The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP007722	Corynebacterium glutamicum strain ATCC 21831, complete genome	3176076	34922	84331	3176076	transposase,protease	Escherichia_phage(55.56%)	40	NA	NA
WP_074493074.1|34922_35612_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_038581881.1|37879_38104_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003861074.1|39091_39364_-	cell division protein CrgA	NA	NA	NA	NA	NA
WP_038581883.1|39476_41420_-	Stk1 family PASTA domain-containing Ser/Thr kinase	NA	A0A2R3ZRI5	Marseillevirus	31.5	7.0e-16
WP_038581885.1|41416_42826_-	serine/threonine protein kinase	NA	K7YID8	Megavirus	31.2	1.2e-17
WP_038581886.1|42829_44254_-	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_038581888.1|44250_45576_-	FtsW/RodA/SpoVE family cell cycle protein	NA	NA	NA	NA	NA
WP_038581891.1|45572_46928_-	serine/threonine-protein phosphatase	NA	NA	NA	NA	NA
WP_003855394.1|46927_47392_-	FHA domain-containing protein	NA	NA	NA	NA	NA
WP_003855395.1|47408_48275_-	DUF3662 and FHA domain-containing protein	NA	NA	NA	NA	NA
WP_080724050.1|48800_49523_-	heme peroxidase	NA	NA	NA	NA	NA
WP_080724052.1|52563_52983_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038581893.1|53123_54290_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155274383.1|54312_54750_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038581898.1|55373_57161_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_038581903.1|58439_59066_+	recombinase family protein	NA	A0A286S1P7	Klebsiella_phage	36.4	8.5e-24
WP_038581905.1|59585_60737_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038581909.1|61495_61822_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145973343.1|62304_62604_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010889963.1|62850_63561_+|transposase	IS6-like element IS1628 family transposase	transposase	A0A077SL39	Escherichia_phage	58.5	6.8e-78
WP_038586668.1|63833_64049_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080724054.1|67919_68384_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080724055.1|68377_69229_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038581926.1|69205_69916_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	57.3	6.8e-78
WP_038586680.1|70079_71306_+	hypothetical protein	NA	NA	NA	NA	NA
WP_034982465.1|71977_72241_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003858913.1|72242_72542_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003858908.1|73519_73780_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003858906.1|73779_74181_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010889963.1|74662_75373_-|transposase	IS6-like element IS1628 family transposase	transposase	A0A077SL39	Escherichia_phage	58.5	6.8e-78
WP_051904565.1|75447_75987_+	DUF4263 domain-containing protein	NA	NA	NA	NA	NA
WP_038581930.1|76189_77221_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	53.6	3.8e-29
WP_010889963.1|77922_78633_+|transposase	IS6-like element IS1628 family transposase	transposase	A0A077SL39	Escherichia_phage	58.5	6.8e-78
WP_011014007.1|78877_79342_-	hypothetical protein	NA	NA	NA	NA	NA
WP_034982465.1|81112_81376_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003858913.1|81377_81677_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003858908.1|82650_82911_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003858906.1|82910_83312_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155274384.1|83383_83644_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038581926.1|83620_84331_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	57.3	6.8e-78
>prophage 2
NZ_CP007722	Corynebacterium glutamicum strain ATCC 21831, complete genome	3176076	1445275	1501129	3176076	integrase,protease,transposase,tRNA	Iris_mild_mosaic_virus(11.11%)	54	1490040:1490091	1503669:1503720
WP_074508439.1|1445275_1446757_+|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_003854060.1|1446828_1447044_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_038583806.1|1447044_1447518_-	DUF2975 domain-containing protein	NA	NA	NA	NA	NA
WP_038583808.1|1447634_1448159_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080724190.1|1448243_1448744_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_143855340.1|1448782_1449253_-	SRPBCC domain-containing protein	NA	NA	NA	NA	NA
WP_038583815.1|1451039_1452017_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_038583818.1|1452340_1454137_-	phosphomethylpyrimidine synthase ThiC	NA	NA	NA	NA	NA
WP_145973367.1|1454461_1454752_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038586943.1|1455290_1455620_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038583821.1|1455832_1458220_-	glycogen/starch/alpha-glucan phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	47.7	6.4e-19
WP_038583825.1|1458415_1458574_-	hypothetical protein	NA	A0A1V0SKJ6	Klosneuvirus	60.0	1.8e-07
WP_038583828.1|1458631_1460041_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_038586949.1|1460666_1462043_-|transposase	IS1380-like element IS1677 family transposase	transposase	NA	NA	NA	NA
WP_010991833.1|1462599_1462956_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011015203.1|1462960_1464583_-	hypothetical protein	NA	A0A160DH52	Gordonia_phage	32.4	9.0e-17
WP_080724100.1|1464825_1466193_-|transposase	IS1380-like element ISCgl4 family transposase	transposase	NA	NA	NA	NA
WP_038583836.1|1466764_1467244_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038583839.1|1467304_1467871_+	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A2I2L310	Orpheovirus	36.8	7.0e-09
WP_003861499.1|1467853_1468561_-	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_038583842.1|1468741_1470187_+	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
WP_011014282.1|1470204_1470798_+	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
WP_038586961.1|1471283_1472660_+|transposase	IS1380-like element IS1677 family transposase	transposase	NA	NA	NA	NA
WP_011014283.1|1472837_1473917_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_011014284.1|1473925_1474084_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003858849.1|1474125_1475124_+	NAD(P)-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_003861506.1|1475148_1476231_+	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_038583847.1|1476287_1477268_-	DUF3515 domain-containing protein	NA	NA	NA	NA	NA
WP_011014287.1|1477335_1478325_+	thiamine-phosphate kinase	NA	NA	NA	NA	NA
WP_038583862.1|1478324_1479074_+	uracil-DNA glycosylase	NA	S4VZ65	Pandoravirus	35.7	5.6e-30
WP_080724191.1|1479205_1480789_+	DAK2 domain-containing protein	NA	NA	NA	NA	NA
WP_038583867.1|1480793_1482917_+	ATP-dependent DNA helicase RecG	NA	NA	NA	NA	NA
WP_003858832.1|1482936_1483152_+	acetyl-CoA carboxylase biotin carboxyl carrier protein subunit	NA	NA	NA	NA	NA
WP_003858829.1|1483151_1483736_+	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_038583872.1|1483739_1484222_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	30.8	2.5e-15
WP_003858826.1|1484793_1485558_-	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.9	1.6e-19
WP_038583875.1|1485561_1486512_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_003858822.1|1486554_1487559_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003858818.1|1487658_1488468_+	DUF1266 domain-containing protein	NA	NA	NA	NA	NA
WP_003858816.1|1488550_1489531_-	DUF368 domain-containing protein	NA	NA	NA	NA	NA
1490040:1490091	attL	GTTTCCGCTGGTAGTGGTGCCCCTGGTGAGACTCGAACTCACACTGGACGGG	NA	NA	NA	NA
WP_011014293.1|1490178_1490937_-|integrase	site-specific integrase	integrase	G9FH48	Rhodococcus_phage	32.1	1.8e-15
WP_011014294.1|1490922_1491333_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003861519.1|1491329_1492076_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003858809.1|1492268_1492703_+	metallopeptidase	NA	NA	NA	NA	NA
WP_089158527.1|1493381_1494583_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	34.2	2.5e-27
WP_003858803.1|1494688_1495303_+	DUF4258 domain-containing protein	NA	NA	NA	NA	NA
WP_003858801.1|1495305_1495527_+	DUF2283 domain-containing protein	NA	NA	NA	NA	NA
WP_038583885.1|1496175_1496610_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003858799.1|1496625_1496841_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003858795.1|1497279_1497651_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011014297.1|1497671_1497989_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003858792.1|1498367_1498571_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003861526.1|1499542_1499920_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003861528.1|1500178_1501129_-|protease	trypsin-like serine protease	protease	NA	NA	NA	NA
1503669:1503720	attR	GTTTCCGCTGGTAGTGGTGCCCCTGGTGAGACTCGAACTCACACTGGACGGG	NA	NA	NA	NA
