The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP011052	Halomonas sp. KO116 chromosome, complete genome	4649248	391025	460285	4649248	transposase	Escherichia_phage(25.0%)	51	NA	NA
WP_144408548.1|391025_392039_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_035562932.1|394719_395010_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035562935.1|395054_396113_-	maleylacetate reductase	NA	NA	NA	NA	NA
WP_035562938.1|396149_396452_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035562941.1|396627_398484_-	phenol 2-monooxygenase	NA	NA	NA	NA	NA
WP_035562943.1|398592_399573_-	catechol 1,2-dioxygenase	NA	NA	NA	NA	NA
WP_035562946.1|399759_399999_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158414199.1|400126_400285_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035562949.1|400353_402069_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_035562953.1|402476_404183_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_082072531.1|404546_404966_+	cytochrome c	NA	NA	NA	NA	NA
WP_035562958.1|404970_405507_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035562962.1|405538_407089_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_052703700.1|407209_408214_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_035562965.1|408265_409732_+	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_035562968.1|409824_410733_+	transporter	NA	NA	NA	NA	NA
WP_035562971.1|410783_411872_+	NAD(P)-dependent alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	25.5	8.7e-24
WP_035562974.1|412907_414107_+	M24 family metallopeptidase	NA	NA	NA	NA	NA
WP_035565116.1|414712_416224_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.3	5.4e-48
WP_082072532.1|416882_417320_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	54.3	9.8e-35
WP_045812044.1|417319_417637_-|transposase	transposase	transposase	A0A0N7BVE9	Escherichia_phage	58.7	3.9e-25
WP_045812209.1|417684_418062_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_035565389.1|418262_419279_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	36.4	1.2e-43
WP_035556504.1|420019_421333_+	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	51.2	3.9e-95
WP_035556506.1|421359_422610_+	sarcosine oxidase subunit beta family protein	NA	NA	NA	NA	NA
WP_035556509.1|422622_422982_+	sarcosine oxidase subunit delta	NA	NA	NA	NA	NA
WP_082072533.1|422978_426029_+	sarcosine oxidase subunit alpha family protein	NA	NA	NA	NA	NA
WP_035556511.1|426021_426672_+	sarcosine oxidase subunit gamma family protein	NA	NA	NA	NA	NA
WP_035556514.1|426779_427124_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_035556517.1|427235_428102_+	formyltetrahydrofolate deformylase	NA	NA	NA	NA	NA
WP_035556519.1|428119_429499_+	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_045812045.1|429618_430611_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	33.3	7.9e-40
WP_052703701.1|432515_433418_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_035556524.1|433585_434617_+	C4-dicarboxylate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_045812047.1|434667_435180_+	TRAP transporter small permease	NA	NA	NA	NA	NA
WP_035556527.1|435176_436463_+	TRAP transporter large permease	NA	NA	NA	NA	NA
WP_035556534.1|438271_440365_+	hydantoinase/oxoprolinase family protein	NA	NA	NA	NA	NA
WP_035556536.1|440384_442145_+	hydantoinase B/oxoprolinase family protein	NA	NA	NA	NA	NA
WP_045812048.1|442239_443757_+	nitrate reductase	NA	NA	NA	NA	NA
WP_035556539.1|443930_444626_+	isochorismatase family protein	NA	NA	NA	NA	NA
WP_035556634.1|444769_445813_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_035556541.1|446096_447416_+	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	51.4	2.3e-95
WP_035556543.1|447442_448693_+	sarcosine oxidase subunit beta family protein	NA	NA	NA	NA	NA
WP_035556546.1|448707_449100_+	sarcosine oxidase subunit delta	NA	NA	NA	NA	NA
WP_035556549.1|449096_452147_+	sarcosine oxidase subunit alpha family protein	NA	NA	NA	NA	NA
WP_035556551.1|452139_452790_+	sarcosine oxidase subunit gamma family protein	NA	NA	NA	NA	NA
WP_035556553.1|452836_453703_+	formyltetrahydrofolate deformylase	NA	NA	NA	NA	NA
WP_035556555.1|453739_455119_+	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_144408549.1|455437_455890_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035556558.1|457881_458550_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035556560.1|458848_460285_-|transposase	IS1182 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP011052	Halomonas sp. KO116 chromosome, complete genome	4649248	2620341	2678097	4649248	tRNA,holin,transposase	Escherichia_phage(33.33%)	47	NA	NA
WP_144408586.1|2620341_2621557_+|transposase	IS3 family transposase	transposase	A0A0N7C035	Escherichia_phage	58.3	6.8e-94
WP_008956633.1|2621636_2621963_+	TraR/DksA family transcriptional regulator	NA	NA	NA	NA	NA
WP_035563690.1|2622024_2623872_+	ATP-dependent metallopeptidase FtsH/Yme1/Tma family protein	NA	A0A0P0CCN8	Ostreococcus_mediterraneus_virus	43.3	1.3e-104
WP_035563687.1|2623878_2624994_-	ABC-2 transporter permease	NA	NA	NA	NA	NA
WP_035563685.1|2624995_2627719_-	ribosome-associated ATPase/putative transporter RbbA	NA	A0A2H4PQG7	Staphylococcus_phage	30.7	1.4e-22
WP_144408631.1|2627715_2628759_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_035563681.1|2629183_2630131_-	pirin family protein	NA	NA	NA	NA	NA
WP_158414213.1|2630558_2630735_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035563678.1|2631992_2632625_-	pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
WP_045812126.1|2632825_2633452_-	isochorismatase family protein	NA	NA	NA	NA	NA
WP_022523388.1|2635132_2635414_+	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_035563672.1|2635427_2635997_+	cytochrome b561	NA	NA	NA	NA	NA
WP_022523387.1|2636104_2636794_-	VIT family protein	NA	NA	NA	NA	NA
WP_022523386.1|2636981_2638394_-	two-component sensor histidine kinase	NA	NA	NA	NA	NA
WP_022523385.1|2638390_2639053_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_022523384.1|2639346_2640540_+	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_045812128.1|2640677_2640992_+	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_022523382.1|2640973_2641660_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_045812129.1|2641684_2643352_+	phosphoethanolamine--lipid A transferase	NA	NA	NA	NA	NA
WP_035563666.1|2643427_2643796_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144408632.1|2644427_2645363_-|holin	choline ABC transporter substrate-binding protein	holin	NA	NA	NA	NA
WP_035563660.1|2645583_2646189_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_035563658.1|2646213_2647683_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_035563655.1|2647853_2649527_+|holin	choline dehydrogenase	holin	A0A1V0S9J5	Catovirus	26.1	1.6e-40
WP_035563652.1|2649757_2652244_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_035563647.1|2652481_2653579_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.3	2.6e-07
WP_035563644.1|2653571_2654672_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.8	8.8e-16
WP_035563641.1|2654664_2655552_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_035563637.1|2655553_2656450_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_035563634.1|2656462_2656735_+	DUF2160 domain-containing protein	NA	NA	NA	NA	NA
WP_035563631.1|2656853_2658620_+	carbohydrate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_035563628.1|2658777_2660421_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_008956668.1|2660494_2660719_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035563625.1|2661217_2662705_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_035563623.1|2662827_2663586_-	DeoR/GlpR family transcriptional regulator	NA	NA	NA	NA	NA
WP_035563620.1|2663712_2665662_-	SLC13 family permease	NA	NA	NA	NA	NA
WP_035563617.1|2665923_2666901_-	NADPH:quinone reductase	NA	NA	NA	NA	NA
WP_035563614.1|2667099_2667855_+	glycerophosphoryl diester phosphodiesterase	NA	A0A2H4PGQ5	Escherichia_phage	33.9	3.3e-14
WP_035563611.1|2667902_2668766_+	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	29.9	6.9e-24
WP_035563608.1|2668873_2670289_+	amidase	NA	NA	NA	NA	NA
WP_035563605.1|2670359_2670794_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035563602.1|2671089_2672808_+|tRNA	proline--tRNA ligase	tRNA	A0A2K9L3R9	Tupanvirus	29.1	1.9e-09
WP_035563599.1|2672863_2673445_+	lytic transglycosylase domain-containing protein	NA	I6ZXX9	Escherichia_phage	39.3	5.9e-11
WP_144408586.1|2674026_2675243_-|transposase	IS3 family transposase	transposase	A0A0N7C035	Escherichia_phage	58.3	6.8e-94
WP_052703763.1|2675814_2676453_+|transposase	transposase	transposase	Q9JMN8	Wolbachia_phage	40.8	3.4e-36
WP_035565936.1|2676684_2677365_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158414214.1|2677668_2678097_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP011052	Halomonas sp. KO116 chromosome, complete genome	4649248	3976864	3987614	4649248	tRNA,integrase	uncultured_Mediterranean_phage(50.0%)	10	3970409:3970465	3981756:3981812
3970409:3970465	attL	TTTGGTGCCGGTAGCCAGACTCGAACTGGCACACCCGTAAAGGCGGCGGATTTTGAA	NA	NA	NA	NA
WP_035564558.1|3976864_3977926_+	assembly protein	NA	A7BJY0	Enterobacteria_phage	53.8	2.4e-103
WP_052703801.1|3977906_3978299_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052703802.1|3978241_3979333_+	hypothetical protein	NA	G4WZN6	Enterobacteria_phage	48.0	2.8e-70
WP_035564563.1|3979402_3980695_+	hypothetical protein	NA	Q56VN8	Pseudomonas_phage	37.4	1.7e-74
WP_035564565.1|3980694_3981684_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	45.6	2.1e-77
WP_035564567.1|3981958_3982990_+|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
3981756:3981812	attR	TTTGGTGCCGGTAGCCAGACTCGAACTGGCACACCCGTAAAGGCGGCGGATTTTGAA	NA	NA	NA	NA
WP_082072691.1|3983083_3984202_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	45.7	1.4e-88
WP_035564570.1|3984340_3984667_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	41.8	6.6e-12
WP_035564829.1|3984799_3986653_+	protein translocase subunit SecD	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	23.5	5.1e-08
WP_035564572.1|3986687_3987614_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	36.8	4.1e-38
>prophage 1
NZ_CP011053	Halomonas sp. KO116 plasmid unnamed1, complete sequence	313995	28164	35854	313995	transposase	Escherichia_phage(40.0%)	10	NA	NA
WP_035557673.1|28164_28566_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_157738121.1|28466_28748_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_035557670.1|28784_29735_+|transposase	IS481 family transposase	transposase	Q60FS6	Murine_leukemia_virus	33.1	1.4e-06
WP_082072702.1|29746_30115_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045812302.1|30428_31445_+	endonuclease	NA	NA	NA	NA	NA
WP_045812303.1|31544_32537_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	33.6	9.3e-41
WP_052703829.1|32780_33092_+	HNH endonuclease	NA	A0A2H4JGM1	uncultured_Caudovirales_phage	47.1	1.4e-06
WP_035557668.1|33096_33702_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045812044.1|35099_35417_+|transposase	transposase	transposase	A0A0N7BVE9	Escherichia_phage	58.7	3.9e-25
WP_082072532.1|35416_35854_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	54.3	9.8e-35
>prophage 2
NZ_CP011053	Halomonas sp. KO116 plasmid unnamed1, complete sequence	313995	150645	215381	313995	transposase	Staphylococcus_prophage(50.0%)	55	NA	NA
WP_113271319.1|150645_151488_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	32.3	7.7e-28
WP_082072722.1|153251_154289_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035565177.1|156450_156963_-	signal peptidase II	NA	NA	NA	NA	NA
WP_045812311.1|156966_157866_-	cation transporter	NA	NA	NA	NA	NA
WP_035566955.1|157961_158369_+	Cd(II)/Pb(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_035566952.1|158542_159628_-	ATPase	NA	NA	NA	NA	NA
WP_035566949.1|159909_160638_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081193111.1|161143_161428_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045812073.1|161815_163177_-|transposase	IS1380 family transposase	transposase	NA	NA	NA	NA
WP_035565177.1|164931_165444_-	signal peptidase II	NA	NA	NA	NA	NA
WP_045812313.1|165447_166344_-	cation transporter	NA	NA	NA	NA	NA
WP_004364961.1|166439_166847_+	Cd(II)/Pb(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_035562985.1|167352_167823_-	cytochrome c	NA	NA	NA	NA	NA
WP_035562988.1|167815_168682_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035562990.1|168705_169449_-	cytochrome C biogenesis protein CcdA	NA	NA	NA	NA	NA
WP_035562993.1|169465_169849_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045812314.1|169861_170410_-	TlpA family protein disulfide reductase	NA	NA	NA	NA	NA
WP_035562995.1|170424_170865_-	metal-binding protein	NA	NA	NA	NA	NA
WP_035562998.1|170965_171202_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035563000.1|171448_171874_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_035563003.1|171870_172605_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_022522186.1|172605_173148_-	thiol:disulfide interchange protein	NA	NA	NA	NA	NA
WP_035563007.1|173144_173957_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_035563010.1|174025_174553_-	DsbE family thiol:disulfide interchange protein	NA	NA	NA	NA	NA
WP_035563012.1|174643_175321_-	TVP38/TMEM64 family protein	NA	NA	NA	NA	NA
WP_052703842.1|175382_176213_-	thiol:disulfide interchange protein DsbG	NA	NA	NA	NA	NA
WP_035563015.1|176440_178915_-	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	32.8	6.3e-86
WP_035563017.1|178995_179403_-	heavy metal-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_035563020.1|179489_180119_-	peroxiredoxin	NA	NA	NA	NA	NA
WP_035563023.1|180366_181089_+	cytochrome C biogenesis protein CcdA	NA	NA	NA	NA	NA
WP_035565389.1|181398_182415_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	36.4	1.2e-43
WP_144408649.1|182486_182840_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035564332.1|182939_184193_+	TolC family protein	NA	NA	NA	NA	NA
WP_035564331.1|184189_185647_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_045812315.1|185643_188799_+	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	20.4	5.4e-50
WP_035564328.1|188795_189152_+	copper-binding protein	NA	NA	NA	NA	NA
WP_127063333.1|189463_189733_+	hypothetical protein	NA	NA	NA	NA	NA
WP_127063332.1|189740_189998_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144408650.1|191549_191966_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052703843.1|192132_193299_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035565121.1|195706_196036_+	four-helix bundle copper-binding protein	NA	NA	NA	NA	NA
WP_052703843.1|196631_197798_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045812317.1|197964_198381_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035565798.1|198474_199494_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.1	2.4e-44
WP_035561671.1|199612_200383_-	copper resistance protein B	NA	NA	NA	NA	NA
WP_035561674.1|200392_202255_-	copper resistance system multicopper oxidase	NA	NA	NA	NA	NA
WP_035561740.1|202323_203646_-	histidine kinase	NA	NA	NA	NA	NA
WP_035561676.1|203771_205073_-|transposase	IS1380 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	26.1	1.2e-32
WP_035561679.1|205315_205672_+	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_035561683.1|205876_207097_+	TolC family protein	NA	NA	NA	NA	NA
WP_035561686.1|207118_208384_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_035561689.1|208398_211596_+	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	22.0	4.6e-65
WP_035561693.1|211648_212971_-	two-component sensor	NA	NA	NA	NA	NA
WP_035561696.1|213000_213672_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_035561699.1|214055_215381_+|transposase	IS1182 family transposase	transposase	Q9MBP7	Staphylococcus_prophage	24.6	6.9e-15
