The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_HF545616	Ruminococcus bicirculans strain 80/3 chromosome I	2240877	294206	303195	2240877		Streptococcus_phage(33.33%)	11	NA	NA
WP_051706256.1|294206_295304_-	helix-turn-helix transcriptional regulator	NA	A0A139ZPI6	Marinitoga_camini_virus	43.5	9.8e-07
WP_038670477.1|295436_295709_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038672891.1|295718_296525_-	DNA adenine methylase	NA	A0A2H4IYF4	uncultured_Caudovirales_phage	46.1	5.8e-57
WP_022288247.1|296650_296848_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158455038.1|296828_296969_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038670479.1|296969_297206_-	hypothetical protein	NA	A0A127AWS3	Bacillus_phage	52.5	3.6e-07
WP_038670481.1|297205_297967_-	phage antirepressor KilAC domain-containing protein	NA	A6XMM0	Bacillus_virus	41.8	1.9e-41
WP_038670483.1|297959_299231_-	DNA (cytosine-5-)-methyltransferase	NA	E4ZFL5	Streptococcus_phage	38.3	4.5e-80
WP_038670485.1|299289_299595_-	DUF4314 domain-containing protein	NA	NA	NA	NA	NA
WP_038670487.1|300038_301547_-	LlaJI family restriction endonuclease	NA	NA	NA	NA	NA
WP_051706258.1|301566_303195_-	AAA family ATPase	NA	M1NSM1	Streptococcus_phage	34.4	5.7e-35
>prophage 2
NZ_HF545616	Ruminococcus bicirculans strain 80/3 chromosome I	2240877	366437	408971	2240877	integrase,protease,transposase	Paenibacillus_phage(28.57%)	33	371338:371360	409136:409158
WP_038670563.1|366437_367022_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	NA	NA	NA	NA
WP_038670565.1|366969_368298_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	H6X3M6	Enterobacteria_phage	32.4	1.1e-41
WP_158455041.1|368300_368462_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038670567.1|368755_369817_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051706274.1|370279_371257_+	RNA-directed DNA polymerase	NA	NA	NA	NA	NA
371338:371360	attL	TGGTGACCCGTACGGGAATTGAA	NA	NA	NA	NA
WP_022127451.1|371902_372631_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022127450.1|372632_373268_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	34.4	1.2e-33
WP_022127449.1|373278_374034_-	DUF2705 family protein	NA	NA	NA	NA	NA
WP_022127448.1|374045_374936_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022127447.1|375005_375410_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022127446.1|375578_376004_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022127445.1|376099_376777_-	DUF4367 domain-containing protein	NA	NA	NA	NA	NA
WP_022127444.1|376769_377303_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_158455044.1|377328_378054_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022126623.1|378705_379638_-|integrase	site-specific integrase	integrase	A8ATM2	Listeria_phage	47.9	5.1e-81
WP_081855907.1|379698_380271_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_081855908.1|383554_384112_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_051706279.1|386735_387347_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_022286572.1|388149_388887_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_038670579.1|388883_390035_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038670581.1|390625_392443_+	DUF927 domain-containing protein	NA	NA	NA	NA	NA
WP_038670583.1|392919_393105_+	excisionase family DNA-binding protein	NA	NA	NA	NA	NA
WP_081855909.1|393227_394502_+|integrase	site-specific integrase	integrase	A0A0K2CZ62	Paenibacillus_phage	27.4	3.1e-36
WP_038670586.1|394916_395333_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038670588.1|395377_396886_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_038670590.1|397165_398356_+|transposase	IS110 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	42.2	1.3e-84
WP_038670592.1|398571_400062_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051706282.1|400070_402593_-	SAM-dependent DNA methyltransferase	NA	A0A1V0SLK8	Klosneuvirus	24.7	7.7e-15
WP_038670594.1|402791_403499_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_038670596.1|403696_405142_+	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_038670598.1|405279_405462_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051706287.1|407181_407487_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_081855910.1|407699_408971_+|integrase	site-specific integrase	integrase	A0A0K2CZ62	Paenibacillus_phage	30.3	1.9e-38
409136:409158	attR	TGGTGACCCGTACGGGAATTGAA	NA	NA	NA	NA
>prophage 3
NZ_HF545616	Ruminococcus bicirculans strain 80/3 chromosome I	2240877	1102925	1110221	2240877	protease,tRNA	Streptococcus_phage(16.67%)	7	NA	NA
WP_038671492.1|1102925_1104287_+	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	42.0	9.7e-89
WP_051706470.1|1104276_1105605_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	A0A0U2S5Z2	Escherichia_phage	31.9	7.2e-12
WP_038671494.1|1105704_1106229_+	hypoxanthine phosphoribosyltransferase	NA	A0A2K9L634	Tupanvirus	25.3	3.8e-09
WP_051706472.1|1106267_1108208_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	C7U047	Ostreococcus_tauri_virus	43.6	2.3e-107
WP_038671496.1|1108326_1109094_+	TIGR00282 family metallophosphoesterase	NA	NA	NA	NA	NA
WP_022287824.1|1109201_1109462_+	stage V sporulation protein S	NA	J9PTX7	Bacillus_phage	40.5	4.6e-08
WP_022287825.1|1109522_1110221_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	22.7	1.1e-16
>prophage 1
NZ_HF545617	Ruminococcus bicirculans strain 80/3 chromosome II	727623	79377	88355	727623		Synechococcus_phage(28.57%)	10	NA	NA
WP_041337193.1|79377_80559_-	phosphoribosylaminoimidazolecarboxamide formyltransferase	NA	Q58MG4	Prochlorococcus_phage	26.0	7.7e-26
WP_041337194.1|80590_81124_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022287352.1|81139_81637_-	zinc ribbon domain protein	NA	NA	NA	NA	NA
WP_041337195.1|81669_82386_-	IMP cyclohydrolase	NA	NA	NA	NA	NA
WP_041337196.1|82408_83041_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	32.5	6.4e-19
WP_022287349.1|83053_84094_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	42.2	1.3e-64
WP_041337197.1|84116_85541_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	34.2	4.6e-57
WP_041337198.1|85546_86968_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	27.4	6.5e-11
WP_041337668.1|86973_87681_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A1D7SCX8	Cyanophage	43.7	4.9e-44
WP_041337200.1|87857_88355_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	43.4	7.5e-23
>prophage 2
NZ_HF545617	Ruminococcus bicirculans strain 80/3 chromosome II	727623	442137	468799	727623	transposase,portal,terminase	Lactococcus_phage(25.0%)	23	NA	NA
WP_041337418.1|442137_443070_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_022287545.1|443282_443537_+	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_041337419.1|443607_445719_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	36.0	1.2e-74
WP_022287542.1|446006_448418_-	glycogen/starch/alpha-glucan phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	36.6	7.4e-07
WP_051707013.1|448989_449865_-	DUF368 domain-containing protein	NA	NA	NA	NA	NA
WP_148303620.1|449910_450804_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041337421.1|450898_451999_-	peptidoglycan bridge formation glycyltransferase FemA/FemB family protein	NA	NA	NA	NA	NA
WP_038671142.1|452230_453163_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_041337749.1|453561_455094_-	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_051706931.1|455518_455983_+|terminase	terminase small subunit	terminase	NA	NA	NA	NA
WP_041337422.1|455979_457224_+|terminase	PBSX family phage terminase large subunit	terminase	E5DV50	Deep-sea_thermophilic_phage	50.1	3.2e-115
WP_041337423.1|457257_458424_+|portal	phage portal protein	portal	NA	NA	NA	NA
WP_041337424.1|458420_459257_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041337426.1|459487_460462_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041337427.1|460524_460905_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022287531.1|460920_461343_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041337428.1|461335_461680_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041337429.1|461679_462588_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022287528.1|462661_463543_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_041337430.1|463549_464479_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_041337431.1|464573_466088_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022287525.1|466166_467177_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	29.5	2.8e-24
WP_038671142.1|467866_468799_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_HF545617	Ruminococcus bicirculans strain 80/3 chromosome II	727623	595581	609151	727623	portal,capsid	Streptococcus_phage(25.0%)	16	NA	NA
WP_041337524.1|595581_598545_-	hypothetical protein	NA	A0A1X9I6B4	Streptococcus_phage	50.6	4.9e-53
WP_158455163.1|598621_599299_+	zinc ribbon domain-containing protein	NA	A0A0A8WFW4	Clostridium_phage	36.0	2.1e-20
WP_041337525.1|599331_599889_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041337526.1|599885_600380_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041337527.1|600423_600927_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041337528.1|600927_601359_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081856069.1|601342_601714_-	hypothetical protein	NA	A0A0A8WIK8	Clostridium_phage	39.7	2.1e-17
WP_041337529.1|601710_602037_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041337530.1|602037_602358_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041337531.1|602361_602598_-	Rho termination factor N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_041337532.1|602609_603497_-	hypothetical protein	NA	A0A1S5SA65	Streptococcus_phage	32.5	1.4e-27
WP_041337533.1|603517_604054_-	phage scaffolding protein	NA	Q20DD5	Lactobacillus_phage	32.5	1.4e-11
WP_041337534.1|604375_604636_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051706956.1|604647_606318_-|capsid	phage minor capsid protein	capsid	A0A2K9V3K1	Faecalibacterium_phage	36.5	1.5e-59
WP_041337535.1|606317_607778_-	hypothetical protein	NA	H7BVR3	unidentified_phage	25.1	2.5e-10
WP_041337536.1|607774_609151_-|portal	phage portal protein	portal	A0A1J1J8Z1	Escherichia_phage	50.1	3.4e-126
