The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP007763	Brucella melitensis bv. 1 str. 16M chromosome 1, complete sequence	2116984	2338	63709	2116984	portal,transposase,holin,tail	Rhodobacter_phage(14.29%)	59	NA	NA
WP_005969645.1|2338_2893_-|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	33.9	3.9e-12
WP_002975117.1|3716_4034_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004686778.1|4644_6000_+	phosphomannomutase	NA	NA	NA	NA	NA
WP_004683228.1|6070_7495_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	30.8	6.9e-53
WP_002963690.1|7527_8700_+	AGE family epimerase/isomerase	NA	NA	NA	NA	NA
WP_002969456.1|8782_9892_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_109790518.1|10240_10444_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004683239.1|12137_13139_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_002969455.1|13217_14180_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004683241.1|14237_15290_+	sugar phosphate isomerase/epimerase	NA	NA	NA	NA	NA
WP_004683244.1|15297_16470_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_002966715.1|16511_17819_-	xylose isomerase	NA	NA	NA	NA	NA
WP_004683247.1|17865_19317_-	xylulokinase	NA	NA	NA	NA	NA
WP_004683249.1|19349_20381_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_004683252.1|20642_21161_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004683253.1|21067_21637_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_002963701.1|22175_23639_-	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_004683256.1|23790_25473_-|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	30.6	6.0e-40
WP_004683258.1|25475_26072_-	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_002963705.1|26262_27285_+	asparaginase	NA	NA	NA	NA	NA
WP_002967489.1|27329_27800_+	transcription elongation factor	NA	NA	NA	NA	NA
WP_002963707.1|27796_28186_-	type II toxin-antitoxin system death-on-curing family toxin	NA	A0A1B3AYM0	Gordonia_phage	44.6	3.5e-07
WP_004683261.1|28182_28413_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_002963709.1|28473_29466_-	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_004683264.1|29621_30299_+	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004683266.1|30295_31594_+	CynX/NimT family MFS transporter	NA	NA	NA	NA	NA
WP_002963712.1|31650_32013_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002963713.1|32348_33860_+	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.3	1.4e-83
WP_002963714.1|34057_34774_-	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_002971536.1|34832_35075_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004683270.1|35951_36551_+	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	43.1	6.2e-40
WP_002963717.1|36722_37058_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002967492.1|37175_39284_-	S9 family peptidase	NA	NA	NA	NA	NA
WP_002963720.1|39856_40285_+	MucR family transcriptional regulator	NA	A0A1P8VVG0	Erythrobacter_phage	47.6	1.0e-20
WP_002969861.1|40492_40804_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004683273.1|40985_41441_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005969604.1|41437_42211_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002967494.1|42323_43661_+	amidase	NA	NA	NA	NA	NA
WP_002963725.1|43701_44127_-	SufE family protein	NA	NA	NA	NA	NA
WP_004683280.1|44206_44671_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004686781.1|44961_46791_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	28.9	1.2e-22
WP_002971535.1|46765_47734_+	peptidoglycan-binding protein	NA	NA	NA	NA	NA
WP_002963729.1|47747_48095_+	DUF1491 family protein	NA	NA	NA	NA	NA
WP_004686782.1|48105_49164_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004683287.1|49361_49904_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002963732.1|49896_50508_-	DUF1214 domain-containing protein	NA	NA	NA	NA	NA
WP_002969866.1|50514_52689_-	penicillin-binding protein 1A	NA	NA	NA	NA	NA
WP_002963734.1|53028_53541_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005969588.1|53479_54739_+	DNA-packaging protein	NA	A0A1V0DY66	Dinoroseobacter_phage	40.6	1.3e-71
WP_002963736.1|54770_55964_+|portal	phage portal protein	portal	W8ECU7	Geobacillus_phage	40.0	7.0e-67
WP_002967499.1|55960_56338_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002963743.1|56388_56802_+|tail	phage major tail protein, TP901-1 family	tail	NA	NA	NA	NA
WP_004683300.1|56798_57140_+	gene transfer agent family protein	NA	NA	NA	NA	NA
WP_004683301.1|57183_57354_+|tail	phage tail assembly chaperone	tail	NA	NA	NA	NA
WP_002970984.1|57358_57904_+|tail	phage tail tape measure protein	tail	A0A0S2SYD9	Pseudomonas_phage	46.4	2.8e-07
WP_002963747.1|57906_58539_+	TIGR02217 family protein	NA	A0A0B5A2K3	Paracoccus_phage	47.6	2.9e-48
WP_004683305.1|58535_59411_+	DUF2163 domain-containing protein	NA	A0A0K1Y6Z2	Rhodobacter_phage	38.9	4.5e-47
WP_004683307.1|59407_59842_+	peptidase P60	NA	NA	NA	NA	NA
WP_004686783.1|59845_63709_+	host specificity protein	NA	A0A0K1LL82	Rhodobacter_phage	38.6	3.6e-213
>prophage 2
NZ_CP007763	Brucella melitensis bv. 1 str. 16M chromosome 1, complete sequence	2116984	326600	338527	2116984	tRNA	uncultured_Mediterranean_phage(90.0%)	13	NA	NA
WP_004683698.1|326600_327452_+	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	33.5	4.4e-31
WP_004683699.1|327444_328170_+	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	45.1	4.3e-43
WP_002964012.1|328315_328534_+	twin-arginine translocase TatA/TatE family subunit	NA	A0A1B1IVR9	uncultured_Mediterranean_phage	65.1	1.5e-07
WP_004686803.1|328644_329226_+	twin-arginine translocase subunit TatB	NA	NA	NA	NA	NA
WP_004683701.1|329222_330047_+	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	41.5	2.6e-44
WP_004683702.1|330123_331407_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	47.2	2.6e-104
WP_004683703.1|331555_332323_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	40.2	1.0e-39
WP_004683704.1|332319_332988_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	38.5	6.6e-14
WP_002964018.1|333132_333318_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002964019.1|333366_334665_+	peptidoglycan DD-metalloendopeptidase family protein	NA	Q8SBN9	Clostridium_phage	41.1	1.0e-18
WP_002964020.1|334713_335580_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_002964021.1|335739_336081_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	40.2	9.1e-12
WP_011005223.1|336199_338527_+	protein translocase subunit SecDF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	43.5	6.2e-51
>prophage 3
NZ_CP007763	Brucella melitensis bv. 1 str. 16M chromosome 1, complete sequence	2116984	407557	417578	2116984	integrase,transposase	Brucella_phage(37.5%)	15	407440:407480	422541:422581
407440:407480	attL	AGCTTGGGAAGCTGACAGGCTACCATTACATCATACCCGCA	NA	NA	NA	NA
WP_004686809.1|407557_408583_-|integrase	site-specific integrase	integrase	A0A141GEZ3	Brucella_phage	36.4	3.7e-48
WP_004683737.1|408569_408773_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005968947.1|408775_408991_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002964088.1|408987_409191_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005968944.1|409240_409945_+	hypothetical protein	NA	A0A076GD06	Sinorhizobium_phage	46.8	4.5e-05
WP_002964091.1|409941_410172_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002964092.1|410168_410444_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004683738.1|410466_411054_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004683739.1|411288_411999_+	porin family protein	NA	O11861	Bartonella_henselae_phage	36.8	5.1e-41
WP_004686810.1|412346_412517_-	YegP family protein	NA	A0A2P1N580	Mycobacterium_phage	43.1	9.1e-05
WP_004683740.1|412864_413179_-	BrnA antitoxin family protein	NA	K4NZP3	Burkholderia_phage	42.1	2.0e-05
WP_004683741.1|413178_413424_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104987955.1|414264_415021_+|transposase	IS5 family transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	41.0	2.7e-16
WP_002967634.1|415022_415796_+	hypothetical protein	NA	A0A141GEY5	Brucella_phage	97.8	1.3e-122
WP_004685623.1|416126_417578_+	hypothetical protein	NA	A0A141GEY6	Brucella_phage	57.1	1.3e-136
422541:422581	attR	AGCTTGGGAAGCTGACAGGCTACCATTACATCATACCCGCA	NA	NA	NA	NA
