The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP009114	Klebsiella pneumoniae strain carbapenem-resistant blaNDM-1 chromosome, complete genome	5297511	1305	58475	5297511	tail,tRNA,plate,protease	Salmonella_phage(42.86%)	54	NA	NA
WP_038430657.1|1305_1884_+|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	84.9	3.0e-92
WP_000177580.1|1880_2240_+	GPW/gp25 family protein	NA	A0A1S6KZZ4	Salmonella_phage	87.4	3.2e-52
WP_021532224.1|2226_3135_+|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	90.7	1.2e-143
WP_001086820.1|3127_3733_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	92.5	5.2e-111
WP_077263504.1|6453_6708_-|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	77.1	1.9e-30
WP_001555853.1|6738_7305_+	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	84.8	2.2e-87
WP_001555854.1|7447_8620_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.0	4.6e-204
WP_001207660.1|8629_9145_+|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.3	2.1e-89
WP_001281009.1|9199_9502_+|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	5.3e-40
WP_000763311.1|9516_9636_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
WP_001282787.1|9628_12706_+|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	63.0	0.0e+00
WP_000980414.1|12702_13188_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.0	1.8e-66
WP_021566199.1|13184_14285_+	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	87.7	5.5e-175
WP_000972391.1|14375_14594_+	ogr/Delta-like zinc finger family protein	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_004179131.1|14814_16500_-	aspartate:alanine antiporter	NA	NA	NA	NA	NA
WP_002896351.1|16766_17150_+	inner membrane protein YbjM	NA	NA	NA	NA	NA
WP_002896352.1|17156_17420_-	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	73.1	1.6e-27
WP_002896354.1|17622_17910_+	YbjC family protein	NA	NA	NA	NA	NA
WP_002896363.1|18731_19634_+	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	35.3	2.0e-34
WP_002896365.1|19722_20202_+	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_002896368.1|20550_21663_+	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_002896370.1|21826_22960_+	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.9	2.2e-30
WP_002896371.1|22970_23924_+	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_002896372.1|23920_24766_+	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_002896376.1|24823_25312_+	DUF2593 family protein	NA	NA	NA	NA	NA
WP_002896378.1|25353_26481_+	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A2K5B251	Erysipelothrix_phage	25.6	1.3e-19
WP_002896380.1|26559_27276_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.9	2.1e-34
WP_002896382.1|27272_28745_+	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	31.8	7.9e-28
WP_002896384.1|28787_29519_-	ABC transporter substrate-binding protein ArtJ	NA	NA	NA	NA	NA
WP_004150852.1|29702_30371_-	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_002896386.1|30370_31087_-	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_002896390.1|31093_31825_-	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002896392.1|31845_32574_-	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	37.1	1.2e-29
WP_002896394.1|32800_33316_-	lipoprotein	NA	NA	NA	NA	NA
WP_004150851.1|34193_35333_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_002896397.1|35364_36195_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	31.6	4.1e-05
WP_002896399.1|36191_37205_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_002896401.1|37292_38735_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_038430658.1|38745_39747_-	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_002896406.1|39785_41504_-	ubiquinone-dependent pyruvate dehydrogenase	NA	NA	NA	NA	NA
WP_002896408.1|41655_42090_+	DoxX family protein	NA	NA	NA	NA	NA
WP_002896410.1|42301_43270_-	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_002896412.1|43280_44933_-	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_004147773.1|45076_45976_-	lysine exporter LysO family protein	NA	NA	NA	NA	NA
WP_002896434.1|46091_46787_-	aquaporin Z	NA	NA	NA	NA	NA
WP_002896437.1|47206_48865_+	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_002896440.1|49011_50127_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
WP_004150848.1|50123_52064_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
WP_002896516.1|52140_52362_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_002896520.1|52687_53005_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896522.1|53035_55315_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
WP_001040187.1|55435_55654_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_002898014.1|56007_56709_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_004150847.1|56753_58475_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
>prophage 2
NZ_CP009114	Klebsiella pneumoniae strain carbapenem-resistant blaNDM-1 chromosome, complete genome	5297511	68917	110136	5297511	plate,head,tail,terminase,integrase,portal,holin,tRNA,lysis,capsid	Escherichia_phage(63.27%)	52	73557:73573	120044:120060
WP_002898139.1|68917_70210_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	44.7	7.3e-94
WP_002898141.1|70410_72849_+	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	50.2	2.8e-219
WP_004150845.1|72859_73477_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	58.1	2.6e-73
WP_004150844.1|73478_74342_+	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
73557:73573	attL	CTGGCGCTGGCGCTGAT	NA	NA	NA	NA
WP_004150843.1|74616_75765_+	MFS transporter	NA	NA	NA	NA	NA
WP_051959684.1|75927_76725_-	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.6	2.3e-21
WP_000023395.1|76756_77752_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LA05	Escherichia_phage	100.0	7.1e-190
WP_000072552.1|77845_78157_-	helix-turn-helix transcriptional regulator	NA	Q1JS25	Enterobacteria_phage	100.0	4.3e-53
WP_000022051.1|78261_78618_+	hypothetical protein	NA	A0A0F7LDH4	Escherichia_phage	100.0	1.1e-63
WP_000217670.1|78795_79296_+	hypothetical protein	NA	M1SV55	Escherichia_phage	100.0	2.6e-92
WP_000557703.1|79360_79585_+	DUF2732 family protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
WP_001754915.1|79584_79887_+	DUF5405 family protein	NA	A0A0F7LCL4	Escherichia_phage	100.0	3.5e-47
WP_001113263.1|79886_80111_+	TraR/DksA family transcriptional regulator	NA	A0A0F7LDG9	Escherichia_phage	100.0	2.2e-35
WP_000027667.1|80107_80383_+	DUF5405 family protein	NA	Q858T5	Yersinia_virus	100.0	3.8e-45
WP_038430660.1|80372_82661_+	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	98.0	0.0e+00
WP_001302990.1|83069_83225_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001310277.1|83261_83570_+	helix-turn-helix transcriptional regulator	NA	E5E3S9	Burkholderia_phage	40.2	1.7e-12
WP_000746343.1|83547_84498_+	RNA-directed DNA polymerase	NA	E5E3S8	Burkholderia_phage	40.0	3.8e-39
WP_000042038.1|84622_85060_-	hypothetical protein	NA	S4TUD6	Salmonella_phage	92.3	1.6e-69
WP_000551925.1|85058_85253_+	hypothetical protein	NA	S4TRZ0	Salmonella_phage	89.1	8.5e-23
WP_001177885.1|85283_85553_-	hypothetical protein	NA	Q2P9X2	Enterobacteria_phage	89.9	3.8e-29
WP_000038161.1|85765_86800_-|portal	phage portal protein	portal	A0A0F7LDI7	Escherichia_phage	100.0	1.9e-201
WP_000156872.1|86799_88572_-|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	100.0	0.0e+00
WP_001085953.1|88745_89600_+|capsid	GPO family capsid scaffolding protein	capsid	Q778Z1	Enterobacteria_phage	100.0	4.6e-137
WP_016237184.1|89658_90732_+|capsid	phage major capsid protein, P2 family	capsid	Q94MK7	Enterobacteria_phage	99.7	5.1e-202
WP_072198306.1|90759_91479_+|terminase	terminase endonuclease subunit	terminase	U5N091	Enterobacteria_phage	98.3	5.6e-120
WP_000988633.1|91578_92088_+|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_038430663.1|92087_92291_+|tail	tail protein X	tail	A0A0F7LCN2	Escherichia_phage	98.5	8.8e-31
WP_000123123.1|92294_92576_+|holin	phage holin family protein	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_038430665.1|92575_93073_+	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	99.4	1.2e-92
WP_038430667.1|93087_93516_+	hypothetical protein	NA	A0A0F7LDU9	Escherichia_phage	96.5	1.5e-59
WP_038430668.1|93500_93926_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A0F7LDJ6	Escherichia_phage	95.0	3.0e-65
WP_000917182.1|94033_94501_+|tail	phage tail protein	tail	Q7Y4E0	Escherichia_virus	99.4	1.9e-81
WP_001001782.1|94493_94946_+	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	99.3	4.1e-76
WP_038430670.1|95012_95648_+|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	96.7	3.0e-109
WP_000127163.1|95644_95992_+	GPW/gp25 family protein	NA	A0A0F7L9X3	Escherichia_phage	100.0	1.7e-58
WP_001121479.1|95996_96905_+|plate	baseplate assembly protein	plate	A0A0F7LCQ9	Escherichia_phage	99.7	7.5e-162
WP_001285307.1|96897_97509_+|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	99.5	2.4e-116
WP_038430671.1|97505_98690_+|tail	phage tail protein	tail	A0A0F7LBW5	Escherichia_phage	80.3	4.0e-163
WP_038430672.1|98692_99133_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	67.3	1.7e-50
WP_038430673.1|99104_99707_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	87.5	1.1e-95
WP_174221272.1|99706_100252_-|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	61.4	1.1e-48
WP_038430674.1|100279_100873_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	97.5	4.6e-104
WP_001286734.1|100932_102123_+|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.7	4.8e-225
WP_001251408.1|102135_102654_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001031303.1|102709_102985_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_000785970.1|103017_103137_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_038430675.1|103129_105577_+|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	96.6	0.0e+00
WP_000978889.1|105591_106071_+|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	99.4	1.5e-84
WP_016240314.1|106070_107234_+	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	99.7	6.3e-206
WP_000468308.1|107315_107534_+	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_002898148.1|107853_110136_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.8	8.4e-162
120044:120060	attR	CTGGCGCTGGCGCTGAT	NA	NA	NA	NA
>prophage 3
NZ_CP009114	Klebsiella pneumoniae strain carbapenem-resistant blaNDM-1 chromosome, complete genome	5297511	477471	492988	5297511	integrase,transposase	Escherichia_phage(21.43%)	17	480151:480166	493192:493207
WP_004140269.1|477471_478281_-	peptide ABC transporter ATP-binding protein SapF	NA	A0A2H4PQG7	Staphylococcus_phage	28.9	2.1e-14
WP_004140266.1|478282_479275_-	peptide ABC transporter ATP-binding protein SapD	NA	G9BWD6	Planktothrix_phage	27.2	3.0e-07
WP_004151901.1|479274_480165_-	peptide ABC transporter permease SapC	NA	NA	NA	NA	NA
480151:480166	attL	GCTATCGTAGGGCATA	NA	NA	NA	NA
WP_004151900.1|480311_481529_+|integrase	site-specific integrase	integrase	K7PGY1	Enterobacteria_phage	51.9	8.6e-121
WP_004151899.1|481736_482399_-	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	84.6	2.7e-105
WP_004151898.1|482395_482824_-	hypothetical protein	NA	M9NYX4	Enterobacteria_phage	80.3	7.5e-64
WP_004201102.1|482820_483501_-	YqaJ viral recombinase family protein	NA	A0A0M3ULE0	Salmonella_phage	91.2	8.2e-121
WP_088224434.1|483502_483790_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004201103.1|483786_484632_-	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	59.2	1.8e-69
WP_004201105.1|484647_484932_-	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	79.8	1.1e-39
WP_004135674.1|485020_485215_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|485359_486064_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_004178082.1|487973_489461_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_002901812.1|489540_489960_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	57.5	1.4e-35
WP_002901813.1|489961_491227_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	82.7	9.6e-208
WP_071531199.1|491302_492130_-	FRG domain-containing protein	NA	A0A1S6KZX9	Salmonella_phage	30.2	8.4e-19
WP_002901815.1|492316_492988_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	59.6	4.5e-79
493192:493207	attR	GCTATCGTAGGGCATA	NA	NA	NA	NA
>prophage 4
NZ_CP009114	Klebsiella pneumoniae strain carbapenem-resistant blaNDM-1 chromosome, complete genome	5297511	525921	597418	5297511	terminase,holin,integrase,plate	uncultured_Caudovirales_phage(34.0%)	83	524002:524016	532942:532956
524002:524016	attL	AGTTGATCCTCTGGC	NA	NA	NA	NA
WP_004152144.1|525921_526683_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.5	2.4e-20
WP_004152145.1|526899_528432_+	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	30.0	1.1e-21
WP_016197745.1|528630_529179_-	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
WP_004152147.1|529375_530557_+|integrase	site-specific integrase	integrase	A0A0M4QX09	Salmonella_phage	84.2	5.6e-202
WP_004152148.1|530537_530780_-	hypothetical protein	NA	A0A0M4RTZ2	Salmonella_phage	73.8	2.2e-20
WP_004198245.1|530739_530886_-	hypothetical protein	NA	A0A1B5FPC2	Escherichia_phage	70.8	2.9e-15
WP_014343018.1|530958_531192_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152150.1|531434_531647_-	hypothetical protein	NA	A0A286S2B6	Klebsiella_phage	98.6	3.4e-33
WP_004152151.1|531643_531868_-	hypothetical protein	NA	A0A286S2B3	Klebsiella_phage	89.2	3.1e-29
WP_004154298.1|531857_532568_-	Rha family transcriptional regulator	NA	A0A286S260	Klebsiella_phage	88.3	2.1e-111
WP_004152153.1|532573_533092_-	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	98.8	1.7e-94
532942:532956	attR	GCCAGAGGATCAACT	NA	NA	NA	NA
WP_004152154.1|533196_534024_-	hypothetical protein	NA	Q8W654	Enterobacteria_phage	84.0	5.5e-111
WP_004152155.1|534020_534215_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152156.1|534211_534637_-	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	77.9	3.5e-53
WP_004177208.1|534633_534852_-	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	98.6	6.6e-32
WP_004152157.1|534823_535078_-	hypothetical protein	NA	A0A286SGR4	Klebsiella_phage	97.6	3.1e-41
WP_004152158.1|535070_535436_-	hypothetical protein	NA	A0A286S1Q6	Klebsiella_phage	99.2	6.9e-58
WP_004152159.1|535605_535794_-	hypothetical protein	NA	A0A286S1P8	Klebsiella_phage	100.0	4.6e-26
WP_004152160.1|535786_536101_-	hypothetical protein	NA	A0A286S1T9	Klebsiella_phage	100.0	1.0e-49
WP_004152161.1|536271_536940_-	LexA family transcriptional regulator	NA	A0A286S2B2	Klebsiella_phage	99.5	2.4e-125
WP_004152162.1|537037_537259_+	helix-turn-helix transcriptional regulator	NA	A0A286S2C1	Klebsiella_phage	100.0	3.0e-32
WP_004198228.1|537835_539494_+	DEAD/DEAH box helicase	NA	A0A286N2P9	Klebsiella_phage	96.0	0.0e+00
WP_004198233.1|539495_540458_+	toprim domain-containing protein	NA	A0A286N2Q0	Klebsiella_phage	99.4	4.8e-183
WP_004198239.1|540454_540931_+	hypothetical protein	NA	A0A286N2Q1	Klebsiella_phage	100.0	1.8e-90
WP_004152167.1|540927_541710_+	antitermination protein	NA	F1C595	Cronobacter_phage	76.8	7.2e-113
WP_004146526.1|542115_542364_+|holin	class II holin family protein	holin	NA	NA	NA	NA
WP_004152169.1|542366_542897_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	77.1	2.7e-79
WP_004153952.1|542893_543283_+	lipase chaperone	NA	A0A192Y6H8	Salmonella_phage	49.2	9.4e-21
WP_004152170.1|543517_543838_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004218030.1|544203_544692_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152172.1|544642_546043_+|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	69.0	9.4e-188
WP_004152173.1|546280_547732_+	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	68.8	3.8e-192
WP_004152174.1|547787_548336_+	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	56.3	3.0e-49
WP_004199270.1|548387_549590_+	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	54.1	2.6e-106
WP_000528476.1|549593_550088_+	hypothetical protein	NA	A0A2H4JHM9	uncultured_Caudovirales_phage	62.7	4.2e-50
WP_001132269.1|550099_551041_+	DUF2184 domain-containing protein	NA	A0A2H4J191	uncultured_Caudovirales_phage	77.1	1.7e-137
WP_000725700.1|551080_551362_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000113538.1|551330_551750_+	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	60.7	3.3e-40
WP_000834982.1|551746_552253_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001116156.1|552252_552639_+	hypothetical protein	NA	A0A2H4J1A4	uncultured_Caudovirales_phage	78.2	1.1e-48
WP_004152176.1|552733_553174_+	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	51.7	1.6e-40
WP_004152177.1|553177_554323_+	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	76.9	6.3e-166
WP_004199809.1|554333_554774_+	DUF3277 family protein	NA	A0A0M5M1K6	Salmonella_phage	80.1	3.3e-62
WP_004152564.1|554777_555203_+	hypothetical protein	NA	A0A2H4J2V6	uncultured_Caudovirales_phage	63.4	2.6e-40
WP_004152565.1|555238_555391_+	hypothetical protein	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	88.0	7.6e-19
WP_004152566.1|555380_557384_+	lytic transglycosylase domain-containing protein	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	63.6	1.2e-247
WP_004152567.1|557383_557983_+	hypothetical protein	NA	A0A2H4J1B3	uncultured_Caudovirales_phage	57.6	9.9e-54
WP_004217362.1|558058_558286_+	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	56.0	4.6e-20
WP_004152569.1|558288_559311_+	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	54.2	9.2e-100
WP_004152570.1|559310_559652_+	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	46.6	1.8e-23
WP_004199301.1|559701_559884_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152571.1|559926_560493_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152572.1|560546_561200_+	hypothetical protein	NA	A0A2H4J8H6	uncultured_Caudovirales_phage	63.5	1.0e-59
WP_004152573.1|561201_561555_+	hypothetical protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	80.3	2.3e-50
WP_004152574.1|561554_562751_+|plate	baseplate J/gp47 family protein	plate	A0A0M4RD32	Salmonella_phage	72.9	3.9e-158
WP_004152575.1|562747_563521_+	DUF2612 domain-containing protein	NA	A0A2H4J1A9	uncultured_Caudovirales_phage	54.4	2.8e-77
WP_004152576.1|563520_564387_+	hypothetical protein	NA	A0A2H4IYR0	uncultured_Caudovirales_phage	64.5	1.9e-34
WP_004152577.1|564386_564584_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004218487.1|566934_567663_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002902128.1|567673_568405_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002902131.1|568401_568611_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002902133.1|568715_569000_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002902136.1|569222_569471_-	DinI-like family protein	NA	S5MQI1	Escherichia_phage	70.4	1.4e-25
WP_002902144.1|570316_570808_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_002902148.1|570850_572395_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_004218490.1|572404_573748_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_004151603.1|573744_574434_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_004151602.1|574430_576137_+	OmpA family protein	NA	NA	NA	NA	NA
WP_002902160.1|576141_576633_+	type VI secretion system effector Hcp	NA	NA	NA	NA	NA
WP_002902163.1|576897_579552_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	33.4	2.5e-96
WP_004228410.1|579553_581923_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	33.8	9.1e-18
WP_002902169.1|581923_582703_+	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_002902172.1|582766_583297_+	T6SS immunity phospholipase A1-binding lipoprotein Tli1-KP	NA	NA	NA	NA	NA
WP_002902174.1|583365_583896_+	T6SS immunity phospholipase A1-binding lipoprotein Tli1-KP	NA	NA	NA	NA	NA
WP_002902176.1|583963_584494_+	T6SS immunity phospholipase A1-binding lipoprotein Tli1-KP	NA	NA	NA	NA	NA
WP_002902178.1|584562_585093_+	T6SS immunity phospholipase A1-binding lipoprotein Tli1-KP	NA	NA	NA	NA	NA
WP_002902180.1|585160_585691_+	T6SS immunity phospholipase A1-binding lipoprotein Tli1-KP	NA	NA	NA	NA	NA
WP_004151601.1|585678_588096_+	DUF2235 domain-containing protein	NA	NA	NA	NA	NA
WP_002902252.1|588140_588398_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_002902254.1|588394_589534_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151599.1|589517_592943_+	type VI secretion protein VasK	NA	NA	NA	NA	NA
WP_004151598.1|594614_596369_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_002902268.1|596332_597418_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
>prophage 5
NZ_CP009114	Klebsiella pneumoniae strain carbapenem-resistant blaNDM-1 chromosome, complete genome	5297511	791458	802345	5297511		Escherichia_phage(87.5%)	9	NA	NA
WP_002210516.1|791458_792079_-	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
WP_004151609.1|792071_793337_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.5	6.6e-233
WP_004151610.1|793348_794251_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.3	7.7e-159
WP_002210513.1|794511_795273_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_004176269.1|795293_796154_-	class A broad-spectrum beta-lactamase SHV-11	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
WP_002904006.1|796451_796712_+	hypothetical protein	NA	A0A077SK33	Escherichia_phage	97.7	3.5e-40
WP_001620097.1|796798_797887_+	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
WP_038430688.1|797917_799183_-	MFS transporter	NA	NA	NA	NA	NA
WP_004151613.1|799237_802345_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.6	0.0e+00
>prophage 6
NZ_CP009114	Klebsiella pneumoniae strain carbapenem-resistant blaNDM-1 chromosome, complete genome	5297511	1466563	1526696	5297511	tRNA,protease,plate,transposase	uncultured_Caudovirales_phage(20.0%)	52	NA	NA
WP_002910404.1|1466563_1467820_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_004145431.1|1468090_1468702_+	lipoprotein localization protein LolB	NA	NA	NA	NA	NA
WP_025987673.1|1468701_1469550_+	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_002910407.1|1469733_1470681_+	ribose-phosphate diphosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.5	2.3e-44
WP_019724970.1|1470805_1472485_+	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.8	1.8e-23
WP_019724969.1|1472485_1473532_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002910437.1|1473753_1474029_-	stress-induced protein YchH	NA	NA	NA	NA	NA
WP_004180389.1|1474301_1474886_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_002910443.1|1475003_1476095_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_004145442.1|1476175_1476505_-	DUF1869 domain-containing protein	NA	NA	NA	NA	NA
WP_002910453.1|1476588_1477503_-	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_019724968.1|1477634_1479050_-	type VI secretion system ImpA family N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_019724967.1|1479069_1479513_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_077255875.1|1479515_1480052_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_072157837.1|1480032_1481049_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_019724965.1|1481078_1482842_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_085955245.1|1485764_1486956_+|transposase	IS3-like element ISKpn18 family transposase	transposase	U5P429	Shigella_phage	43.5	3.5e-50
WP_025987650.1|1486897_1487698_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004899008.1|1488927_1489185_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_019724843.1|1489210_1489618_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047662646.1|1490127_1490901_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071814202.1|1491032_1493060_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A2H4JIA8	uncultured_Caudovirales_phage	31.5	5.9e-74
WP_019724840.1|1496147_1497845_-	OmpA family protein	NA	NA	NA	NA	NA
WP_004189358.1|1497848_1498502_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_019724839.1|1498498_1499839_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_002910650.1|1500407_1500737_+	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_002910652.1|1500851_1501391_+	DUF2058 domain-containing protein	NA	NA	NA	NA	NA
WP_019724838.1|1501416_1502115_-	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	27.2	2.6e-05
WP_002910657.1|1502305_1502788_+	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_004152315.1|1502897_1503797_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004145468.1|1503771_1504581_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_004175494.1|1504592_1505888_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	36.8	9.6e-62
WP_002910715.1|1506191_1507118_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002910717.1|1507216_1507693_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_025987691.1|1507742_1509386_-	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	50.4	5.7e-136
WP_002910720.1|1509669_1510563_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004175491.1|1510568_1511288_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.0	1.5e-11
WP_004148803.1|1511284_1512160_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	41.5	9.5e-05
WP_004148804.1|1512156_1513443_-	high-affinity branched-chain amino acid ABC transporter permease LivM	NA	NA	NA	NA	NA
WP_004175489.1|1513452_1514367_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_004189329.1|1514476_1515535_-	branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_032409494.1|1515824_1515971_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021312747.1|1516022_1518317_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.7	3.9e-159
WP_002910759.1|1518345_1519554_-	propionate kinase	NA	NA	NA	NA	NA
WP_004145486.1|1519581_1520913_-	threonine/serine transporter TdcC	NA	NA	NA	NA	NA
WP_002910762.1|1520938_1521928_-	bifunctional threonine ammonia-lyase/L-serine ammonia-lyase TdcB	NA	NA	NA	NA	NA
WP_002910764.1|1522021_1522963_-	transcriptional regulator TdcA	NA	NA	NA	NA	NA
WP_004219597.1|1523139_1523283_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019725612.1|1523580_1523703_+	nitrilotriacetate monooxygenase	NA	NA	NA	NA	NA
WP_004189318.1|1523740_1524541_-	PhnD/SsuA/transferrin family substrate-binding protein	NA	NA	NA	NA	NA
WP_004200323.1|1524533_1525514_-	fatty acid desaturase	NA	NA	NA	NA	NA
WP_015958643.1|1525952_1526696_-|protease	proteasome-type protease	protease	NA	NA	NA	NA
>prophage 7
NZ_CP009114	Klebsiella pneumoniae strain carbapenem-resistant blaNDM-1 chromosome, complete genome	5297511	1782271	1789176	5297511	tRNA	Bacillus_phage(33.33%)	6	NA	NA
WP_004149058.1|1782271_1783750_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	8.5e-30
WP_004175198.1|1783746_1784469_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
WP_004144192.1|1784787_1786149_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	94.8	1.8e-207
WP_073568699.1|1786391_1787288_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.9	4.7e-15
WP_004180550.1|1787528_1788302_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.7	3.9e-26
WP_032444346.1|1788312_1789176_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	5.7e-10
>prophage 8
NZ_CP009114	Klebsiella pneumoniae strain carbapenem-resistant blaNDM-1 chromosome, complete genome	5297511	4602333	4613987	5297511	integrase	Enterobacteria_phage(70.0%)	13	4590467:4590481	4613524:4613538
4590467:4590481	attL	AGCGCGGAGAGATTG	NA	NA	NA	NA
WP_002889890.1|4602333_4604667_-	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	82.2	0.0e+00
WP_002889897.1|4604678_4604999_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_002889911.1|4604995_4605223_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024940872.1|4605219_4605777_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	70.4	1.8e-33
WP_002889915.1|4605773_4606040_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	71.6	2.6e-30
WP_002889917.1|4606581_4607319_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	60.7	9.0e-73
WP_002889919.1|4607315_4607561_+	ogr/Delta-like zinc finger family protein	NA	Q7M294	Enterobacteria_phage	58.0	1.9e-19
WP_002889930.1|4607578_4608145_+	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	64.3	1.5e-59
WP_004152979.1|4608713_4609139_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152029.1|4609138_4610089_-	AAA family ATPase	NA	A0A1X9IGI7	Lactococcus_phage	27.1	1.2e-13
WP_002889938.1|4610076_4611267_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	62.7	6.4e-145
WP_002889940.1|4611619_4612873_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	44.9	8.9e-89
WP_004144574.1|4612883_4613987_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.5	4.8e-62
4613524:4613538	attR	AGCGCGGAGAGATTG	NA	NA	NA	NA
>prophage 9
NZ_CP009114	Klebsiella pneumoniae strain carbapenem-resistant blaNDM-1 chromosome, complete genome	5297511	5265422	5297368	5297511	plate,head,tail,terminase,integrase,portal,lysis,capsid	Salmonella_phage(81.08%)	40	5255018:5255032	5281770:5281784
5255018:5255032	attL	CCGCAGGCGGGGAAA	NA	NA	NA	NA
WP_001763838.1|5265422_5266403_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.5	4.8e-98
WP_000900883.1|5266663_5266855_-	hypothetical protein	NA	A0A0R6PIH8	Moraxella_phage	65.9	6.8e-09
WP_001346406.1|5266870_5267440_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	41.9	3.2e-38
WP_000188450.1|5267585_5267789_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000460893.1|5267853_5268363_+	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
WP_000956187.1|5268370_5268667_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	92.3	2.2e-22
WP_001747374.1|5268784_5269126_+	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	97.3	6.6e-55
WP_001244228.1|5269193_5269427_+	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	98.7	6.4e-33
WP_000752613.1|5269426_5269654_+	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
WP_000145290.1|5269650_5269953_+	DUF3850 domain-containing protein	NA	A0A0A8WI22	Clostridium_phage	42.1	9.8e-10
WP_038431105.1|5269949_5270807_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	96.5	1.2e-158
WP_038431106.1|5270803_5273218_+	replication endonuclease	NA	E5G6L9	Salmonella_phage	97.8	0.0e+00
WP_004178082.1|5273693_5275181_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_001154434.1|5275281_5275470_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
WP_016529212.1|5275480_5275714_+	DinI family protein	NA	A0A1S6L014	Salmonella_phage	89.6	1.1e-32
WP_016529211.1|5276000_5276219_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016529210.1|5276218_5277061_+	hypothetical protein	NA	A0A0M4R2T6	Salmonella_phage	48.5	1.3e-59
WP_038431152.1|5277262_5278915_+	NTPase	NA	X2KLG0	Campylobacter_phage	27.8	2.1e-13
WP_038431107.1|5278945_5279974_-|portal	phage portal protein	portal	E5G6M3	Salmonella_phage	86.7	4.9e-170
WP_031591583.1|5279973_5281740_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.1	0.0e+00
WP_002895967.1|5281882_5282716_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	88.8	6.3e-123
5281770:5281784	attR	TTTCCCCGCCTGCGG	NA	NA	NA	NA
WP_032427925.1|5282732_5283788_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.4	3.7e-181
WP_021563628.1|5283791_5284442_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	95.8	1.5e-111
WP_000673530.1|5284537_5285002_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	1.9e-76
WP_038431109.1|5285001_5285205_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	91.0	3.0e-31
WP_000171568.1|5285208_5285424_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
WP_038431112.1|5285404_5285920_+	lysozyme	NA	E5G6N1	Salmonella_phage	91.2	1.8e-88
WP_038431114.1|5285916_5286345_+|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	91.5	1.9e-59
WP_038431116.1|5286440_5286872_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	92.3	2.2e-71
WP_031591600.1|5286864_5287329_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	83.6	5.5e-60
WP_038431118.1|5287416_5288928_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038430657.1|5289054_5289633_+|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	84.9	3.0e-92
WP_000177580.1|5289629_5289989_+	GPW/gp25 family protein	NA	A0A1S6KZZ4	Salmonella_phage	87.4	3.2e-52
WP_021532224.1|5289975_5290884_+|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	90.7	1.2e-143
WP_001086820.1|5290876_5291482_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	92.5	5.2e-111
WP_001174919.1|5292886_5293327_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	66.7	1.5e-51
WP_077263506.1|5293899_5294442_-|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	55.4	2.1e-42
WP_001555853.1|5294472_5295039_+	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	84.8	2.2e-87
WP_001424180.1|5295181_5295520_+|tail	major tail sheath domain protein	tail	E5G6P7	Salmonella_phage	89.1	6.0e-48
WP_000763311.1|5297248_5297368_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
>prophage 1
NZ_CP009116	Klebsiella pneumoniae strain carbapenem-resistant blaNDM-1 plasmid p1, complete sequence	94760	765	62200	94760	integrase,transposase	Escherichia_phage(28.0%)	56	9056:9115	62205:62815
WP_000227969.1|765_1842_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_020324562.1|2554_3259_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	9.9e-138
WP_000842134.1|3748_4858_-	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	30.2	2.8e-33
WP_001039466.1|4952_6137_-	tetracycline efflux MFS transporter Tet(D)	NA	NA	NA	NA	NA
WP_000113282.1|6232_6889_+	tetracycline resistance transcriptional repressor TetR(D)	NA	NA	NA	NA	NA
WP_020324562.1|6900_7605_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	9.9e-138
WP_001011939.1|7748_8390_-	type A-2 chloramphenicol O-acetyltransferase CatII	NA	G3CFL0	Escherichia_phage	45.9	7.3e-55
WP_001239317.1|8539_9040_-	hypothetical protein	NA	NA	NA	NA	NA
9056:9115	attL	GGGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCT	NA	NA	NA	NA
WP_001143760.1|9699_12705_-|transposase	Tn3-like element Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	100.0	0.0e+00
WP_001235713.1|12868_13426_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
WP_000027057.1|13608_14469_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_000480972.1|15189_16026_-	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_001082320.1|16025_16829_-	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
WP_001043260.1|16889_17705_-	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
WP_000954592.1|18034_18211_+	DUF4102 domain-containing protein	NA	T1S9J3	Salmonella_phage	68.6	1.0e-06
WP_000427619.1|18392_19397_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_001138070.1|19475_22442_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	72.9	0.0e+00
WP_003124096.1|22444_23005_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	88.6	2.1e-50
WP_000993245.1|23135_23348_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_001087807.1|23413_23650_-	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_001277466.1|23646_24012_-	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_000209296.1|24029_25715_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	29.1	1.8e-39
WP_000522996.1|25753_26179_-	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000732275.1|26206_26482_-	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_004200999.1|26497_26863_-	mercuric ion transporter MerT	NA	NA	NA	NA	NA
WP_001166628.1|26934_27390_+	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_040120391.1|27649_28177_+	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	39.5	5.7e-21
WP_001776120.1|28209_28641_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001776122.1|29120_30086_-	DUF1738 domain-containing protein	NA	A0A1V0EEV1	Caulobacter_phage	42.7	1.6e-58
WP_004178082.1|30555_32043_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_000776034.1|32448_32880_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	53.3	1.6e-29
WP_004118291.1|32879_34151_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.3	4.9e-151
WP_040120392.1|34232_35207_-	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	54.7	6.9e-89
WP_000368714.1|35206_36412_-	AAA family ATPase	NA	A0A077SL49	Escherichia_phage	69.6	2.4e-163
WP_000339857.1|36826_37096_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040120393.1|37452_38319_-	replication initiation protein	NA	A0A222YYK1	Escherichia_phage	31.1	2.0e-23
WP_032409716.1|38853_38958_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000764642.1|39086_39344_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000015958.1|39401_40178_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	92.9	6.4e-53
WP_000129823.1|40174_40918_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000493378.1|40968_41319_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004201034.1|42126_42579_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023292072.1|43095_43716_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_023292073.1|43712_44777_+	hypothetical protein	NA	J9Q6F5	Salmonella_phage	39.7	5.5e-39
WP_023292074.1|45523_47224_+	AIPR family protein	NA	NA	NA	NA	NA
WP_087759376.1|47409_48529_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.2	6.0e-52
WP_015632534.1|49092_49455_-	DUF596 domain-containing protein	NA	NA	NA	NA	NA
WP_015632533.1|49826_51656_-	NACHT domain-containing protein	NA	NA	NA	NA	NA
WP_032433950.1|52574_53036_-	Mov34/MPN/PAD-1 family protein	NA	NA	NA	NA	NA
WP_015632531.1|53010_54780_-	ThiF family adenylyltransferase	NA	NA	NA	NA	NA
WP_015632530.1|54776_55841_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015632529.1|55827_56925_-	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_000807690.1|58390_59146_-	replication initiation protein RepE	NA	I3WF20	Macacine_betaherpesvirus	96.0	4.5e-136
WP_000861580.1|60157_60349_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001039463.1|60357_60744_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020324562.1|61495_62200_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	9.9e-138
62205:62815	attR	AGCTCCATCAGCAAAAGGGGATGATAAGTTTATCACCACCGACTATTTGCAACAGTGCCCAAAAAATTAACTACCTGAGGAAAATTGATCCTTTTGTGTTTGAAGAACTGTTGCTGGAAGGATTTGAAGCGCATGGCTTCAGAACCATCAGAAACAAACGCTATACCGGCGATGGAGGCATTGACGGCCAGGTAATAATAGGAAAATATCGCTATCTTATTCAGGCTAAACGCTATCGCGGCCATATTGCTTTACAGCACGTACAGGAGTTCGAGAAGTTGCTTAAACGTCATAACTGTCGCGGTCTGTTTTGCCATACCGGGAAAACCGGCGCAGGTTCAAAATCTGTCAGTATTGCCAGTGAACGGATGGAGATTATCAGCGGCCAGCGCCTGATAGATTTGCTCACGCCCGGCAGCTCCTTCACTATCGCAACCGCCCCGCAGACGATGATGAAGCGTACCGCAGCAACACTAGAAACGAGCACCATTGTTAAAGATGCCGGTAAAGAAAATCGATACCATGAGAGTTAATTAAATGAAGTCAGTAACTATAGAAGCAAAAACATTTGCTGAAATGTTAGGAATAACAGAAGGTGAGTTAATCTTTGC	NA	NA	NA	NA
>prophage 1
NZ_CP009115	Klebsiella pneumoniae strain carbapenem-resistant blaNDM-1 plasmid p2, complete sequence	118061	0	7068	118061		Erysipelothrix_phage(100.0%)	10	NA	NA
WP_004152339.1|248_581_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004171440.1|587_986_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152337.1|1011_1341_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152336.1|1368_1677_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001261282.1|2579_2810_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001044770.1|2806_3223_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_004152334.1|3296_4007_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_072093211.1|4738_4864_+	mercury transporter	NA	NA	NA	NA	NA
WP_001340589.1|4899_5322_+	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000105636.1|5373_7068_+	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	8.8e-39
>prophage 2
NZ_CP009115	Klebsiella pneumoniae strain carbapenem-resistant blaNDM-1 plasmid p2, complete sequence	118061	10295	11156	118061		Enterobacteria_phage(100.0%)	1	NA	NA
WP_000027057.1|10295_11156_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
>prophage 3
NZ_CP009115	Klebsiella pneumoniae strain carbapenem-resistant blaNDM-1 plasmid p2, complete sequence	118061	14385	17900	118061	transposase	Salmonella_phage(66.67%)	3	NA	NA
WP_001217881.1|14385_14943_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	98.4	2.0e-93
WP_000608644.1|15506_16769_+|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
WP_000239590.1|17024_17900_+	class A extended-spectrum beta-lactamase CTX-M-15	NA	A0A1B0VBP7	Salmonella_phage	82.4	1.1e-125
>prophage 4
NZ_CP009115	Klebsiella pneumoniae strain carbapenem-resistant blaNDM-1 plasmid p2, complete sequence	118061	25404	27854	118061		Clostridium_phage(50.0%)	3	NA	NA
WP_001493762.1|25404_25977_-	recombinase family protein	NA	M9Q1K0	Clostridium_phage	39.4	3.4e-19
WP_012477564.1|26113_26704_-	plasmid pRiA4b ORF-3 family protein	NA	NA	NA	NA	NA
WP_014386410.1|27074_27854_+	APH(3')-VI family aminoglycoside O-phosphotransferase	NA	E4ZFP6	Streptococcus_phage	34.7	6.9e-31
>prophage 5
NZ_CP009115	Klebsiella pneumoniae strain carbapenem-resistant blaNDM-1 plasmid p2, complete sequence	118061	33550	34255	118061	transposase	Escherichia_phage(100.0%)	1	NA	NA
WP_004217321.1|33550_34255_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
>prophage 6
NZ_CP009115	Klebsiella pneumoniae strain carbapenem-resistant blaNDM-1 plasmid p2, complete sequence	118061	38699	48554	118061		Wolbachia_phage(25.0%)	8	NA	NA
WP_014343478.1|38699_39179_-	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	31.7	2.7e-17
WP_040120367.1|39354_39663_-	hypothetical protein	NA	K7PKY8	Enterobacterial_phage	31.7	1.4e-08
WP_040120368.1|39659_40310_-	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
WP_004153014.1|40365_41010_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064750782.1|41059_41662_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152380.1|41822_42416_-	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_040120370.1|42487_43213_-	type-F conjugative transfer system pilin acetylase TraX	NA	A0A1D6ZIU7	Xanthomonas_phage	28.3	7.1e-06
WP_040120371.1|43292_48554_-	conjugative transfer relaxase/helicase TraI	NA	A0A1P8DII4	Virus_Rctr197k	33.3	4.0e-05
>prophage 7
NZ_CP009115	Klebsiella pneumoniae strain carbapenem-resistant blaNDM-1 plasmid p2, complete sequence	118061	77417	109880	118061	transposase	Escherichia_phage(16.67%)	43	NA	NA
WP_004152492.1|77417_78239_-	DUF945 domain-containing protein	NA	K4F5L3	Cronobacter_phage	40.1	1.2e-44
WP_032445769.1|79055_79889_-	N-6 DNA methylase	NA	A0A2K9V411	Faecalibacterium_phage	33.5	1.4e-21
WP_004152750.1|79939_80086_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032445771.1|80180_80528_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020802391.1|80594_80975_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040120381.1|81692_82106_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004152721.1|82106_82385_-	helix-turn-helix transcriptional regulator	NA	O64356	Escherichia_phage	39.4	2.5e-07
WP_004152720.1|82374_82695_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A088CBP5	Shigella_phage	39.5	6.8e-09
WP_014343499.1|82775_83000_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032445756.1|83010_83223_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019706019.1|83283_83640_-	hypothetical protein	NA	A0A248SL90	Klebsiella_phage	58.1	4.4e-25
WP_032445789.1|84480_84798_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032445787.1|84812_85163_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032445785.1|85159_85432_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014343509.1|86130_86289_-	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_085949440.1|86390_87760_-|transposase	IS3-like element ISKpn8 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	95.5	9.4e-108
WP_040120382.1|87963_88338_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001568059.1|88393_88720_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015065618.1|88716_89445_-	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_004194235.1|89441_89873_-	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_040120383.1|89917_91975_-	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	25.9	1.3e-23
WP_032445658.1|92044_92293_-	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_014343512.1|92341_92884_-	single-stranded DNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	76.7	4.6e-50
WP_004118473.1|93679_93997_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032445741.1|94031_94286_-	hypothetical protein	NA	H9C187	Pectobacterium_phage	47.5	4.4e-11
WP_001568047.1|94473_94665_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013214014.1|94707_95214_-	antirestriction protein ArdA	NA	G9FHQ1	Rhodococcus_virus	31.4	1.2e-07
WP_001568045.1|95256_95685_-	antirestriction protein	NA	NA	NA	NA	NA
WP_032445745.1|96317_97085_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001568043.1|97138_97558_-	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_001568042.1|97567_97789_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001568041.1|97788_98490_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.2	1.6e-26
WP_001568040.1|98926_99157_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152354.1|99217_99889_-	plasmid partitioning/stability family protein	NA	NA	NA	NA	NA
WP_004152353.1|99891_100863_-	mediator of plasmid stability	NA	A0A222YXF2	Escherichia_phage	46.8	1.1e-73
WP_004152352.1|101094_101526_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	52.5	1.0e-28
WP_004152351.1|101525_102797_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.7	3.6e-154
WP_004152350.1|103197_104094_+	replication initiation protein	NA	Q71TL8	Escherichia_phage	53.8	3.3e-69
WP_004152349.1|104415_105621_+	AAA family ATPase	NA	Q1MVJ3	Enterobacteria_phage	89.0	7.3e-205
WP_004152348.1|105617_106592_+	ParB/RepB/Spo0J family partition protein	NA	Q1MVJ4	Enterobacteria_phage	62.3	1.4e-105
WP_004152347.1|106968_107301_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004227314.1|107525_107741_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152345.1|107852_109880_+	SAM-dependent DNA methyltransferase	NA	A0A220A2U5	Liberibacter_phage	26.6	2.1e-26
>prophage 8
NZ_CP009115	Klebsiella pneumoniae strain carbapenem-resistant blaNDM-1 plasmid p2, complete sequence	118061	114455	115724	118061	transposase	Burkholderia_virus(100.0%)	1	NA	NA
WP_004152342.1|114455_115724_+|transposase	ISL3-like element ISKpn25 family transposase	transposase	Q6V7R1	Burkholderia_virus	34.7	5.2e-60
