The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP006704	Comamonas testosteroni TK102 chromosome, complete genome	6062703	1513313	1549772	6062703	portal,capsid,head,integrase,protease,terminase,tail	Pseudomonas_phage(18.18%)	40	1517770:1517816	1556378:1556424
WP_003057503.1|1513313_1514576_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	53.0	5.0e-124
WP_003057502.1|1514729_1517144_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.6	4.2e-220
1517770:1517816	attL	GGATTGCAAATCCGGTTAGACCAGTTCGACTCTGGTTCGCGCCTCCA	NA	NA	NA	NA
WP_043371241.1|1518009_1519218_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_043371242.1|1519214_1519598_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_043371243.1|1519600_1520125_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043371244.1|1520255_1520585_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051962125.1|1520584_1520881_-	hypothetical protein	NA	J7HXK7	Pseudomonas_phage	37.5	1.0e-06
WP_043371246.1|1521722_1523993_-	ParB/RepB/Spo0J family partition protein	NA	S5VSZ7	Leptospira_phage	29.8	1.5e-06
WP_043371247.1|1523989_1524421_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043371249.1|1524417_1524807_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051962127.1|1524803_1525562_-	3'-5' exoribonuclease	NA	H9C0Y4	Vibrio_phage	40.6	3.9e-23
WP_043371250.1|1525554_1525908_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158407666.1|1525907_1526057_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043371251.1|1526053_1526440_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144244897.1|1526567_1527002_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158407667.1|1527429_1528080_-	hypothetical protein	NA	K7PLZ5	Enterobacterial_phage	32.7	6.0e-20
WP_043371253.1|1528190_1528400_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_043371254.1|1528607_1529129_+	hypothetical protein	NA	B7SYH6	Stenotrophomonas_phage	43.5	5.6e-29
WP_043371255.1|1529125_1529416_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080731456.1|1529490_1531962_+	hypothetical protein	NA	A0A2D1GN57	Marinobacter_phage	32.3	1.0e-51
WP_144244898.1|1532358_1532661_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043371260.1|1532660_1533095_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080731630.1|1533605_1533818_+	HNH endonuclease	NA	A0A2K9VET6	Gordonia_phage	53.5	5.1e-05
WP_051962129.1|1533954_1534443_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051962130.1|1534481_1536149_+|terminase	terminase large subunit	terminase	C7BGG7	Burkholderia_phage	59.6	1.4e-190
WP_043371263.1|1536156_1537452_+|portal	phage portal protein	portal	G0ZT36	Aeromonas_phage	60.8	1.9e-142
WP_043371264.1|1537457_1538336_+|protease	Clp protease ClpP	protease	A0A0U4B0F3	Pseudomonas_phage	56.3	3.3e-82
WP_043371265.1|1538347_1539712_+|capsid	phage major capsid protein	capsid	A0A2H4PI18	Pseudomonas_phage	58.6	1.1e-119
WP_162473292.1|1539768_1540065_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043371267.1|1540064_1540424_+|head,tail	phage gp6-like head-tail connector protein	head,tail	Q6JIM5	Burkholderia_virus	43.4	3.9e-13
WP_144244900.1|1540493_1540694_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051962131.1|1540690_1541035_+|head	phage head closure protein	head	A0A1J0GUY4	Halomonas_phage	46.9	1.2e-16
WP_043371268.1|1541024_1541498_+	HK97 gp10 family phage protein	NA	A0A1V0E895	Vibrio_phage	56.1	8.4e-40
WP_043371269.1|1541494_1541863_+	DUF3168 domain-containing protein	NA	A0A2H4J359	uncultured_Caudovirales_phage	27.0	8.9e-05
WP_080731457.1|1541911_1542412_+	hypothetical protein	NA	A0A2H4J511	uncultured_Caudovirales_phage	31.0	1.7e-11
WP_043376182.1|1542408_1542867_+|tail	phage tail assembly chaperone family protein, TAC	tail	NA	NA	NA	NA
WP_043371270.1|1543131_1545753_+|tail	phage tail length tape measure family protein	tail	K7PGX8	Enterobacteria_phage	22.8	8.9e-14
WP_043371271.1|1545753_1546221_+	hypothetical protein	NA	A0A286S298	Klebsiella_phage	47.7	3.7e-40
WP_043371272.1|1546223_1546715_+	DUF1833 family protein	NA	A0A2H4J983	uncultured_Caudovirales_phage	40.6	3.1e-29
WP_043371273.1|1547087_1549772_+	hypothetical protein	NA	A0A0H5ART3	Pseudomonas_phage	40.8	1.6e-191
1556378:1556424	attR	GGATTGCAAATCCGGTTAGACCAGTTCGACTCTGGTTCGCGCCTCCA	NA	NA	NA	NA
>prophage 2
NZ_CP006704	Comamonas testosteroni TK102 chromosome, complete genome	6062703	1727892	1769267	6062703	integrase,transposase	Burkholderia_virus(25.0%)	31	1767506:1767520	1769806:1769820
WP_080731470.1|1727892_1728132_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	Q8W6R2	Burkholderia_virus	65.8	6.3e-20
WP_080731471.1|1729074_1729359_-|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	53.7	9.5e-15
WP_144244987.1|1730051_1730859_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_043371474.1|1730946_1731972_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_080731472.1|1733286_1734309_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_080731473.1|1734379_1734898_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080731474.1|1735158_1736388_+	polysaccharide biosynthesis/export family protein	NA	NA	NA	NA	NA
WP_043376228.1|1736399_1736834_+	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_043371476.1|1736890_1739134_+	polysaccharide biosynthesis tyrosine autokinase	NA	NA	NA	NA	NA
WP_034359171.1|1739198_1740494_+	nucleotide sugar dehydrogenase	NA	A7IWZ0	Paramecium_bursaria_Chlorella_virus	27.8	2.8e-21
WP_043371480.1|1740513_1741461_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_034359166.1|1741475_1742066_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_043371483.1|1742062_1743160_+	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	A0A2P1ELT3	Moumouvirus	31.2	3.6e-25
WP_043371486.1|1743167_1744577_+	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
WP_043371488.1|1744573_1745749_+	O-antigen ligase family protein	NA	NA	NA	NA	NA
WP_043371490.1|1745801_1746737_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043371494.1|1746992_1748237_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_043371497.1|1748233_1748824_+	sugar transferase	NA	NA	NA	NA	NA
WP_043371500.1|1748930_1749593_+	acetyltransferase	NA	NA	NA	NA	NA
WP_043371502.1|1749638_1750841_+	DegT/DnrJ/EryC1/StrS aminotransferase family protein	NA	A0A2K9L470	Tupanvirus	46.2	4.8e-100
WP_051962144.1|1751140_1753153_+	polysaccharide biosynthesis protein	NA	K7Y9E1	Megavirus	25.1	7.3e-16
WP_080731476.1|1753298_1754120_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_080731477.1|1754238_1754775_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_144244905.1|1755080_1755395_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080731478.1|1757018_1757318_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_043371504.1|1759808_1761539_-	UvrD-helicase domain-containing protein	NA	A0A1V0SIN4	Klosneuvirus	37.6	1.8e-07
WP_043371506.1|1761535_1763374_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_043371508.1|1763692_1764061_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144244906.1|1764060_1765557_-	hypothetical protein	NA	A0A2H4J185	uncultured_Caudovirales_phage	24.2	1.6e-20
WP_144244907.1|1766026_1767298_-	hypothetical protein	NA	NA	NA	NA	NA
1767506:1767520	attL	TGTTCGTGGTCTGGA	NA	NA	NA	NA
WP_043371513.1|1767815_1769267_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_043371513.1|1767815_1769267_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
1769806:1769820	attR	TCCAGACCACGAACA	NA	NA	NA	NA
>prophage 3
NZ_CP006704	Comamonas testosteroni TK102 chromosome, complete genome	6062703	5038030	5080119	6062703	portal,capsid,head,tRNA,lysis,terminase,tail,plate	Burkholderia_phage(33.33%)	42	NA	NA
WP_003051777.1|5038030_5038525_+|tRNA	tRNA (uridine(34)/cytosine(34)/5- carboxymethylaminomethyluridine(34)-2'-O)- methyltransferase TrmL	tRNA	NA	NA	NA	NA
WP_003051774.1|5038677_5038986_+	DUF4148 domain-containing protein	NA	NA	NA	NA	NA
WP_034366233.1|5039089_5039554_-	MaoC family dehydratase	NA	NA	NA	NA	NA
WP_003051771.1|5039686_5040319_-	LysE family transporter	NA	NA	NA	NA	NA
WP_003051768.1|5040523_5042416_+	glutathione-regulated potassium-efflux system protein KefC	NA	NA	NA	NA	NA
WP_029158808.1|5042432_5042885_+	DUF1841 family protein	NA	NA	NA	NA	NA
WP_003051762.1|5042944_5043607_-	cytochrome c4	NA	NA	NA	NA	NA
WP_003051760.1|5043723_5044566_+	MoxR family ATPase	NA	NA	NA	NA	NA
WP_043374956.1|5044597_5044819_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003051756.1|5044830_5045433_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003051754.1|5045451_5046639_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_029158809.1|5046760_5048551_+	BamA/TamA family outer membrane protein	NA	NA	NA	NA	NA
WP_043374958.1|5048553_5052789_+	translocation/assembly module TamB domain-containing protein	NA	NA	NA	NA	NA
WP_043374964.1|5052846_5053122_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003051743.1|5053160_5053436_-	metal/formaldehyde-sensitive transcriptional repressor	NA	NA	NA	NA	NA
WP_043374966.1|5053507_5054467_+	CDF family Co(II)/Ni(II) efflux transporter DmeF	NA	NA	NA	NA	NA
WP_144244966.1|5054855_5055068_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043374968.1|5055378_5056389_-|portal	phage portal protein	portal	A4PE27	Ralstonia_virus	58.3	3.2e-113
WP_043374971.1|5058453_5059278_+|capsid	GPO family capsid scaffolding protein	capsid	A0A077K9W8	Ralstonia_phage	47.5	6.5e-56
WP_043374974.1|5059316_5060354_+|capsid	phage major capsid protein, P2 family	capsid	E5FFI6	Burkholderia_phage	57.7	6.9e-111
WP_043374976.1|5060428_5061283_+|terminase	small terminase subunit	terminase	A4JWP8	Burkholderia_virus	41.2	7.0e-37
WP_051962322.1|5061399_5061891_+|head	head completion/stabilization protein	head	E5E3W6	Burkholderia_phage	42.0	2.8e-22
WP_043374980.1|5061893_5062106_+|tail	tail protein X	tail	A0A077K8R0	Ralstonia_phage	53.0	2.1e-11
WP_003051710.1|5062135_5062600_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043374984.1|5062596_5063172_+	hypothetical protein	NA	A0A0D4DCJ5	Acinetobacter_phage	51.1	9.2e-41
WP_043374987.1|5063168_5063657_+|lysis	lysis protein	lysis	NA	NA	NA	NA
WP_043374989.1|5063653_5064154_+|tail	phage tail protein	tail	A0A2H4J906	uncultured_Caudovirales_phage	46.3	6.8e-24
WP_043374992.1|5064153_5064615_+	phage virion morphogenesis protein	NA	A0A2H4J927	uncultured_Caudovirales_phage	44.4	5.7e-25
WP_043374995.1|5064694_5065615_+	DUF2971 domain-containing protein	NA	NA	NA	NA	NA
WP_043374999.1|5065768_5066440_+|plate	phage baseplate assembly protein V	plate	A0A2H4JFJ8	uncultured_Caudovirales_phage	42.4	1.7e-33
WP_080731591.1|5066436_5066787_+	GPW/gp25 family protein	NA	A0A077K8R5	Ralstonia_phage	49.0	1.5e-17
WP_043375003.1|5066783_5067701_+|plate	baseplate J/gp47 family protein	plate	R4JDM0	Burkholderia_phage	52.8	4.8e-76
WP_019044220.1|5067693_5068242_+|tail	phage tail protein I	tail	V9IQK7	Stenotrophomonas_phage	52.3	3.6e-50
WP_051962250.1|5068268_5071520_+|tail	tail fiber protein	tail	A0A077K818	Ralstonia_phage	42.8	1.4e-48
WP_043376884.1|5072130_5072397_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043375006.1|5072439_5073648_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	E5FFG9	Burkholderia_phage	59.0	2.8e-124
WP_019044051.1|5073674_5074184_+|tail	phage major tail tube protein	tail	V9IQX1	Stenotrophomonas_phage	54.8	3.2e-45
WP_043375009.1|5074226_5074568_+|tail	phage tail assembly protein	tail	R4JJY8	Burkholderia_phage	57.6	3.7e-21
WP_003051665.1|5074576_5074696_+|tail	GpE family phage tail protein	tail	E5E3U7	Burkholderia_phage	62.2	5.2e-07
WP_043375012.1|5074919_5078492_+|tail	phage tail tape measure protein	tail	E5FFG5	Burkholderia_phage	33.6	6.0e-122
WP_043376886.1|5078507_5078957_+|tail	phage tail protein	tail	A0A2H4JG54	uncultured_Caudovirales_phage	52.9	2.5e-33
WP_051962251.1|5078967_5080119_+	late control protein	NA	A0A2H4JAV0	uncultured_Caudovirales_phage	41.3	2.0e-71
>prophage 4
NZ_CP006704	Comamonas testosteroni TK102 chromosome, complete genome	6062703	5354293	5360329	6062703		Escherichia_phage(50.0%)	7	NA	NA
WP_043375288.1|5354293_5354845_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	55.6	4.0e-49
WP_043375291.1|5354841_5355726_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	A0A291LA53	Escherichia_phage	61.0	5.7e-98
WP_043375293.1|5355788_5356694_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	31.9	2.6e-21
WP_043375296.1|5356690_5357761_-	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	47.6	4.6e-86
WP_034400350.1|5357809_5358583_-	type III pantothenate kinase	NA	NA	NA	NA	NA
WP_043006841.1|5358753_5359224_+	peptidoglycan-binding protein LysM	NA	A0A1V0DZX0	Clostridioides_phage	37.5	8.7e-05
WP_043375299.1|5359306_5360329_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	46.8	7.0e-84
