The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP008823	UNVERIFIED_ORG: Enterobacter cloacae ECNIH2, complete genome	4852980	451251	495265	4852980	terminase,integrase,protease,tRNA,portal,tail	Enterobacteria_phage(29.55%)	53	442838:442853	500708:500723
442838:442853	attL	ATGTAGGCCGGGTAAG	NA	NA	NA	NA
WP_044488948.1|451251_451794_+	SocA family protein	NA	A0A139ZPG5	Marinitoga_camini_virus	29.5	3.7e-07
WP_032620638.1|451799_452261_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044488949.1|452295_452568_-	pyocin activator protein PrtN	NA	S5MQM5	Escherichia_phage	88.6	2.0e-38
WP_032620634.1|452606_453176_-	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	74.6	7.6e-80
WP_032620633.1|453175_453373_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032620632.1|453369_454101_-	site-specific DNA-methyltransferase	NA	A0A0H5BBV5	Pseudomonas_phage	65.2	1.0e-84
WP_032620631.1|454097_454424_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032620630.1|454420_454621_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032620628.1|454605_455148_-	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	75.7	3.5e-74
WP_032620626.1|455283_456114_-	YfdQ family protein	NA	Q8HAA2	Salmonella_phage	90.1	4.0e-138
WP_032620624.1|456169_456541_-	hypothetical protein	NA	Q8HAA1	Salmonella_phage	89.4	3.8e-56
WP_032665243.1|457053_457308_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032620621.1|457279_457480_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032620617.1|457662_458289_-	LexA family transcriptional regulator	NA	K7PM82	Enterobacteria_phage	48.3	1.2e-46
WP_032620614.1|458389_458605_+	cell division protein	NA	NA	NA	NA	NA
WP_032620612.1|458627_459185_+	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	65.8	2.6e-64
WP_032620783.1|459414_460059_+	antirepressor	NA	A0A2I7RHG4	Vibrio_phage	53.2	2.7e-49
WP_032620611.1|460060_460240_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	49.0	3.0e-06
WP_032620610.1|460236_461091_+	GntR family transcriptional regulator	NA	A0A1C9IHW0	Salmonella_phage	74.7	1.2e-57
WP_032620608.1|461087_462422_+	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	50.6	7.7e-115
WP_032620607.1|462414_464346_+	DNA methyltransferase	NA	H9C171	Pectobacterium_phage	53.2	5.6e-199
WP_032620605.1|464342_465410_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	53.4	1.4e-106
WP_032620604.1|465426_466032_+	hypothetical protein	NA	H9C175	Pectobacterium_phage	62.9	7.6e-70
WP_014832171.1|466994_467297_+	hypothetical protein	NA	O64361	Escherichia_phage	67.3	3.1e-32
WP_032620601.1|467296_467833_+	lysozyme	NA	K7PM52	Enterobacteria_phage	89.0	7.7e-90
WP_032620598.1|467829_468351_+	hypothetical protein	NA	K7PHH7	Enterobacteria_phage	83.5	3.7e-73
WP_032620596.1|468380_468605_+	hypothetical protein	NA	A0A2H4J182	uncultured_Caudovirales_phage	58.1	1.1e-18
WP_080288384.1|468961_469639_+	DUF1983 domain-containing protein	NA	G8C7Q4	Escherichia_phage	54.9	2.3e-35
WP_020884621.1|469823_470312_+	DUF1441 family protein	NA	K7PJY2	Enterobacterial_phage	98.1	6.5e-80
WP_032620593.1|470311_472414_+|terminase	phage terminase large subunit family protein	terminase	K7PH52	Enterobacterial_phage	99.3	0.0e+00
WP_032620591.1|472410_472626_+	hypothetical protein	NA	K7PMB5	Enterobacterial_phage	97.2	9.4e-31
WP_032620589.1|472622_474122_+|portal	phage portal protein	portal	K7PHM5	Enterobacterial_phage	99.4	2.5e-287
WP_032620779.1|474135_476073_+|protease	Clp protease ClpP	protease	K7PKX4	Enterobacterial_phage	98.8	0.0e+00
WP_032620588.1|476155_476482_+	DUF2190 family protein	NA	K7PJY3	Enterobacterial_phage	96.3	2.5e-51
WP_032620586.1|476474_476750_+	DNA breaking-rejoining protein	NA	K7PH55	Enterobacterial_phage	97.5	1.2e-38
WP_020884618.1|476759_477338_+|tail	phage tail protein	tail	K7PMB7	Enterobacterial_phage	99.0	4.5e-96
WP_001704117.1|477334_477736_+|tail	tail protein	tail	K7PHM6	Enterobacterial_phage	100.0	4.1e-72
WP_032620582.1|477745_478489_+|tail	phage tail protein	tail	K7PKX6	Enterobacterial_phage	98.4	3.9e-132
WP_032620580.1|478499_478940_+|tail	phage minor tail protein G	tail	K7PJY4	Enterobacterial_phage	93.8	3.8e-71
WP_071842901.1|478948_479263_+|tail	phage tail assembly protein T	tail	E4WL32	Enterobacteria_phage	95.2	9.8e-53
WP_032620577.1|479246_482507_+|tail	phage tail tape measure protein	tail	K7PMB9	Enterobacterial_phage	97.7	0.0e+00
WP_032620574.1|482503_482842_+|tail	tail protein	tail	E4WL34	Enterobacteria_phage	99.1	5.2e-60
WP_032620573.1|482897_483635_+|tail	phage minor tail protein L	tail	M9NYX1	Enterobacteria_phage	99.6	6.1e-146
WP_032620572.1|483637_484357_+	C40 family peptidase	NA	M9NZD8	Enterobacteria_phage	97.9	9.8e-141
WP_032620570.1|484349_484967_+|tail	tail assembly protein	tail	M9NZA3	Enterobacteria_phage	99.0	2.6e-105
WP_128754879.1|485052_485532_+	hypothetical protein	NA	M9NZH8	Enterobacteria_phage	98.0	7.9e-78
WP_080288370.1|485548_489526_+|tail	phage tail protein	tail	M9P0D8	Enterobacteria_phage	89.5	0.0e+00
WP_103848176.1|490241_490823_+|tail	tail fiber domain-containing protein	tail	A0A2I6PD03	Escherichia_phage	53.3	4.3e-46
WP_032620566.1|491671_492223_+	recombinase family protein	NA	K7PJT4	Enterobacteria_phage	67.0	2.7e-66
WP_128754880.1|492330_492597_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032620563.1|492580_492826_-	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	63.8	2.2e-20
WP_032620560.1|493045_494140_-|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	83.7	1.4e-178
WP_032620558.1|494227_495265_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
500708:500723	attR	ATGTAGGCCGGGTAAG	NA	NA	NA	NA
>prophage 2
NZ_CP008823	UNVERIFIED_ORG: Enterobacter cloacae ECNIH2, complete genome	4852980	729403	736908	4852980	integrase	Enterobacteria_phage(85.71%)	11	725550:725562	731554:731566
725550:725562	attL	AATAGTGTCCAGT	NA	NA	NA	NA
WP_032620849.1|729403_730666_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	40.4	8.2e-74
WP_080288371.1|730701_731763_-	DUF4435 domain-containing protein	NA	NA	NA	NA	NA
731554:731566	attR	ACTGGACACTATT	NA	NA	NA	NA
WP_032620851.1|731759_732899_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_017692853.1|733237_733801_-	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	65.9	6.0e-61
WP_023323621.1|733829_734048_-	phage transcriptional activator	NA	Q7M294	Enterobacteria_phage	68.2	1.0e-16
WP_032620852.1|734050_734794_-	hypothetical protein	NA	NA	NA	NA	NA
WP_125183029.1|734778_735012_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026094409.1|735356_735623_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	62.5	4.4e-22
WP_032620854.1|735619_736174_+	ash family protein	NA	Q7M2A7	Enterobacteria_phage	72.1	1.5e-35
WP_032620855.1|736166_736466_+	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	70.1	1.2e-31
WP_032620857.1|736458_736908_+	hypothetical protein	NA	Q7M298	Enterobacteria_phage	70.8	9.7e-46
>prophage 3
NZ_CP008823	UNVERIFIED_ORG: Enterobacter cloacae ECNIH2, complete genome	4852980	2391601	2417287	4852980	protease,transposase	Bacillus_phage(25.0%)	22	NA	NA
WP_032103015.1|2391601_2392246_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_032619662.1|2393512_2395720_+	peptidase domain-containing ABC transporter	NA	F2Y165	Organic_Lake_phycodnavirus	29.8	1.2e-14
WP_032619660.1|2396093_2397089_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_032619659.1|2397133_2397874_+	response regulator	NA	W8CYM9	Bacillus_phage	35.9	5.0e-31
WP_032619657.1|2397870_2399166_+	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	23.9	8.8e-15
WP_017382351.1|2399301_2400492_+	redoxin domain-containing protein	NA	NA	NA	NA	NA
WP_023296628.1|2400498_2401257_-	trans-aconitate 2-methyltransferase	NA	NA	NA	NA	NA
WP_017382349.1|2401341_2401926_-	GDP-mannose pyrophosphatase nudK	NA	NA	NA	NA	NA
WP_015570520.1|2402012_2402771_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_012695466.1|2403999_2404923_-|transposase	IS5-like element IS903B family transposase	transposase	Q1MVF0	Enterobacteria_phage	98.7	4.6e-175
WP_012695467.1|2404989_2405574_-	MFS transporter	NA	NA	NA	NA	NA
WP_021243026.1|2405651_2406809_-	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_012695469.1|2407002_2407896_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001118616.1|2408305_2409229_-|transposase	IS5-like element IS903B family transposase	transposase	Q9MCT5	Escherichia_phage	99.3	1.1e-176
WP_077257931.1|2409275_2409698_-	hypothetical protein	NA	A0A1B0VFY5	Salmonella_phage	97.6	6.7e-65
WP_001567369.1|2409751_2410384_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001567368.1|2410412_2411816_-|transposase	ISNCY-like element ISKpn21 family transposase	transposase	NA	NA	NA	NA
WP_012695466.1|2412057_2412981_-|transposase	IS5-like element IS903B family transposase	transposase	Q1MVF0	Enterobacteria_phage	98.7	4.6e-175
WP_012695467.1|2413047_2413632_-	MFS transporter	NA	NA	NA	NA	NA
WP_021243026.1|2413709_2414867_-	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_012695469.1|2415060_2415954_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001118616.1|2416363_2417287_-|transposase	IS5-like element IS903B family transposase	transposase	Q9MCT5	Escherichia_phage	99.3	1.1e-176
>prophage 4
NZ_CP008823	UNVERIFIED_ORG: Enterobacter cloacae ECNIH2, complete genome	4852980	2840818	2935775	4852980	terminase,tRNA,protease,integrase,portal,holin,plate,coat,tail	Salmonella_phage(12.77%)	102	2892154:2892169	2936992:2937007
WP_032619517.1|2840818_2842552_+|tRNA	arginine--tRNA ligase	tRNA	A0A1V0SIS8	Klosneuvirus	36.8	8.8e-87
WP_026080697.1|2842586_2843726_-	glycoside hydrolase family 105 protein	NA	NA	NA	NA	NA
WP_017693238.1|2843730_2845314_-	MFS transporter	NA	NA	NA	NA	NA
WP_023303901.1|2845574_2845967_-	flagellar protein FlhE	NA	NA	NA	NA	NA
WP_023303902.1|2845966_2848045_-	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_006811100.1|2848037_2849186_-	flagellar type III secretion system protein FlhB	NA	NA	NA	NA	NA
WP_003859718.1|2849336_2849981_-	protein phosphatase CheZ	NA	NA	NA	NA	NA
WP_000763862.1|2849991_2850381_-	chemotaxis protein CheY	NA	Q56AR1	Bacillus_thuringiensis_phage	31.3	1.3e-06
WP_014884341.1|2850398_2851448_-	chemotaxis response regulator protein-glutamate methylesterase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.0	2.3e-05
WP_017384409.1|2851444_2852311_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_017693235.1|2852330_2853932_-	methyl-accepting chemotaxis protein IV	NA	A0A2H4J162	uncultured_Caudovirales_phage	77.3	2.2e-07
WP_023303904.1|2853976_2855644_-	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	34.7	5.8e-11
WP_017384412.1|2855729_2856692_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_023303905.1|2856688_2859073_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_032619515.1|2859048_2859810_-	molecular chaperone	NA	NA	NA	NA	NA
WP_015570265.1|2859826_2860375_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_023303908.1|2860382_2860955_-	fimbrial major subunit CsuA/B family protein	NA	NA	NA	NA	NA
WP_023303909.1|2861382_2862642_+	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_003859699.1|2862738_2863242_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_017384416.1|2863261_2865271_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_017693230.1|2865275_2866205_-	flagellar motor protein MotB	NA	NA	NA	NA	NA
WP_003859696.1|2866201_2867089_-	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
WP_003859695.1|2867212_2867791_-	flagellar transcriptional regulator FlhC	NA	NA	NA	NA	NA
WP_006811111.1|2867793_2868153_-	flagellar transcriptional regulator FlhD	NA	NA	NA	NA	NA
WP_017384418.1|2868940_2869369_+	universal stress protein UspC	NA	NA	NA	NA	NA
WP_015570257.1|2869384_2870809_-	alpha,alpha-trehalose-phosphate synthase	NA	NA	NA	NA	NA
WP_023303910.1|2870783_2871587_-	trehalose-phosphatase	NA	NA	NA	NA	NA
WP_003859689.1|2871740_2872721_-	L-arabinose ABC transporter permease AraH	NA	NA	NA	NA	NA
WP_032619514.1|2872735_2874250_-	L-arabinose ABC transporter ATP-binding protein AraG	NA	A0A285PWH2	Cedratvirus	28.2	6.9e-11
WP_017384422.1|2874321_2875311_-	arabinose ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_017384423.1|2875628_2876186_-	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
WP_032619513.1|2876689_2877193_+	non-heme ferritin-like protein	NA	NA	NA	NA	NA
WP_017693227.1|2877334_2878678_+	anaerobic C4-dicarboxylate transporter	NA	NA	NA	NA	NA
WP_003859683.1|2878758_2879010_-	DUF2766 domain-containing protein	NA	NA	NA	NA	NA
WP_003859682.1|2879116_2879200_-	stress response protein AzuC	NA	NA	NA	NA	NA
WP_017384426.1|2879414_2880833_+	MFS transporter	NA	NA	NA	NA	NA
WP_003859680.1|2880875_2881514_-	RpiB/LacA/LacB family sugar-phosphate isomerase	NA	NA	NA	NA	NA
WP_015570249.1|2881759_2882098_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003859676.1|2882298_2882796_+	non-heme ferritin	NA	NA	NA	NA	NA
WP_003859673.1|2882832_2883069_-	YecH family protein	NA	NA	NA	NA	NA
WP_032620305.1|2883260_2884472_+	tyrosine transporter TyrP	NA	NA	NA	NA	NA
WP_003859671.1|2884788_2885457_-	YecA family protein	NA	NA	NA	NA	NA
WP_003859669.1|2885868_2886990_+	branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003859667.1|2887058_2887973_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_023303913.1|2887984_2889259_+	high-affinity branched-chain amino acid ABC transporter permease LivM	NA	NA	NA	NA	NA
WP_015570244.1|2889255_2890131_+	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_032619512.1|2890127_2890844_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.1	6.6e-12
WP_017384432.1|2891009_2891480_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032619511.1|2891485_2892412_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
2892154:2892169	attL	TGCGAAATACCCGGCA	NA	NA	NA	NA
WP_017384434.1|2892441_2892765_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032619510.1|2894424_2894958_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_032619509.1|2894954_2896229_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_004157630.1|2896536_2896692_+	type II toxin-antitoxin system HicA family toxin	NA	A0A0D4DC32	Acinetobacter_phage	78.4	1.2e-16
WP_032619507.1|2896713_2897118_+	type II toxin-antitoxin system HicB family antitoxin	NA	Q775F5	Haemophilus_virus	49.2	3.1e-35
WP_032619506.1|2897158_2898229_-	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_032619505.1|2898305_2898884_-|tail	tail fiber assembly protein	tail	E5G6P1	Salmonella_phage	54.9	5.2e-52
WP_050019395.1|2898883_2901061_-	hypothetical protein	NA	A0A0M3ULF6	Salmonella_phage	38.9	3.9e-55
WP_032619504.1|2901063_2901615_-|tail	phage tail protein I	tail	A0A0F7LDF3	Escherichia_phage	41.0	4.3e-27
WP_032619503.1|2901607_2902522_-|plate	baseplate assembly protein	plate	V5YTH6	Pseudomonas_phage	45.3	1.6e-58
WP_032619502.1|2902505_2902859_-|plate	baseplate assembly protein	plate	E5FFH4	Burkholderia_phage	50.0	8.5e-21
WP_032619501.1|2902895_2904014_-	late control protein D	NA	R9TNM7	Vibrio_phage	32.6	7.8e-36
WP_032620301.1|2904016_2904232_-|tail	tail protein	tail	R9TR63	Vibrio_phage	52.9	1.8e-13
WP_032619500.1|2904206_2904677_-|tail	phage tail protein	tail	D4HTW5	Vibrio_phage	33.8	3.8e-16
WP_032619498.1|2906920_2907208_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_032619497.1|2907259_2907766_-|tail	tail protein	tail	NA	NA	NA	NA
WP_032619495.1|2907762_2909232_-|tail	tail protein	tail	R9TMQ0	Vibrio_phage	47.1	1.1e-77
WP_032619493.1|2909270_2909894_-|plate	phage baseplate assembly protein V	plate	Q8HAB9	Salmonella_phage	30.8	7.2e-07
WP_023303465.1|2909886_2910441_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023299864.1|2910449_2911112_-	hypothetical protein	NA	R9TR34	Vibrio_phage	36.7	1.9e-21
WP_023303463.1|2911113_2911470_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032619492.1|2911469_2911805_-	DUF2190 family protein	NA	NA	NA	NA	NA
WP_103848174.1|2911873_2913931_-|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	53.2	4.6e-199
WP_032619491.1|2913923_2915444_-|portal	phage portal protein	portal	K7PHM5	Enterobacterial_phage	55.4	1.3e-153
WP_023299859.1|2915452_2915668_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032619490.1|2915664_2917785_-|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	74.7	9.2e-304
WP_032619489.1|2917788_2918292_-	DUF1441 family protein	NA	K7PJY2	Enterobacterial_phage	62.3	5.2e-48
WP_032619488.1|2918567_2918828_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032619487.1|2919016_2919244_-	hypothetical protein	NA	A0A1L6Z528	Klebsiella_phage	71.7	2.1e-17
WP_020690713.1|2919316_2919520_-	hypothetical protein	NA	A0A1W6JPG4	Morganella_phage	52.9	1.6e-11
WP_032619486.1|2919668_2919926_-	hypothetical protein	NA	Q8W634	Enterobacteria_phage	53.3	1.6e-16
WP_044489028.1|2919912_2920101_-	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	76.4	4.7e-18
WP_032620296.1|2920051_2920327_-	hypothetical protein	NA	G8C7W1	Escherichia_phage	65.9	1.6e-22
WP_032619484.1|2920334_2920964_-	glycoside hydrolase family 19 protein	NA	G8C7W0	Escherichia_phage	86.6	5.1e-101
WP_044489029.1|2920960_2921257_-|holin	phage holin family protein	holin	G8C7V9	Escherichia_phage	33.8	5.5e-05
WP_032619483.1|2921253_2921658_-	exported phage-related protein	NA	NA	NA	NA	NA
WP_032619482.1|2921996_2922602_-	hypothetical protein	NA	H9C175	Pectobacterium_phage	67.3	1.2e-75
WP_032619481.1|2922598_2922955_-	RusA family crossover junction endodeoxyribonuclease	NA	K7P6W0	Enterobacteria_phage	59.3	9.1e-39
WP_032619479.1|2924763_2925060_-	DUF968 domain-containing protein	NA	Q6V7S4	Burkholderia_virus	59.1	2.6e-23
WP_032619477.1|2925545_2925869_-	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	60.8	7.0e-30
WP_032620293.1|2926054_2926408_-	DUF550 domain-containing protein	NA	K7PGV7	Enterobacterial_phage	92.5	5.4e-52
WP_032619476.1|2926938_2927172_-	hypothetical protein	NA	S4TVX5	Salmonella_phage	46.2	2.8e-12
WP_032619475.1|2927367_2928024_-	DUF1627 domain-containing protein	NA	A0A088CE47	Shigella_phage	26.9	3.2e-13
WP_032619474.1|2928041_2928782_-	DNA replication protein DnaC	NA	S4TNF5	Salmonella_phage	72.3	1.1e-99
WP_032619473.1|2928784_2929702_-	hypothetical protein	NA	U5P0A0	Shigella_phage	40.0	2.4e-51
WP_032620290.1|2929724_2930177_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032619472.1|2930176_2930446_-	hypothetical protein	NA	H6WRX5	Salmonella_phage	38.7	2.2e-08
WP_032619471.1|2930518_2931010_+	helix-turn-helix domain-containing protein	NA	A0A0R6PH50	Moraxella_phage	55.0	1.4e-16
WP_032619469.1|2931852_2932125_+	hypothetical protein	NA	K7P7B3	Enterobacteria_phage	44.2	2.7e-14
WP_032619468.1|2932347_2934252_+	hypothetical protein	NA	K7P6V4	Enterobacteria_phage	29.8	7.3e-18
WP_032619467.1|2934238_2934481_+	DUF4060 family protein	NA	M9P0E0	Enterobacteria_phage	50.0	4.2e-11
WP_032619466.1|2934540_2934762_+	DUF4224 domain-containing protein	NA	H9C153	Pectobacterium_phage	42.9	1.8e-08
WP_032619465.1|2934761_2935775_+|integrase	tyrosine-type recombinase/integrase	integrase	H9C152	Pectobacterium_phage	69.0	5.6e-134
2936992:2937007	attR	TGCGAAATACCCGGCA	NA	NA	NA	NA
>prophage 5
NZ_CP008823	UNVERIFIED_ORG: Enterobacter cloacae ECNIH2, complete genome	4852980	2952524	3003383	4852980	terminase,integrase,holin,head,transposase,tail	Cronobacter_phage(28.81%)	76	2981768:2981782	3006579:3006593
WP_032619460.1|2952524_2953793_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	91.7	5.3e-230
WP_032619458.1|2953792_2954098_-	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	43.6	2.7e-15
WP_032619457.1|2954209_2954572_+	GtrA family protein	NA	U5P0S6	Shigella_phage	85.0	1.5e-49
WP_032619456.1|2954568_2955483_+	glycosyltransferase family 2 protein	NA	U5P087	Shigella_phage	90.4	3.0e-158
WP_058670718.1|2955486_2956902_+	hypothetical protein	NA	A0A0N7CG72	Salmonella_phage	29.5	3.7e-14
WP_032619453.1|2959191_2961669_-|tail	phage tail protein	tail	F1C5A7	Cronobacter_phage	92.8	0.0e+00
WP_032619452.1|2961655_2962021_-	C40 family peptidase	NA	F1C5F2	Cronobacter_phage	89.9	2.1e-62
WP_032619451.1|2962034_2962505_-	hypothetical protein	NA	F1C5F1	Cronobacter_phage	87.2	1.8e-74
WP_032619450.1|2962504_2963002_-	hypothetical protein	NA	F1C5F0	Cronobacter_phage	90.9	1.8e-88
WP_032619449.1|2963001_2965302_-	tape measure protein	NA	A0A291AXC6	Shigella_phage	41.0	1.0e-98
WP_032619448.1|2965359_2965734_-	hypothetical protein	NA	A0A0M4QWT0	Salmonella_phage	54.4	1.3e-24
WP_032619447.1|2965806_2966550_-	hypothetical protein	NA	G0ZNE7	Cronobacter_phage	53.9	4.5e-64
WP_032104759.1|2966600_2967356_-	Ig domain-containing protein	NA	G0ZNE6	Cronobacter_phage	53.0	4.9e-58
WP_032619446.1|2967414_2967798_-	hypothetical protein	NA	F1C5E4	Cronobacter_phage	57.5	4.9e-38
WP_032619445.1|2967794_2968163_-	hypothetical protein	NA	F1C5E3	Cronobacter_phage	73.0	1.5e-44
WP_032619444.1|2968165_2968516_-	hypothetical protein	NA	G0ZNE2	Cronobacter_phage	65.2	7.6e-38
WP_032619443.1|2968515_2968689_-	hypothetical protein	NA	I6R0P9	Salmonella_phage	48.2	6.6e-11
WP_032619442.1|2968688_2969069_-	hypothetical protein	NA	F1C5E2	Cronobacter_phage	54.5	9.1e-29
WP_032619441.1|2969071_2969437_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014884000.1|2969446_2970544_-	hypothetical protein	NA	F1C5E1	Cronobacter_phage	77.7	7.6e-161
WP_032619440.1|2970553_2970988_-	hypothetical protein	NA	F1C5E0	Cronobacter_phage	73.6	1.1e-51
WP_032619439.1|2970991_2972185_-	DUF2213 domain-containing protein	NA	F1C5D9	Cronobacter_phage	47.5	4.1e-91
WP_032619437.1|2972277_2972472_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071843636.1|2972503_2973490_-|head	phage head morphogenesis protein	head	F1C5D8	Cronobacter_phage	65.8	2.1e-109
WP_032619435.1|2973437_2974898_-	DUF1073 domain-containing protein	NA	F1C5D7	Cronobacter_phage	74.2	1.4e-197
WP_017693190.1|2974909_2976457_-|terminase	terminase	terminase	G8C7P3	Escherichia_phage	90.0	7.0e-293
WP_032619434.1|2976453_2977104_-	hypothetical protein	NA	G8C7P2	Escherichia_phage	91.2	1.3e-104
WP_032619433.1|2977107_2977314_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032619431.1|2977310_2977529_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032619430.1|2977677_2977887_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044489031.1|2977974_2978169_-	hypothetical protein	NA	K7PM01	Enterobacterial_phage	93.2	2.8e-18
WP_032619429.1|2978119_2978398_-	hypothetical protein	NA	G8C7W1	Escherichia_phage	51.7	1.3e-13
WP_022651099.1|2978394_2978937_-	glycoside hydrolase family 108 protein	NA	A0A0U2S643	Escherichia_phage	70.4	2.7e-74
WP_001514184.1|2978939_2979215_-|holin	phage holin family protein	holin	S4TNV9	Salmonella_phage	41.0	5.8e-09
WP_001514183.1|2979211_2979613_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071843637.1|2979858_2980122_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032619428.1|2980048_2980738_-	antiterminator	NA	I6PDF8	Cronobacter_phage	52.8	1.7e-57
WP_094314629.1|2980734_2980851_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032619426.1|2980847_2981210_-	RusA family crossover junction endodeoxyribonuclease	NA	K7PM48	Enterobacteria_phage	82.4	2.5e-52
WP_015964709.1|2981206_2981497_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	91.7	6.3e-46
WP_023296423.1|2981489_2981660_-	NinE family protein	NA	K7P7K0	Enterobacteria_phage	96.2	1.2e-20
WP_032619423.1|2981659_2982115_-	hypothetical protein	NA	I6PD71	Cronobacter_phage	66.9	2.4e-60
2981768:2981782	attL	CATCTCGCCGGTTTC	NA	NA	NA	NA
WP_032619422.1|2982292_2982553_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032619420.1|2982549_2982798_-	DNA polymerase III subunit theta	NA	G8C7V1	Escherichia_phage	95.0	5.9e-37
WP_006808975.1|2982797_2982980_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050019399.1|2983013_2983889_-	DUF551 domain-containing protein	NA	A0A248SKW5	Klebsiella_phage	46.3	5.4e-16
WP_032619419.1|2983885_2984308_-	HNH endonuclease	NA	C6ZR29	Salmonella_phage	86.4	5.0e-68
WP_080288378.1|2984310_2984751_-	ead/Ea22-like family protein	NA	K7P6J7	Enterobacteria_phage	48.9	2.7e-32
WP_032619418.1|2985352_2985697_-	helix-turn-helix transcriptional regulator	NA	G8C7U7	Escherichia_phage	95.5	1.1e-54
WP_032619417.1|2985696_2987130_-	AAA family ATPase	NA	Q716D2	Shigella_phage	87.6	3.7e-232
WP_032619416.1|2987119_2988019_-	hypothetical protein	NA	Q37929	Escherichia_phage	53.8	6.0e-79
WP_032619414.1|2988247_2988790_-	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	92.2	9.5e-88
WP_032619413.1|2988875_2989064_-	hypothetical protein	NA	A0A2R2Z333	Escherichia_phage	51.8	1.5e-08
WP_032619411.1|2989167_2989878_+	helix-turn-helix domain-containing protein	NA	K7P8B2	Enterobacteria_phage	70.2	4.1e-91
WP_001118616.1|2990355_2991279_-|transposase	IS5-like element IS903B family transposase	transposase	Q9MCT5	Escherichia_phage	99.3	1.1e-176
WP_103848177.1|2991267_2991915_+	hypothetical protein	NA	A4KWU2	Enterobacteria_phage	93.0	1.3e-99
WP_032619408.1|2991954_2992152_-	hypothetical protein	NA	G8C7T7	Escherichia_phage	96.9	3.2e-25
WP_032619407.1|2992873_2993080_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032105105.1|2993243_2993492_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006809788.1|2993643_2993853_+	cell division protein FtsZ	NA	M9NZE2	Enterobacteria_phage	95.7	6.7e-34
WP_032619405.1|2993923_2995000_+	hypothetical protein	NA	A0A077KCC0	Edwardsiella_phage	70.2	5.8e-36
WP_032619404.1|2995008_2995206_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032619401.1|2995372_2996239_+	ATP-binding protein	NA	A0A1B1P9H8	Acinetobacter_phage	58.0	3.9e-59
WP_032619399.1|2996239_2996770_+	single-stranded DNA-binding protein SSB1	NA	A0A0A0P1Q9	Enterobacteria_phage	91.6	6.9e-51
WP_032619398.1|2996976_2997306_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032619397.1|2997305_2997458_+	DUF1317 family protein	NA	NA	NA	NA	NA
WP_071843638.1|2997454_2999401_+	phage N-6-adenine-methyltransferase	NA	A0A1B0V7P0	Salmonella_phage	47.0	8.6e-115
WP_032619396.1|2999397_2999616_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032619395.1|2999612_3000224_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032619394.1|3000220_3000412_+	DUF1382 family protein	NA	A0A0P0ZC60	Stx2-converting_phage	61.0	1.3e-12
WP_032619392.1|3000503_3000719_+	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	61.4	1.5e-15
WP_032619391.1|3000718_3001102_+	DUF2591 domain-containing protein	NA	A0A2D1GLI3	Escherichia_phage	44.1	9.2e-13
WP_032619390.1|3001064_3001304_+	DUF4222 domain-containing protein	NA	Q6H9Z8	Enterobacteria_phage	50.0	8.3e-12
WP_032619389.1|3001313_3001664_+	hypothetical protein	NA	A0A2I6PID6	Escherichia_phage	59.6	5.1e-34
WP_032619388.1|3001796_3002042_+	excisionase family protein	NA	Q8W657	Enterobacteria_phage	69.2	5.5e-27
WP_032619387.1|3002087_3003383_+|integrase	site-specific integrase	integrase	Q20GI2	Phage_258-320	68.9	5.1e-180
3006579:3006593	attR	GAAACCGGCGAGATG	NA	NA	NA	NA
>prophage 6
NZ_CP008823	UNVERIFIED_ORG: Enterobacter cloacae ECNIH2, complete genome	4852980	3086820	3097633	4852980		Bodo_saltans_virus(12.5%)	9	NA	NA
WP_017693103.1|3086820_3087432_+	bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE	NA	A0A2H4UVM0	Bodo_saltans_virus	29.3	1.6e-14
WP_032619360.1|3087471_3088452_-	LPS O-antigen chain length determinant protein WzzB	NA	NA	NA	NA	NA
WP_032619359.1|3088646_3089651_+	NAD-dependent epimerase	NA	A0A2K9L0I7	Tupanvirus	29.0	1.9e-33
WP_032619358.1|3089700_3090867_-	UDP-glucose 6-dehydrogenase	NA	A0A1J0FA55	Only_Syngen_Nebraska_virus	54.0	7.0e-112
WP_017693099.1|3091105_3091987_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	62.7	9.0e-104
WP_032619357.1|3091987_3093073_-	dTDP-glucose 4,6-dehydratase	NA	A0A291LAD7	Escherichia_phage	52.6	8.2e-99
WP_032619355.1|3093162_3094569_-	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.5	4.7e-38
WP_032619354.1|3094734_3096105_-	phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	27.7	2.0e-33
WP_032619353.1|3096214_3097633_-	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	32.1	8.9e-61
>prophage 7
NZ_CP008823	UNVERIFIED_ORG: Enterobacter cloacae ECNIH2, complete genome	4852980	3561380	3585870	4852980	integrase,transposase	Salmonella_phage(35.0%)	30	3578930:3578943	3586979:3586992
WP_003860714.1|3561380_3563186_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	25.9	1.1e-23
WP_085949497.1|3563814_3564961_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	92.6	2.3e-147
WP_032620270.1|3565118_3565319_-	hypothetical protein	NA	H6WRY8	Salmonella_phage	69.7	1.9e-22
WP_032619262.1|3565324_3565924_-	DUF1367 family protein	NA	H6WRY7	Salmonella_phage	87.3	2.9e-98
WP_032619260.1|3566007_3566217_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032619259.1|3566330_3566564_-	DinI family protein	NA	K7PM44	Enterobacteria_phage	79.2	1.2e-28
WP_032619258.1|3566827_3567586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044489041.1|3567633_3569709_-	DNA methyltransferase	NA	H9C171	Pectobacterium_phage	52.6	1.6e-199
WP_032619256.1|3569705_3569963_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032619254.1|3569964_3570444_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032619253.1|3570440_3570701_-	DUF977 family protein	NA	H6WRX9	Salmonella_phage	62.5	7.9e-24
WP_032619252.1|3570687_3571419_-	DUF1627 domain-containing protein	NA	NA	NA	NA	NA
WP_032619251.1|3571430_3572123_-	phage replication protein P	NA	G8C7U6	Escherichia_phage	60.9	2.4e-80
WP_032619250.1|3572106_3573099_-	replication protein	NA	A5VW95	Enterobacteria_phage	75.0	1.4e-49
WP_032619249.1|3573534_3574077_-	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	55.6	4.3e-48
WP_017693528.1|3574079_3574310_-	hypothetical protein	NA	H6WRX5	Salmonella_phage	43.1	1.5e-10
WP_017693529.1|3574430_3574844_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	42.4	8.2e-07
WP_032619247.1|3575035_3575221_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022651662.1|3575340_3575526_+	YebW family protein	NA	NA	NA	NA	NA
WP_022651664.1|3575777_3576065_+	hypothetical protein	NA	H6WRX2	Salmonella_phage	67.4	5.4e-34
WP_032619246.1|3576187_3579247_+	exodeoxyribonuclease	NA	K7PJT5	Enterobacteria_phage	67.5	0.0e+00
3578930:3578943	attL	AGCCTGCGCGCCAG	NA	NA	NA	NA
WP_022651666.1|3579256_3580342_+	recombinase RecT	NA	K7PKR8	Enterobacteria_phage	53.5	9.1e-106
WP_032619244.1|3580376_3580988_+	hypothetical protein	NA	A0A077SLQ8	Escherichia_phage	50.0	1.8e-42
WP_017692869.1|3580974_3581217_+	DUF4060 family protein	NA	K7PHF4	Enterobacteria_phage	93.6	7.8e-34
WP_022651668.1|3581263_3581548_+	excisionase Xis	NA	H6WRW8	Salmonella_phage	83.0	4.3e-39
WP_006811608.1|3581525_3582755_-|integrase	site-specific integrase	integrase	H6WRW7	Salmonella_phage	98.8	9.9e-242
WP_006811609.1|3583186_3583663_-	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
WP_023304255.1|3583659_3584613_-	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
WP_015572138.1|3584612_3585263_-	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_006176728.1|3585294_3585870_-	RNA polymerase sigma factor RpoE	NA	A0A0F6TH34	Sinorhizobium_phage	28.1	8.2e-05
3586979:3586992	attR	CTGGCGCGCAGGCT	NA	NA	NA	NA
>prophage 8
NZ_CP008823	UNVERIFIED_ORG: Enterobacter cloacae ECNIH2, complete genome	4852980	3621801	3664465	4852980	tRNA,integrase,transposase,protease	Escherichia_phage(28.57%)	41	3627147:3627166	3667400:3667419
WP_014832949.1|3621801_3622569_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_015571575.1|3622600_3623140_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_003863133.1|3623155_3623404_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_003863132.1|3623520_3624882_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_014832951.1|3625048_3625840_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_026094274.1|3625859_3627146_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
3627147:3627166	attL	AATGTAGGCCGGGTAAGGCG	NA	NA	NA	NA
WP_003863126.1|3627197_3627791_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_017383004.1|3627913_3628792_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_015571579.1|3628877_3630539_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_071524123.1|3630513_3630696_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023304267.1|3630677_3631016_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_023304268.1|3631124_3631412_-	RnfH family protein	NA	NA	NA	NA	NA
WP_006811645.1|3631401_3631878_-	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_003863115.1|3631995_3632478_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	6.8e-29
WP_032619204.1|3633054_3634326_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	90.5	1.4e-214
WP_080288391.1|3634482_3636204_-	ATP-dependent helicase	NA	A0A1P8CWU5	Bacillus_phage	22.9	9.6e-17
WP_050019407.1|3636237_3638373_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_128302277.1|3638694_3639597_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047685188.1|3639600_3639807_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032619198.1|3640534_3641896_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032620260.1|3642072_3642450_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032619196.1|3642418_3643609_+	relaxase/mobilization nuclease domain-containing protein	NA	NA	NA	NA	NA
WP_071605947.1|3643831_3644110_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032619194.1|3644139_3644526_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032619193.1|3644545_3644860_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032619191.1|3644896_3645322_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001625709.1|3645418_3645805_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032619190.1|3645819_3647694_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_032619187.1|3647690_3648995_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_032619186.1|3648987_3650190_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_001019190.1|3650485_3650785_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000795663.1|3650805_3651012_-	AlpA family transcriptional regulator	NA	A0A0R6PGY4	Moraxella_phage	41.1	8.5e-05
WP_001067212.1|3651292_3652138_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085949497.1|3653571_3654718_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	92.6	2.3e-147
WP_001618768.1|3655169_3656048_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001618769.1|3656173_3656386_+	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	43.3	4.2e-07
WP_001618770.1|3656512_3657928_+	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_071842894.1|3658058_3658685_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_032619182.1|3658799_3660869_-|protease	protease Lon-related BREX system protein BrxL	protease	NA	NA	NA	NA
WP_032619181.1|3660879_3663477_-	BREX-1 system phosphatase PglZ type A	NA	NA	NA	NA	NA
WP_032634629.1|3663541_3664465_-|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	99.7	1.1e-176
3667400:3667419	attR	CGCCTTACCCGGCCTACATT	NA	NA	NA	NA
>prophage 9
NZ_CP008823	UNVERIFIED_ORG: Enterobacter cloacae ECNIH2, complete genome	4852980	4042914	4079422	4852980	integrase,transposase	Stx2-converting_phage(20.0%)	26	4055915:4055929	4083349:4083363
WP_000227969.1|4042914_4043991_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_016151369.1|4045530_4045881_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	65.5	9.6e-41
WP_007901308.1|4048044_4048968_-|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	97.4	1.5e-173
WP_007896426.1|4049166_4050492_+	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	48.1	6.5e-114
WP_016151347.1|4051735_4052257_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_023304425.1|4052253_4053207_+	fec operon regulator FecR	NA	NA	NA	NA	NA
WP_022652364.1|4053293_4055618_+	Fe(3+) dicitrate transport protein FecA	NA	NA	NA	NA	NA
WP_007898890.1|4055662_4056565_+	Fe(3+) dicitrate ABC transporter substrate-binding protein FecB	NA	NA	NA	NA	NA
4055915:4055929	attL	GGAACGCGCGCGCAG	NA	NA	NA	NA
WP_004118243.1|4056561_4057560_+	iron-dicitrate ABC transporter permease FecC	NA	NA	NA	NA	NA
WP_004118246.1|4057556_4058513_+	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	5.3e-17
WP_004152282.1|4058513_4059281_+	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	25.2	9.8e-14
WP_007898888.1|4059379_4059673_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	95.9	4.7e-49
WP_007898884.1|4060003_4060282_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_000427614.1|4060543_4061548_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_032435706.1|4061951_4062944_-	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_007851507.1|4063313_4064396_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	98.1	6.5e-189
WP_007894989.1|4064517_4067592_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	96.8	0.0e+00
WP_003846917.1|4067643_4068897_+	lactose permease	NA	NA	NA	NA	NA
WP_003846919.1|4068953_4069124_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017384068.1|4069978_4071112_-	alcohol dehydrogenase catalytic domain-containing protein	NA	NA	NA	NA	NA
WP_000019450.1|4071382_4072363_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	1.8e-185
WP_085949497.1|4072646_4073794_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	92.6	2.3e-147
WP_017384060.1|4073884_4074313_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017384059.1|4074316_4076434_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007897920.1|4076421_4078188_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007897923.1|4078174_4079422_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
4083349:4083363	attR	CTGCGCGCGCGTTCC	NA	NA	NA	NA
>prophage 10
NZ_CP008823	UNVERIFIED_ORG: Enterobacter cloacae ECNIH2, complete genome	4852980	4137360	4179752	4852980	terminase,tRNA,integrase,portal,lysis,holin,plate,head,tail,capsid	Erwinia_phage(37.21%)	50	4130324:4130343	4185209:4185228
4130324:4130343	attL	CGGTATCGCGCTCGGGGGAA	NA	NA	NA	NA
WP_015571911.1|4137360_4138374_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	58.9	1.4e-108
WP_001144069.1|4138610_4138826_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_032618997.1|4138941_4140687_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	39.0	1.4e-76
WP_015571912.1|4140839_4142684_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.4e-35
WP_017384024.1|4142784_4143291_-	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_032618996.1|4143570_4144218_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063132245.1|4144240_4144459_-	DNA-binding transcriptional regulator	NA	A0A2I8TV89	Erwinia_phage	86.1	5.4e-34
WP_032618995.1|4144524_4145694_-	phage late control D family protein	NA	Q6K1G4	Salmonella_virus	77.5	2.5e-170
WP_032618994.1|4145690_4146155_-|tail	phage tail protein	tail	A0A218M4I2	Erwinia_phage	70.8	2.1e-59
WP_032618993.1|4146165_4148616_-|tail	phage tail tape measure protein	tail	Q858U7	Yersinia_virus	74.1	9.3e-308
WP_032665230.1|4148605_4148728_-|tail	GpE family phage tail protein	tail	O80316	Escherichia_phage	87.2	7.7e-14
WP_032618991.1|4148760_4149084_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	66.3	2.3e-25
WP_017382996.1|4149141_4149660_-|tail	phage major tail tube protein	tail	A0A218M4J0	Erwinia_phage	81.4	2.9e-78
WP_023323582.1|4149672_4150866_-|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	81.1	2.4e-184
WP_032618988.1|4151240_4151672_-|tail	tail fiber assembly protein	tail	B6SCW7	Bacteriophage	41.1	7.0e-17
WP_044489085.1|4151673_4154022_-|tail	tail fiber protein	tail	A0A0F7LDR4	Escherichia_phage	49.2	3.0e-114
WP_032620226.1|4154033_4154564_-|tail	phage tail protein I	tail	Q37841	Escherichia_phage	87.5	2.4e-91
WP_032618987.1|4154556_4155465_-|plate	baseplate assembly protein	plate	A0A0F7LCQ9	Escherichia_phage	83.1	3.0e-134
WP_032618985.1|4155470_4155821_-|plate	baseplate assembly protein	plate	A0A0M4RE59	Salmonella_phage	71.6	6.2e-40
WP_032618984.1|4155817_4156453_-|plate	phage baseplate assembly protein V	plate	A0A2I8TV69	Erwinia_phage	86.7	8.2e-99
WP_032618983.1|4156521_4156971_-	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	65.8	4.7e-48
WP_032618981.1|4156963_4157431_-|tail	phage tail protein	tail	A0A218M4K6	Erwinia_phage	68.4	2.3e-58
WP_072203250.1|4157393_4157639_-|holin	holin	holin	S4TNY4	Salmonella_phage	74.1	3.2e-27
WP_032618979.1|4157526_4157943_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A218M4K2	Erwinia_phage	67.2	2.1e-42
WP_032618978.1|4157942_4158374_-	hypothetical protein	NA	A0A218M4L6	Erwinia_phage	78.3	2.8e-58
WP_023295248.1|4158370_4158883_-	lysozyme	NA	A0A218M4K3	Erwinia_phage	89.4	1.0e-83
WP_032618977.1|4158866_4159088_-	hypothetical protein	NA	A0A218M4L5	Erwinia_phage	74.0	7.1e-26
WP_017382979.1|4159078_4159282_-|tail	tail protein	tail	Q858W3	Yersinia_virus	79.1	3.3e-25
WP_023295250.1|4159281_4159788_-|head	head completion/stabilization protein	head	O80306	Escherichia_phage	72.0	4.4e-63
WP_032618975.1|4159887_4160643_-|terminase	terminase endonuclease subunit	terminase	Q6K1I5	Salmonella_virus	64.5	9.8e-75
WP_017382976.1|4160646_4161714_-|capsid	phage major capsid protein, P2 family	capsid	A0A0M4R4W2	Salmonella_phage	83.6	9.7e-169
WP_032618973.1|4161769_4162624_-|capsid	GPO family capsid scaffolding protein	capsid	S4TP53	Salmonella_phage	73.6	1.9e-114
WP_044489087.1|4162789_4164559_+|terminase	terminase ATPase subunit family protein	terminase	A0A218M4M1	Erwinia_phage	85.1	2.3e-300
WP_032618971.1|4164560_4165586_+|portal	phage portal protein	portal	Q6K1J0	Salmonella_virus	83.0	4.6e-168
WP_032618970.1|4166012_4167971_+	histidine kinase-, DNA gyrase B-, and HSP90-like ATPase	NA	NA	NA	NA	NA
WP_032618969.1|4168014_4169064_-	DNA cytosine methyltransferase	NA	A0A0R6PG08	Moraxella_phage	55.9	5.7e-105
WP_032665232.1|4169188_4169386_-	hypothetical protein	NA	A0A218M4I0	Erwinia_phage	71.4	1.5e-11
WP_032618967.1|4169508_4171737_-	replication endonuclease	NA	A0A218M4H2	Erwinia_phage	89.6	0.0e+00
WP_032618966.1|4171723_4171945_-	TraR/DksA family transcriptional regulator	NA	Q6K1F5	Salmonella_virus	94.4	1.1e-31
WP_032618964.1|4171944_4172172_-	DUF2732 domain-containing protein	NA	A0A0M3UL87	Salmonella_phage	70.1	4.8e-17
WP_032618963.1|4172238_4172577_-	DUF5347 domain-containing protein	NA	A0A218M4I7	Erwinia_phage	92.9	3.6e-53
WP_071842907.1|4172540_4172741_-	DUF2724 domain-containing protein	NA	Q6K1F7	Salmonella_virus	90.9	1.3e-29
WP_032618962.1|4172748_4173258_-	phage regulatory CII family protein	NA	Q6K1F8	Salmonella_virus	91.7	8.6e-83
WP_032618960.1|4173288_4173552_-	hypothetical protein	NA	A0A218M4I5	Erwinia_phage	93.1	5.0e-42
WP_080288393.1|4173676_4174249_+	phage repressor protein CI	NA	F1BUS8	Erwinia_phage	74.1	1.8e-76
WP_032618959.1|4174248_4175265_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	95.0	8.6e-191
WP_017692643.1|4175621_4176791_+	DNA repair ATPase	NA	NA	NA	NA	NA
WP_017692642.1|4176791_4177556_-	siderophore-interacting protein	NA	NA	NA	NA	NA
WP_017382401.1|4177701_4178196_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_032618958.1|4178192_4179752_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	28.7	9.6e-08
4185209:4185228	attR	CGGTATCGCGCTCGGGGGAA	NA	NA	NA	NA
>prophage 1
NZ_CP008824	UNVERIFIED_ORG: Enterobacter cloacae ECNIH2 plasmid pKEC-39c, complete sequence	319976	22947	95346	319976	protease,integrase,transposase	Escherichia_phage(14.29%)	89	53224:53241	60408:60425
WP_019706040.1|22947_23784_-|transposase	IS5-like element ISEc61 family transposase	transposase	NA	NA	NA	NA
WP_001275995.1|24021_24336_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000262467.1|24349_25144_+	APH(3')-II family aminoglycoside O-phosphotransferase	NA	Q75ZG1	Hepacivirus	74.3	6.4e-109
WP_000349358.1|25170_25530_+	BLMT family bleomycin binding protein	NA	NA	NA	NA	NA
WP_100206629.1|25460_25649_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019706001.1|25692_26640_+|transposase	IS30-like element ISAs2 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.7	1.4e-41
WP_016809943.1|26722_27871_+	cephalosporin-hydrolyzing class C beta-lactamase FOX-5	NA	NA	NA	NA	NA
WP_016809945.1|29387_30350_+	HTH-type transcriptional regulator YidZ	NA	NA	NA	NA	NA
WP_041445713.1|30961_31909_+|transposase	IS30-like element ISAs2 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.7	2.3e-41
WP_071843640.1|32630_32834_+	type II toxin-antitoxin system YafQ family toxin	NA	NA	NA	NA	NA
WP_001067855.1|32867_33572_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_012561167.1|34144_34510_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012561166.1|34509_37746_-	conjugative relaxase	NA	U5J9B0	Bacillus_phage	27.3	2.4e-05
WP_017787123.1|37952_38969_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.4	2.9e-186
WP_041445714.1|38973_40473_-	type IV secretion system DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001749975.1|40474_40891_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020319858.1|41663_41801_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001749973.1|41809_42526_+	StdB	NA	NA	NA	NA	NA
WP_000414913.1|42527_42896_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048968061.1|43188_43422_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001749971.1|43532_43853_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000214483.1|43907_44087_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000932975.1|44972_45212_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000881513.1|45221_45626_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000447669.1|45683_46109_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000861760.1|46523_46964_+	translesion error-prone DNA polymerase V autoproteolytic subunit MucA	NA	A0A1W6JNS2	Morganella_phage	48.8	1.2e-27
WP_001749980.1|46951_48217_+	translesion error-prone DNA polymerase V subunit MucB	NA	F1C5A5	Cronobacter_phage	53.8	2.2e-119
WP_001452808.1|48367_49159_+|protease	zinc metalloprotease	protease	NA	NA	NA	NA
WP_000057569.1|49173_49515_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001749982.1|50074_50794_+	replication initiation protein	NA	I3WF20	Macacine_betaherpesvirus	28.9	8.6e-20
WP_108742639.1|51736_52399_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001749988.1|52750_53320_-	recombinase family protein	NA	E5FFF9	Burkholderia_phage	43.2	5.2e-36
53224:53241	attL	CCTGATAGATTTGCTCAC	NA	NA	NA	NA
WP_015344971.1|53459_53744_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000845048.1|53712_54726_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_004201280.1|54881_55355_+	trimethoprim-resistant dihydrofolate reductase DfrA14	NA	G3MBI7	Bacillus_virus	28.9	8.4e-16
WP_001144737.1|55575_55842_+	plasmid mobilization relaxosome protein MobC	NA	NA	NA	NA	NA
WP_001389365.1|55984_56749_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_024139167.1|56790_57003_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001749969.1|57015_58224_+	type II site-specific deoxyribonuclease	NA	E5E3X4	Burkholderia_phage	42.5	1.2e-34
WP_001288432.1|58257_59691_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.6	7.0e-106
WP_001749967.1|60072_60279_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064577928.1|60283_60772_-	restriction endonuclease	NA	NA	NA	NA	NA
60408:60425	attR	GTGAGCAAATCTATCAGG	NA	NA	NA	NA
WP_001067855.1|61021_61726_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001173919.1|61987_62563_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	52.7	5.6e-46
WP_019706040.1|63309_64146_+|transposase	IS5-like element ISEc61 family transposase	transposase	NA	NA	NA	NA
WP_000039129.1|64369_64717_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000988987.1|64713_65142_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000004672.1|65134_65416_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000056203.1|65480_65699_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001256128.1|65710_66280_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000435224.1|66282_66828_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000268395.1|66944_67883_+	hypothetical protein	NA	A0A2P9HXK7	Yersinia_phage	50.2	1.5e-69
WP_000532167.1|67882_68080_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001337764.1|68066_68318_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001096362.1|68317_68560_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001258027.1|68562_68925_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000098292.1|68917_69130_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000194038.1|69189_69945_-	ATPase AAA	NA	K4HZD4	Acidithiobacillus_phage	51.0	5.8e-59
WP_001274811.1|69959_71501_-|transposase	IS21-like element ISAs29 family transposase	transposase	K4I413	Acidithiobacillus_phage	47.6	4.4e-130
WP_001050849.1|71745_72780_+	site-specific DNA-methyltransferase	NA	H8ZMF1	Synechococcus_phage	20.9	1.0e-05
WP_000058870.1|72793_73243_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000338945.1|73224_73536_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001151304.1|73709_74495_+	ParA family protein	NA	A0A1X9IGI7	Lactococcus_phage	26.4	6.1e-11
WP_001207227.1|74498_75680_+	ParB/RepB/Spo0J family partition protein	NA	I3NLC2	Bifidobacterium_phage	28.7	2.4e-11
WP_000703827.1|75728_76001_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000074431.1|76053_76689_-	N-6 DNA methylase	NA	NA	NA	NA	NA
WP_001125905.1|77242_77620_+	hypothetical protein	NA	A0A2H4P7P5	Pseudomonas_phage	49.6	2.2e-22
WP_000044824.1|77612_77894_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000344151.1|77868_78543_+	thymidylate kinase	NA	NA	NA	NA	NA
WP_005507681.1|78610_79042_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000348669.1|79026_79359_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000647189.1|79367_79868_+	hypothetical protein	NA	I3UMJ0	Colwellia_phage	43.3	1.7e-19
WP_000936896.1|79871_81299_+	DNA cytosine methyltransferase	NA	NA	NA	NA	NA
WP_000268551.1|81298_81955_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000362482.1|82160_82379_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000464631.1|82472_83090_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000505707.1|83090_83297_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000542259.1|83301_83601_+	hypothetical protein	NA	A0A0K1LLW2	Caulobacter_phage	55.4	2.1e-20
WP_000468105.1|83692_84181_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000366821.1|84195_86388_-	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	29.2	2.9e-42
WP_001191892.1|86387_86621_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001249396.1|86602_87220_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001337757.1|87387_90366_+	conjugal transfer protein TraI	NA	NA	NA	NA	NA
WP_000178856.1|90362_92228_+	conjugative transfer system coupling protein TraD	NA	NA	NA	NA	NA
WP_000332866.1|92238_92823_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000743450.1|92779_93409_+	DUF4400 domain-containing protein	NA	NA	NA	NA	NA
WP_000122506.1|93418_93865_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041445762.1|93874_94054_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086008128.1|94142_95346_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	70.1	7.7e-114
>prophage 2
NZ_CP008824	UNVERIFIED_ORG: Enterobacter cloacae ECNIH2 plasmid pKEC-39c, complete sequence	319976	139503	176011	319976	integrase,transposase	Escherichia_phage(20.0%)	26	133262:133275	145679:145692
133262:133275	attL	AATAAAGGCTCAGG	NA	NA	NA	NA
WP_007897923.1|139503_140751_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_007897920.1|140737_142504_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017384059.1|142491_144609_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017384060.1|144612_145041_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085949497.1|145131_146278_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	92.6	2.3e-147
145679:145692	attR	AATAAAGGCTCAGG	NA	NA	NA	NA
WP_000019450.1|146562_147543_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	1.8e-185
WP_017384068.1|147813_148947_+	alcohol dehydrogenase catalytic domain-containing protein	NA	E3SJ82	Synechococcus_phage	28.9	1.7e-09
WP_003846919.1|149801_149972_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003846917.1|150028_151282_-	lactose permease	NA	NA	NA	NA	NA
WP_007894989.1|151333_154408_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	96.8	0.0e+00
WP_007851507.1|154529_155612_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	98.1	6.5e-189
WP_032435706.1|155981_156974_+	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_000427614.1|157377_158382_+|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_007898884.1|158643_158922_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_007898888.1|159252_159546_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	95.9	4.7e-49
WP_004152282.1|159644_160412_-	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	25.2	9.8e-14
WP_004118246.1|160412_161369_-	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	NA	NA	NA	NA
WP_004118243.1|161365_162364_-	iron-dicitrate ABC transporter permease FecC	NA	NA	NA	NA	NA
WP_007898890.1|162360_163263_-	Fe(3+) dicitrate ABC transporter substrate-binding protein FecB	NA	NA	NA	NA	NA
WP_022652364.1|163307_165632_-	Fe(3+) dicitrate transport protein FecA	NA	NA	NA	NA	NA
WP_023304425.1|165718_166672_-	fec operon regulator FecR	NA	NA	NA	NA	NA
WP_016151347.1|166668_167190_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_007896426.1|168433_169759_-	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	48.1	6.5e-114
WP_007901308.1|169957_170881_+|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	97.4	1.5e-173
WP_016151369.1|173044_173395_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	65.5	9.6e-41
WP_000227969.1|174934_176011_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP008824	UNVERIFIED_ORG: Enterobacter cloacae ECNIH2 plasmid pKEC-39c, complete sequence	319976	191599	225874	319976	integrase,transposase	Escherichia_phage(35.29%)	32	204196:204210	237968:237982
WP_011191341.1|191599_192874_+|transposase	IS4-like element ISApu2 family transposase	transposase	NA	NA	NA	NA
WP_000122923.1|192887_194615_+	hypothetical protein	NA	A0A0P0ZFY3	Escherichia_phage	32.6	9.9e-14
WP_000268337.1|194601_194880_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000714162.1|194952_195192_+	permease	NA	NA	NA	NA	NA
WP_001337692.1|195411_195813_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000988732.1|195926_196652_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001138073.1|199768_202741_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.1	0.0e+00
WP_001162012.1|202743_203301_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	81.3	5.8e-48
WP_001447826.1|203338_203662_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000845039.1|203606_204620_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
204196:204210	attL	CCATACAGAAGCTGG	NA	NA	NA	NA
WP_000381802.1|204765_205299_+	aminoglycoside nucleotidyltransferase ANT(2'')-Ia	NA	NA	NA	NA	NA
WP_000679427.1|205455_205803_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259032.1|205796_206636_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_031974050.1|206565_206745_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001389365.1|206810_207575_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_001067855.1|207751_208456_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000052512.1|208905_210381_+	ABC-F type ribosomal protection protein Msr(E)	NA	A0A1B0RXA0	Streptococcus_phage	59.0	2.3e-160
WP_000155092.1|210436_211321_+	Mph(E) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_001067855.1|211404_212109_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_004163135.1|211999_212959_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	40.5	1.7e-47
WP_000946487.1|213060_213912_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.1e-11
WP_001993321.1|213841_214021_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000376623.1|214039_214540_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001297012.1|214845_214959_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001375156.1|214971_215178_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|215299_216004_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001553819.1|216912_219810_-|transposase	Tn3-like element Tn5403 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.8	4.2e-182
WP_000509966.1|219904_220510_+	DNA resolvase	NA	A0A1S5Y2X8	uncultured_archaeal_virus	35.3	5.5e-20
WP_004152397.1|220823_222143_+|transposase	IS1182-like element ISKpn6 family transposase	transposase	Q9MBP7	Staphylococcus_prophage	24.2	1.9e-12
WP_004199234.1|222392_223274_-	carbapenem-hydrolyzing class A beta-lactamase KPC-2	NA	A0A1B0VBP7	Salmonella_phage	52.2	2.2e-73
WP_001067855.1|223798_224503_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_007897923.1|224626_225874_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
237968:237982	attR	CCATACAGAAGCTGG	NA	NA	NA	NA
>prophage 4
NZ_CP008824	UNVERIFIED_ORG: Enterobacter cloacae ECNIH2 plasmid pKEC-39c, complete sequence	319976	251027	302552	319976	integrase,transposase	Escherichia_phage(44.0%)	55	291813:291828	304684:304699
WP_040113343.1|251027_251957_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	53.1	1.4e-75
WP_001118645.1|252160_253084_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	93.2	1.0e-166
WP_040113342.1|253290_254088_+	(S)-acetoin forming diacetyl reductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	26.9	5.1e-13
WP_040113332.1|254349_255273_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	92.8	2.3e-166
WP_023205627.1|255416_256808_-	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_040113331.1|257643_258666_-|transposase	IS110-like element IS5708 family transposase	transposase	NA	NA	NA	NA
WP_001067855.1|258828_259533_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_002210516.1|260244_260865_-	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
WP_011117368.1|260857_262123_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.8	4.6e-234
WP_002210514.1|262134_263037_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	100.0	5.3e-160
WP_002210513.1|263297_264059_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_011117369.1|264079_264940_-	class A extended-spectrum beta-lactamase SHV-5	NA	A0A077SL40	Escherichia_phage	99.7	4.4e-156
WP_001620096.1|265237_265498_+	hypothetical protein	NA	A0A077SK33	Escherichia_phage	100.0	1.9e-41
WP_001620097.1|265584_266673_+	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
WP_001067855.1|267645_268350_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_124103214.1|268295_268526_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000845039.1|268491_269505_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_032488579.1|269665_270220_+	aminoglycoside N-acetyltransferase AAC(6')-Ib3	NA	NA	NA	NA	NA
WP_002089484.1|270295_270760_+	AAC(3)-I family aminoglycoside 3-N-acetyltransferase	NA	NA	NA	NA	NA
WP_000679427.1|270965_271313_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|271306_272146_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000050481.1|272550_274092_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_012579084.1|274424_275081_+	quinolone resistance pentapeptide repeat protein QnrA1	NA	NA	NA	NA	NA
WP_000259031.1|275280_276120_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_001993321.1|276049_276229_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000376623.1|276247_276748_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001163403.1|276923_277706_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	35.0	2.5e-33
WP_001324342.1|277695_279219_-|transposase	IS21-like element IS1326 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	24.2	1.2e-15
WP_000344784.1|280936_281797_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_000935451.1|281799_283515_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_000204520.1|283553_284261_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_000993386.1|284257_284494_-	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_001277456.1|284490_284853_-	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_015063453.1|284870_286565_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	8.8e-39
WP_000522996.1|286603_287029_-	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000732275.1|287056_287332_-	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_001294656.1|287347_287713_-	mercuric ion transporter MerT	NA	NA	NA	NA	NA
WP_001166628.1|287784_288240_+	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_000787563.1|289586_289859_+	MafI family immunity protein	NA	NA	NA	NA	NA
WP_000750746.1|289863_290106_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000243483.1|290117_290453_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000791469.1|290619_291072_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000278322.1|291087_291690_-	hypothetical protein	NA	NA	NA	NA	NA
291813:291828	attL	TAATTATGATAATTAC	NA	NA	NA	NA
WP_000243801.1|291912_292233_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000932880.1|292251_292539_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000949433.1|292531_293068_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000543934.1|293070_294081_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0K0N6I5	Gordonia_phage	31.9	3.1e-07
WP_044489169.1|294085_294715_+	3'-5' exonuclease	NA	A2I2Z6	Vibrio_virus	43.3	4.1e-18
WP_011787801.1|295166_296657_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	82.2	8.6e-224
WP_011787802.1|296691_297546_+	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	48.6	1.3e-67
WP_011787803.1|297636_297969_+	conjugal transfer protein TraR	NA	NA	NA	NA	NA
WP_011787804.1|298086_298707_-	recombinase family protein	NA	E5FFF9	Burkholderia_phage	37.1	1.1e-26
WP_011787805.1|298876_299137_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_011918375.1|299136_299448_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_011787830.1|299471_302552_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	30.6	8.2e-51
304684:304699	attR	TAATTATGATAATTAC	NA	NA	NA	NA
>prophage 1
NZ_CP008825	UNVERIFIED_ORG: Enterobacter cloacae ECNIH2 plasmid pKPC-272, complete sequence	282439	7094	64576	282439	integrase,transposase	Escherichia_phage(62.5%)	47	NA	NA
WP_001118616.1|7094_8018_-|transposase	IS5-like element IS903B family transposase	transposase	Q9MCT5	Escherichia_phage	99.3	1.1e-176
WP_086013480.1|8218_9052_+	DsbC family protein	NA	NA	NA	NA	NA
WP_001022588.1|9061_10012_+	TraV family lipoprotein	NA	NA	NA	NA	NA
WP_000387412.1|10020_12702_+	TraC family protein	NA	NA	NA	NA	NA
WP_001050364.1|16540_17794_+	ParA family protein	NA	NA	NA	NA	NA
WP_001278838.1|17790_18795_+	peptide transporter	NA	A0A1I9KFW9	Aeromonas_phage	33.8	2.7e-11
WP_000815011.1|18856_19246_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000598517.1|19242_19764_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000700976.1|19756_20593_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000718595.1|20589_21537_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000818954.1|21900_22938_+	hypothetical protein	NA	A0A0A7NPX4	Enterobacteria_phage	35.0	3.6e-43
WP_001118616.1|23447_24371_-|transposase	IS5-like element IS903B family transposase	transposase	Q9MCT5	Escherichia_phage	99.3	1.1e-176
WP_001118620.1|24710_25634_-|transposase	IS5-like element IS903B family transposase	transposase	Q9MCT5	Escherichia_phage	99.7	8.4e-177
WP_000952689.1|26122_26575_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000836981.1|26564_26990_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000235773.1|26998_27553_+	plasmid transfer protein	NA	NA	NA	NA	NA
WP_001232109.1|27672_31977_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001286760.1|32254_32767_+	signal peptidase I	NA	NA	NA	NA	NA
WP_001256132.1|32753_34265_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072102646.1|34454_35465_+	plasmid transfer protein	NA	NA	NA	NA	NA
WP_000776701.1|35483_38672_+	conjugal transfer protein TraN	NA	NA	NA	NA	NA
WP_000771834.1|38700_39573_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000517885.1|39752_41537_+	ATP-dependent helicase	NA	G3MA40	Bacillus_virus	23.1	6.0e-22
WP_044489211.1|41931_42804_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000120822.1|42861_43239_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000810361.1|43299_44277_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032634629.1|45231_46155_-|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	99.7	1.1e-176
WP_000174396.1|46827_47955_+	DUF3150 domain-containing protein	NA	NA	NA	NA	NA
WP_000762700.1|48031_50038_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_044489214.1|50110_50290_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007901308.1|50345_51269_-|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	97.4	1.5e-173
WP_000220379.1|51511_52744_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001011130.1|53013_53535_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000762003.1|53613_54492_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000691119.1|54561_55497_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000991697.1|55565_56486_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000472041.1|56552_57491_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000149830.1|57662_58619_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001004200.1|58882_59158_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000578891.1|59202_59793_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001371933.1|59800_60058_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044489218.1|60131_60668_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000549069.1|60684_61131_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001804700.1|61203_62184_+	DNA replication protein	NA	NA	NA	NA	NA
WP_001198595.1|62193_63099_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001805195.1|63034_63379_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000795949.1|63400_64576_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
>prophage 2
NZ_CP008825	UNVERIFIED_ORG: Enterobacter cloacae ECNIH2 plasmid pKPC-272, complete sequence	282439	75916	179992	282439	integrase,protease,transposase	Escherichia_phage(21.62%)	116	102439:102458	142428:143247
WP_001585166.1|75916_76996_-|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	34.1	2.8e-38
WP_001040058.1|76997_77771_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001280115.1|77763_78906_-	hypothetical protein	NA	A0A172Q0Y1	Acinetobacter_phage	34.5	6.5e-30
WP_012695441.1|78915_79974_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000254137.1|80294_80876_+	tellurium resistance-associated protein TerZ	NA	K4JRX3	Caulobacter_phage	30.0	6.3e-13
WP_001054786.1|80875_82033_+	tellurium resistance protein TerA	NA	NA	NA	NA	NA
WP_000007449.1|82055_82511_+	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_000255079.1|82533_83574_+	tellurium resistance membrane protein TerC	NA	K7QKE8	Escherichia_phage	48.0	2.2e-77
WP_000116680.1|83622_84201_+	tellurium resistance membrane protein TerD	NA	A0A2P1N0L4	Streptomyces_phage	40.0	2.5e-06
WP_000301247.1|84269_84845_+	tellurium resistance protein TerE	NA	K4JRX3	Caulobacter_phage	41.6	8.7e-31
WP_001053340.1|85273_86515_+	tellurium resistance protein TerF	NA	NA	NA	NA	NA
WP_000374058.1|86605_87061_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000398479.1|87301_87493_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001151572.1|87584_87926_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000880375.1|88912_89167_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000166877.1|89169_91209_-	ATP-dependent helicase	NA	E3T5J8	Cafeteria_roenbergensis_virus	25.3	1.7e-25
WP_000211823.1|91205_92192_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000341066.1|93112_93505_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012695443.1|93483_93795_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000462754.1|94163_94820_+|protease	trypsin-like serine protease	protease	NA	NA	NA	NA
WP_123906519.1|94859_95042_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000340139.1|95022_95520_+	membrane protein	NA	NA	NA	NA	NA
WP_012695445.1|95524_96913_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012477377.1|97313_97607_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000088044.1|97611_98937_+	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
WP_000134171.1|98997_99204_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000985909.1|99304_99715_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001805097.1|99727_100252_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000427623.1|100433_101438_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_000405672.1|101528_101963_-	Cd(II)/Pb(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_001287661.1|102048_104454_+	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	46.1	1.0e-141
102439:102458	attL	GTTGCTGATCTCGATTTCAA	NA	NA	NA	NA
WP_000118563.1|104450_105527_+	signal peptidase II	NA	NA	NA	NA	NA
102439:102458	attL	GTTGCTGATCTCGATTTCAA	NA	NA	NA	NA
WP_000993245.1|105535_105748_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_001446012.1|105710_105830_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001087807.1|105813_106050_-	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_001277466.1|106046_106412_-	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_000209297.1|106429_108115_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	29.1	1.8e-39
WP_000522996.1|108153_108579_-	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000732275.1|108606_108882_-	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_001294656.1|108897_109263_-	mercuric ion transporter MerT	NA	NA	NA	NA	NA
WP_001166628.1|109334_109790_+	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_000278471.1|110467_110893_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001224686.1|111441_111750_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000784387.1|111765_112623_+	HNH endonuclease	NA	G0X580	Salmonella_phage	34.2	3.9e-11
WP_001194554.1|112684_112888_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001287391.1|113229_113634_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_001100635.1|113811_114105_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000175475.1|114130_114367_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000916941.1|114407_114863_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000490638.1|114922_115588_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001371925.1|115645_116026_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000027057.1|116355_117216_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001217881.1|117398_117956_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	98.4	2.0e-93
WP_004152391.1|119069_120785_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_004152392.1|120894_123924_+|transposase	IS3-like element Tn4401 family transposase	transposase	NA	NA	NA	NA
123677:123696	attR	TTGAAATCGAGATCAGCAAC	NA	NA	NA	NA
WP_004199214.1|124030_125056_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	50.3	1.4e-87
123677:123696	attR	TTGAAATCGAGATCAGCAAC	NA	NA	NA	NA
WP_004152394.1|125052_125832_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	61.8	2.5e-89
WP_004152396.1|126218_127100_+	carbapenem-hydrolyzing class A beta-lactamase KPC-3	NA	A0A1B0VBP7	Salmonella_phage	52.2	2.8e-73
WP_004152397.1|127349_128669_-|transposase	IS1182-like element ISKpn6 family transposase	transposase	Q9MBP7	Staphylococcus_prophage	24.2	1.9e-12
WP_001067855.1|135147_135852_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_011191340.1|136110_136359_+	type II toxin-antitoxin system YafQ family toxin	NA	NA	NA	NA	NA
WP_001173919.1|136485_137061_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	52.7	5.6e-46
WP_122997120.1|137159_137435_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_000845048.1|137403_138417_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_000381802.1|138562_139096_+	aminoglycoside nucleotidyltransferase ANT(2'')-Ia	NA	NA	NA	NA	NA
WP_000186237.1|139178_139811_+	type B-3 chloramphenicol O-acetyltransferase CatB3	NA	A0A2R8FE91	Brazilian_cedratvirus	41.2	4.1e-26
WP_000679427.1|139967_140315_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|140308_141148_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_001993321.1|141077_141257_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000376623.1|141275_141776_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001297012.1|142081_142195_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|142479_143184_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001572372.1|143349_143826_-	WbuC family cupin fold metalloprotein	NA	NA	NA	NA	NA
WP_001572373.1|143902_145522_-	phosphoethanolamine--lipid A transferase MCR-9.1	NA	NA	NA	NA	NA
WP_001572374.1|145710_146634_-|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	99.3	2.4e-176
WP_004248839.1|146717_148064_+	copper resistance membrane spanning protein PcoS	NA	W8CYF6	Bacillus_phage	26.6	8.8e-18
WP_000723070.1|148281_148716_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001572377.1|148973_150089_-	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
WP_000019951.1|150211_150484_+	Ni(II)/Co(II)-binding transcriptional repressor RcnR	NA	NA	NA	NA	NA
WP_000193207.1|150949_151768_+	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_001371952.1|151764_152970_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000121164.1|153033_153237_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000078513.1|153249_154569_-	DUF1173 family protein	NA	NA	NA	NA	NA
WP_000833380.1|154819_156247_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	52.3	3.4e-100
WP_000464825.1|156461_156977_+	thermonuclease family protein	NA	A0A1X6WF84	Pacmanvirus	38.6	2.1e-07
WP_000975181.1|156979_157876_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001005009.1|157923_158238_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000637193.1|158311_158569_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001371948.1|158627_158861_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001046767.1|158906_159161_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000443289.1|159198_159486_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001371914.1|159555_159753_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000864986.1|159893_160169_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000927306.1|160660_162139_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	74.4	7.3e-199
WP_001066652.1|162157_162985_+	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	37.2	4.9e-43
WP_000065802.1|163044_163470_-	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	1.6e-50
WP_000922628.1|163482_164772_-	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	71.4	9.9e-168
WP_000941305.1|164817_165138_-	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	53.7	1.7e-20
WP_000130816.1|165224_165929_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	72.9	8.8e-86
WP_000125668.1|165961_167365_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_012695466.1|167584_168508_-|transposase	IS5-like element IS903B family transposase	transposase	Q1MVF0	Enterobacteria_phage	98.7	4.6e-175
WP_012695467.1|168574_169159_-	MFS transporter	NA	NA	NA	NA	NA
WP_021243026.1|169236_170394_-	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_012695469.1|170587_171481_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012695470.1|171617_172433_-	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	98.2	7.4e-161
WP_001118616.1|172593_173517_-|transposase	IS5-like element IS903B family transposase	transposase	Q9MCT5	Escherichia_phage	99.3	1.1e-176
WP_077257931.1|173563_173986_-	hypothetical protein	NA	A0A1B0VFY5	Salmonella_phage	97.6	6.7e-65
WP_001567369.1|174039_174672_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001567368.1|174700_176104_-|transposase	ISNCY-like element ISKpn21 family transposase	transposase	NA	NA	NA	NA
WP_044489247.1|176317_176635_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001100610.1|176657_176963_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000285959.1|177007_177679_+	trypsin-like peptidase domain-containing protein	NA	NA	NA	NA	NA
WP_001371904.1|178136_178544_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000900745.1|178594_178912_-	hypothetical protein	NA	NA	NA	NA	NA
WP_122966916.1|178880_179096_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100185530.1|179077_179992_-|transposase	IS5 family transposase	transposase	A0A077SK28	Escherichia_phage	98.4	3.6e-172
>prophage 3
NZ_CP008825	UNVERIFIED_ORG: Enterobacter cloacae ECNIH2 plasmid pKPC-272, complete sequence	282439	223147	271562	282439	transposase	Escherichia_phage(35.71%)	55	NA	NA
WP_000219087.1|223147_224386_-|transposase	IS110 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	23.1	2.5e-11
WP_000589001.1|224807_226148_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_000137794.1|226578_227184_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000703842.1|227400_227682_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000633161.1|228057_228369_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000814953.1|228591_228792_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000551490.1|228831_229056_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000781547.1|229110_229314_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024143014.1|229493_229787_-	hypothetical protein	NA	I7B2L9	Escherichia_phage	38.6	4.1e-05
WP_001371932.1|229866_230358_-	DUF3085 domain-containing protein	NA	NA	NA	NA	NA
WP_001165367.1|230362_230674_-	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_000071366.1|231190_231511_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001371935.1|231689_231920_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000252081.1|232091_232985_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032666269.1|232974_234087_-	toxic anion resistance protein	NA	NA	NA	NA	NA
WP_001371906.1|234083_234869_-	toxic anion resistance protein TelA	NA	NA	NA	NA	NA
WP_000280723.1|235463_236072_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000241452.1|236185_236719_-	HNH endonuclease	NA	E7EKU5	Edwardsiella_phage	65.2	6.8e-46
WP_000159617.1|236773_236968_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000172888.1|236964_237276_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001180999.1|237338_237578_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000140246.1|239393_239723_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044489265.1|239839_240817_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	96.7	3.3e-171
WP_001118616.1|240813_241737_-|transposase	IS5-like element IS903B family transposase	transposase	Q9MCT5	Escherichia_phage	99.3	1.1e-176
WP_022646497.1|241875_242076_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000774871.1|242126_242918_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001052325.1|243147_243405_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000556022.1|243470_243797_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000834113.1|244039_244360_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000104393.1|244654_245905_-	site-specific DNA-methyltransferase	NA	NA	NA	NA	NA
WP_000833775.1|246075_246684_-	hypothetical protein	NA	K4JV11	Caulobacter_phage	38.5	4.4e-25
WP_001290639.1|246839_247097_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000069824.1|247161_247590_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000645320.1|247681_248059_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011152995.1|248464_249646_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000581857.1|249654_249951_-	toxin-plasmid maintenance system killer protein	NA	A0A222YWE2	Escherichia_phage	35.1	3.2e-05
WP_000170639.1|250000_250471_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012695481.1|250904_253322_-	DUF4165 domain-containing protein	NA	NA	NA	NA	NA
WP_000115760.1|253696_253948_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001107529.1|253980_254169_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001139014.1|254155_254413_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001251242.1|254405_254837_-	hypothetical protein	NA	A0A1V0E5M6	Salmonella_phage	49.6	4.2e-22
WP_000803858.1|254940_255465_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000277498.1|255787_256552_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001447802.1|256632_257394_+	methyltransferase	NA	A0A2I7RNS1	Vibrio_phage	32.9	1.2e-19
WP_000149862.1|257487_257751_+	hypothetical protein	NA	M9UXL5	Escherichia_phage	46.5	3.2e-09
WP_000491820.1|257794_258382_+	hypothetical protein	NA	A0A248SKW5	Klebsiella_phage	71.1	1.1e-09
WP_085949497.1|258875_260022_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	92.6	2.3e-147
WP_000681217.1|260078_262499_+	DUF4165 domain-containing protein	NA	NA	NA	NA	NA
WP_001371941.1|263524_264181_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031275323.1|264576_265632_-	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	50.9	2.1e-83
WP_001232713.1|266772_269229_-	DUF4165 domain-containing protein	NA	NA	NA	NA	NA
WP_000966518.1|269601_270228_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000535423.1|270285_270567_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001118616.1|270638_271562_-|transposase	IS5-like element IS903B family transposase	transposase	Q9MCT5	Escherichia_phage	99.3	1.1e-176
