	5228024		Bacillus_phage(50.0%)	7	NA	NA
WP_040119204.1|3375888_3378327_+	DEAD/DEAH box helicase family protein	NA	A0A0K2CZF8	Paenibacillus_phage	28.5	4.3e-39
WP_040119646.1|3378514_3378781_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040119205.1|3378935_3379586_-	2OG-Fe(II) oxygenase	NA	M1GXR2	Acanthocystis_turfacea_Chlorella_virus	30.5	9.8e-15
WP_040119206.1|3380033_3380894_+	DnaD domain protein	NA	A6M985	Geobacillus_virus	38.6	1.7e-46
WP_040119207.1|3380890_3382177_+	replicative DNA helicase	NA	D2XR44	Bacillus_phage	59.6	4.9e-143
WP_040119208.1|3382872_3383811_+	hypothetical protein	NA	A0A0K2D0C0	Bacillus_phage	53.8	6.3e-79
WP_040119209.1|3384042_3385584_-	hypothetical protein	NA	J9Q9X0	Bacillus_phage	32.3	9.5e-24
>prophage 6
NZ_CP007626	Bacillus pseudomycoides strain 219298 chromosome, complete genome	5228024	3824813	3832225	5228024	integrase	Bacillus_phage(66.67%)	7	3823079:3823093	3836076:3836090
3823079:3823093	attL	TCTATTTATATATAT	NA	NA	NA	NA
WP_006094051.1|3824813_3825554_+	phage repressor protein/antirepressor Ant	NA	A0A2K9V3K3	Faecalibacterium_phage	37.3	6.5e-31
WP_018781085.1|3825649_3826327_+	hypothetical protein	NA	NA	NA	NA	NA
WP_018781084.1|3826402_3827089_+	hypothetical protein	NA	A0A2P1JUI8	Bacillus_phage	52.7	1.2e-39
WP_006094060.1|3827102_3827765_+	hypothetical protein	NA	A0A1S5QTJ5	Bacillus_phage	32.2	2.7e-20
WP_018781080.1|3828348_3829443_+	hypothetical protein	NA	A0A2H4J8G3	uncultured_Caudovirales_phage	46.9	2.7e-89
WP_006094065.1|3830364_3831147_-	transcriptional regulator	NA	J9PRI8	Bacillus_phage	26.5	1.0e-10
WP_006094066.1|3831304_3832225_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A142F1N9	Bacillus_phage	27.3	8.7e-25
3836076:3836090	attR	TCTATTTATATATAT	NA	NA	NA	NA
>prophage 1
NZ_CP007624	Bacillus pseudomycoides strain 219298 plasmid unnamed, complete sequence	140690	33489	82470	140690	transposase,integrase	Bacillus_phage(42.86%)	41	26511:26558	72683:72730
26511:26558	attL	ATTTAGAGAGGTGTTTTTTATCGTCTCATTCTCAGGGTTCACTCCAAA	NA	NA	NA	NA
WP_040118698.1|33489_34881_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_018783651.1|35074_36241_-|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	40.1	4.9e-65
WP_018783652.1|36761_37286_-	hypothetical protein	NA	NA	NA	NA	NA
WP_018783653.1|37536_38715_-	UDP-glucosyltransferase	NA	Q0IKX4	Leucania_separata_nucleopolyhedrovirus	23.9	4.3e-08
WP_018783654.1|39001_39859_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_040118699.1|40213_41095_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	41.0	5.6e-45
WP_033799504.1|41103_41400_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_018783672.1|43225_43753_-	M23 family metallopeptidase	NA	A0A0K2CNY2	Brevibacillus_phage	44.8	5.9e-10
WP_018783671.1|44395_46024_+	FAD-dependent monooxygenase	NA	NA	NA	NA	NA
WP_018783670.1|46358_46502_+	hypothetical protein	NA	NA	NA	NA	NA
WP_018783669.1|46713_47658_+	phosphotransferase	NA	NA	NA	NA	NA
WP_018783667.1|48132_49569_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_123767132.1|50547_50772_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040118700.1|50882_51590_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	41.7	5.1e-41
WP_040118701.1|52775_54158_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_003204763.1|56522_56819_-	WXG100 family type VII secretion target	NA	NA	NA	NA	NA
WP_040118703.1|56954_57350_-	DUF1433 domain-containing protein	NA	NA	NA	NA	NA
WP_040118704.1|57429_57819_-	DUF1433 domain-containing protein	NA	NA	NA	NA	NA
WP_040118705.1|57879_59076_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040118706.1|59077_59461_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040118707.1|59559_60369_-	DUF2837 family protein	NA	NA	NA	NA	NA
WP_095995427.1|61881_63241_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	76.6	4.8e-112
WP_018783627.1|64184_64694_-	DUF4303 domain-containing protein	NA	NA	NA	NA	NA
WP_029427989.1|64977_65364_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040118710.1|66121_66829_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	41.3	4.6e-42
WP_095995426.1|66884_67604_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_018783622.1|67613_68054_-	hypothetical protein	NA	NA	NA	NA	NA
WP_018783621.1|68287_69448_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_018783620.1|69803_70787_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003209727.1|70993_71881_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_003203261.1|72817_73726_+	VanZ family protein	NA	NA	NA	NA	NA
72683:72730	attR	TTTGGAGTGAACCCTGAGAATGAGACGATAAAAAACACCTCTCTAAAT	NA	NA	NA	NA
WP_040118711.1|74551_75724_+	serine hydrolase	NA	A0A1D8EXR7	Mycobacterium_phage	27.9	1.9e-24
WP_040118712.1|75972_76680_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	1.8e-41
WP_040118713.1|76969_77935_-	zinc-binding dehydrogenase	NA	NA	NA	NA	NA
WP_018783421.1|78086_78536_-	DNA gyrase inhibitor	NA	NA	NA	NA	NA
WP_018783422.1|79223_79451_-	hypothetical protein	NA	A0A290FZQ6	Caldibacillus_phage	58.0	1.4e-13
WP_018783423.1|79920_80151_+	helix-turn-helix transcriptional regulator	NA	A0A0S2MVM0	Bacillus_phage	56.6	9.7e-18
WP_040118714.1|80151_80766_-	hypothetical protein	NA	H0USY2	Bacillus_phage	46.1	8.9e-42
WP_040118715.1|80704_81886_-	cell division protein FtsK	NA	H0USY1	Bacillus_phage	56.0	1.7e-121
WP_040118716.1|81986_82172_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040118717.1|82173_82470_-	phage protein	NA	H0USY0	Bacillus_phage	44.3	3.8e-14
>prophage 1
NZ_CP007625	Bacillus pseudomycoides strain 219298 plasmid unnamed, complete sequence	285163	5469	131535	285163	transposase,holin,integrase,protease	Bacillus_phage(52.78%)	115	36242:36260	80900:80915
WP_040118735.1|5469_6597_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	S6AND0	Bacillus_phage	81.9	3.3e-175
WP_018783097.1|7821_9522_-	hypothetical protein	NA	NA	NA	NA	NA
WP_018783095.1|10610_12335_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029427758.1|12891_13188_+	hypothetical protein	NA	H0USY0	Bacillus_phage	47.7	2.2e-14
WP_018783094.1|13189_13375_+	hypothetical protein	NA	NA	NA	NA	NA
WP_018783093.1|13474_14656_+	cell division protein FtsK	NA	A0A288WFS1	Bacillus_phage	55.6	1.1e-123
WP_018783092.1|14594_15209_+	hypothetical protein	NA	H0USY2	Bacillus_phage	47.1	5.0e-45
WP_003209566.1|15214_15445_-	helix-turn-helix transcriptional regulator	NA	S5MBY6	Brevibacillus_phage	47.3	8.5e-14
WP_029427756.1|15906_16152_+	damage repair protein	NA	A0A290FZQ6	Caldibacillus_phage	58.0	2.6e-13
WP_018767625.1|18289_18733_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040118736.1|18898_19606_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	40.8	2.5e-40
WP_018767554.1|19787_20135_-	helix-turn-helix transcriptional regulator	NA	A0A1B1P888	Bacillus_phage	42.6	2.7e-19
WP_018767556.1|20897_21248_-	helix-turn-helix transcriptional regulator	NA	A0A0U3SD25	Bacillus_phage	47.3	3.8e-21
WP_006097390.1|21377_21599_+	helix-turn-helix transcriptional regulator	NA	A0A0U3SLC2	Bacillus_phage	55.6	2.4e-05
WP_018783085.1|21640_22414_+	phage repressor protein/antirepressor Ant	NA	A0A2H4PQV4	Staphylococcus_phage	52.9	4.0e-71
WP_018783084.1|23026_23227_+	hypothetical protein	NA	NA	NA	NA	NA
WP_018783083.1|23228_23426_+	hypothetical protein	NA	NA	NA	NA	NA
WP_018783082.1|23882_24731_+	replication protein	NA	A0A1W6JNM1	Staphylococcus_phage	43.2	1.4e-32
WP_018783081.1|24666_25473_+	ATP-binding protein	NA	A0A1B0T6C3	Bacillus_phage	63.7	4.9e-88
WP_123767139.1|25514_25718_+	hypothetical protein	NA	NA	NA	NA	NA
WP_018767569.1|26236_26623_+	hypothetical protein	NA	A0A288WG73	Bacillus_phage	73.8	1.2e-49
WP_040118737.1|26862_27843_+	lysozyme family protein	NA	A0A223LKM8	Bacillus_phage	41.8	3.5e-32
WP_040118738.1|27870_28089_+	hypothetical protein	NA	A0A218KCJ1	Bacillus_phage	52.5	2.3e-13
WP_040118739.1|28230_29079_+	M23 family metallopeptidase	NA	A0A218KCJ1	Bacillus_phage	42.1	2.7e-28
WP_018783744.1|29128_29554_+|holin	phage holin family protein	holin	A0A1B1P787	Bacillus_phage	85.1	9.1e-62
WP_040118740.1|29553_30555_+	N-acetylmuramoyl-L-alanine amidase	NA	J9PQX3	Bacillus_phage	69.2	6.9e-92
WP_040118738.1|30582_30801_+	hypothetical protein	NA	A0A218KCJ1	Bacillus_phage	52.5	2.3e-13
WP_080739967.1|31056_31221_+	Fur-regulated basic protein FbpA	NA	NA	NA	NA	NA
WP_018783749.1|32838_33387_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040118741.1|33652_34360_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	3.0e-41
WP_018783715.1|34927_35440_+	cysteine hydrolase	NA	NA	NA	NA	NA
WP_018783716.1|35729_36110_-	hypothetical protein	NA	NA	NA	NA	NA
36242:36260	attL	CATGCCCATCAACTTAAGA	NA	NA	NA	NA
WP_040118742.1|36370_37807_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
36242:36260	attL	CATGCCCATCAACTTAAGA	NA	NA	NA	NA
WP_040118743.1|38005_38200_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_040118696.1|38199_38655_+	hypothetical protein	NA	NA	NA	NA	NA
WP_018783699.1|38899_39097_+	type IV secretion protein Rhs	NA	NA	NA	NA	NA
WP_000566919.1|39108_39501_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040118744.1|39558_40131_-|integrase	tyrosine-type recombinase/integrase	integrase	D2XR58	Bacillus_phage	40.8	1.8e-28
WP_018783697.1|40608_41247_-	LysE family transporter	NA	NA	NA	NA	NA
40567:40585	attR	TCTTAAGTTGATGGGCATG	NA	NA	NA	NA
WP_018783696.1|41239_42007_-	YqcI/YcgG family protein	NA	NA	NA	NA	NA
40567:40585	attR	TCTTAAGTTGATGGGCATG	NA	NA	NA	NA
WP_018783695.1|42039_42513_-	YbaK/EbsC family protein	NA	NA	NA	NA	NA
WP_040118712.1|42886_43594_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	1.8e-41
WP_018783662.1|44082_44733_+	type 1 glutamine amidotransferase-like domain-containing protein	NA	NA	NA	NA	NA
WP_006097206.1|45042_45405_+	DUF3796 domain-containing protein	NA	NA	NA	NA	NA
WP_018783661.1|45394_45595_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_006096975.1|46705_47071_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_006096976.1|47407_47581_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016113442.1|47723_48341_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_040118745.1|48464_50693_+	MMPL family transporter	NA	NA	NA	NA	NA
WP_018783658.1|50802_50967_-	DUF4021 family protein	NA	NA	NA	NA	NA
WP_006096981.1|51513_51777_+	transcriptional regulator SplA	NA	NA	NA	NA	NA
WP_018783657.1|51773_52802_+	spore photoproduct lyase	NA	NA	NA	NA	NA
WP_029427994.1|53529_53853_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_158318669.1|54017_54218_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_018783638.1|54133_54724_+|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	39.4	1.7e-29
WP_018783637.1|55184_56051_+	recombinase family protein	NA	A0A219Y9V9	Aeromonas_phage	47.5	3.5e-36
WP_018783636.1|56120_57059_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_018783635.1|57132_57273_+	hypothetical protein	NA	NA	NA	NA	NA
WP_018783634.1|57474_57831_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_018783633.1|58351_59410_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	33.5	1.0e-29
WP_018783632.1|60289_62506_+	hypothetical protein	NA	NA	NA	NA	NA
WP_018783631.1|62785_62998_+	hypothetical protein	NA	NA	NA	NA	NA
WP_018783630.1|63062_63980_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_123767136.1|64724_65288_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040118747.1|65618_66875_-	MFS transporter	NA	NA	NA	NA	NA
WP_018783416.1|66867_67476_-	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
WP_018783414.1|69229_69733_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_029427896.1|71611_72493_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	42.5	3.5e-47
WP_018783411.1|73311_73773_+	CarD family transcriptional regulator	NA	NA	NA	NA	NA
WP_000738547.1|74320_74467_+	BC1881 family protein	NA	NA	NA	NA	NA
WP_018767989.1|74765_74999_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003202925.1|75238_75472_+	YuzF family protein	NA	NA	NA	NA	NA
WP_003202922.1|75539_75815_-	hypothetical protein	NA	NA	NA	NA	NA
WP_018783410.1|76213_77068_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_018783408.1|77962_78892_-	hypothetical protein	NA	NA	NA	NA	NA
WP_018783407.1|79086_79716_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_123767137.1|79769_80648_+	MerR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_018783405.1|81407_82802_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_001120967.1|82938_83271_-	DUF1904 family protein	NA	NA	NA	NA	NA
WP_018783404.1|83993_85163_+	serine hydrolase	NA	A0A1D8EXR7	Mycobacterium_phage	28.3	1.8e-22
WP_123767138.1|85300_85768_+	recombinase family protein	NA	A0A1V0E035	Clostridioides_phage	39.8	3.5e-06
WP_123767141.1|85971_87273_+	teichoic acid transporter	NA	NA	NA	NA	NA
WP_018783400.1|87716_88094_+	YxeA family protein	NA	A0A0K2CYS5	Paenibacillus_phage	39.5	2.4e-13
WP_018783399.1|88238_89669_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_018783398.1|90090_90543_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_018783396.1|91144_91939_+	nucleoside triphosphate hydrolase	NA	NA	NA	NA	NA
WP_018767729.1|92439_93678_+	cytochrome P450	NA	A0A2I2L481	Orpheovirus	27.8	1.2e-05
WP_018783533.1|96048_96663_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_018783532.1|96863_100079_+	cytochrome P450	NA	V5UQK0	Mycobacterium_phage	35.9	1.1e-77
WP_018783531.1|100175_101615_+	NADP-dependent glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_018783529.1|102025_103207_+	DUF3533 domain-containing protein	NA	NA	NA	NA	NA
WP_018783528.1|103520_105050_+	cardiolipin synthase	NA	NA	NA	NA	NA
WP_018783527.1|105201_105657_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016114392.1|105691_106063_+	ATP synthase subunit I	NA	NA	NA	NA	NA
WP_018783526.1|106669_107218_+	VanZ family protein	NA	NA	NA	NA	NA
WP_018783525.1|107474_107909_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040118787.1|108071_108269_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006097496.1|108308_109190_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	41.7	5.0e-46
WP_033799504.1|109198_109495_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_018783523.1|110490_110817_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029427931.1|110809_111046_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_018783518.1|113569_114115_+	DUF3967 domain-containing protein	NA	NA	NA	NA	NA
WP_040118748.1|115758_117297_+	alveolysin	NA	NA	NA	NA	NA
WP_018783364.1|118140_118644_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_018783362.1|119722_120343_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	32.1	4.5e-09
WP_018783361.1|120442_121102_+	serine/threonine protein kinase	NA	NA	NA	NA	NA
WP_051091469.1|121198_121510_-	hypothetical protein	NA	NA	NA	NA	NA
WP_018783359.1|122030_122396_-	YxeA family protein	NA	NA	NA	NA	NA
WP_018783358.1|122495_124352_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_018783357.1|124356_125130_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.4	3.9e-34
WP_018783356.1|125698_126589_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	25.4	8.2e-20
WP_080739953.1|126715_126886_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_018783355.1|127859_128492_-	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_018783354.1|128947_129937_+	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_018783353.1|130098_131535_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP007625	Bacillus pseudomycoides strain 219298 plasmid unnamed, complete sequence	285163	166305	219229	285163	transposase,integrase	Streptococcus_phage(25.0%)	34	151123:151149	226891:226917
151123:151149	attL	TTTTCTTAAGTTGATGGGCATGGGGTA	NA	NA	NA	NA
WP_018783211.1|166305_167184_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_040118790.1|167631_168792_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_040118755.1|169146_170130_+	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_040118756.1|170329_171715_-	chitosanase	NA	NA	NA	NA	NA
WP_040118757.1|172565_173774_-	MFS transporter	NA	NA	NA	NA	NA
WP_040118758.1|174155_175430_+	aspartate aminotransferase family protein	NA	B5LJF5	Mycobacterium_phage	25.2	7.1e-09
WP_040118759.1|175426_176374_+	inorganic polyphosphate kinase	NA	NA	NA	NA	NA
WP_018783202.1|176351_177398_+	alcohol dehydrogenase catalytic domain-containing protein	NA	E3SJ82	Synechococcus_phage	28.2	4.5e-09
WP_029427806.1|178110_179049_+	class A beta-lactamase	NA	A0A1B0VBP7	Salmonella_phage	44.2	2.0e-56
WP_080739956.1|180108_181266_+	acyltransferase	NA	NA	NA	NA	NA
WP_040118760.1|182031_182691_-	L-serine ammonia-lyase, iron-sulfur-dependent, subunit beta	NA	NA	NA	NA	NA
WP_018783196.1|183062_183974_-	DMT family transporter	NA	NA	NA	NA	NA
WP_018783195.1|183970_185203_-	5-aminolevulinate synthase	NA	V5LQ39	Emiliania_huxleyi_virus	30.5	1.1e-38
WP_040118761.1|186655_186961_+	monooxygenase	NA	NA	NA	NA	NA
WP_018783191.1|187368_188598_-	serine hydrolase	NA	NA	NA	NA	NA
WP_123767142.1|189728_190403_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	64.6	2.6e-66
WP_018783189.1|190708_190891_+	hypothetical protein	NA	NA	NA	NA	NA
WP_018783188.1|191517_192948_+	alanine:cation symporter family protein	NA	NA	NA	NA	NA
WP_040118762.1|193483_194470_+	glutaminase	NA	NA	NA	NA	NA
WP_018783186.1|194708_196025_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_018783185.1|196029_196974_+	response regulator	NA	NA	NA	NA	NA
WP_018783184.1|197101_197809_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	44.4	1.4e-43
WP_018783183.1|198377_198602_+	hypothetical protein	NA	NA	NA	NA	NA
WP_018783181.1|200130_200916_+	3-hydroxybutyryl-CoA dehydratase	NA	NA	NA	NA	NA
WP_040118763.1|203898_204780_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	41.4	3.3e-45
WP_018783218.1|205906_206563_-	hypothetical protein	NA	NA	NA	NA	NA
WP_018783220.1|208370_208871_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002107182.1|210057_210396_-	hypothetical protein	NA	NA	NA	NA	NA
WP_018783222.1|210400_210598_-	helix-turn-helix transcriptional regulator	NA	A0A142LP09	Marinitoga_camini_virus	39.7	1.6e-05
WP_018783223.1|210891_212325_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_018783224.1|213203_213878_-	S-layer homology domain-containing protein	NA	NA	NA	NA	NA
WP_018767543.1|214653_215298_-	F0F1 ATP synthase subunit alpha	NA	NA	NA	NA	NA
WP_018783226.1|216039_217704_+	peptidase M4 family protein	NA	NA	NA	NA	NA
WP_018783227.1|218203_219229_+|transposase	IS1595-like element ISBth19 family transposase	transposase	NA	NA	NA	NA
226891:226917	attR	TTTTCTTAAGTTGATGGGCATGGGGTA	NA	NA	NA	NA
