The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP004870	Bacillus thuringiensis serovar kurstaki str. HD-1, complete genome	5631672	228662	314563	5631672	protease,terminase,transposase,capsid,head,integrase,holin,tRNA,portal,tail	Bacillus_phage(54.17%)	93	256853:256871	322709:322727
WP_155269682.1|228662_230005_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	37.3	6.3e-32
WP_042969332.1|230112_230985_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_025988984.1|231417_231534_+	DUF3948 family protein	NA	NA	NA	NA	NA
WP_080711269.1|231568_231685_+	DUF3948 family protein	NA	NA	NA	NA	NA
WP_080711270.1|231719_231836_+	DUF3948 family protein	NA	NA	NA	NA	NA
WP_155269683.1|231870_231987_+	DUF3948 family protein	NA	NA	NA	NA	NA
WP_080711271.1|232021_232138_+	DUF3948 family protein	NA	NA	NA	NA	NA
WP_001083690.1|232181_232292_+	DUF3948 family protein	NA	NA	NA	NA	NA
WP_000810922.1|232685_233804_+	4-hydroxyphenylpyruvate dioxygenase	NA	NA	NA	NA	NA
WP_000674006.1|233870_234827_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_013141710.1|234792_235965_+	homogentisate 1,2-dioxygenase	NA	NA	NA	NA	NA
WP_000809349.1|236197_237613_+	amino acid permease	NA	NA	NA	NA	NA
WP_000799726.1|237720_238992_+	MFS transporter	NA	A0A2H4PQR6	Staphylococcus_phage	24.9	7.8e-16
WP_000161427.1|239220_240306_+	D-alanine--D-alanine ligase B	NA	NA	NA	NA	NA
WP_000595961.1|240368_241745_+	UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D- alanine ligase	NA	NA	NA	NA	NA
WP_000961167.1|243722_244685_+	UV DNA damage repair endonuclease UvsE	NA	NA	NA	NA	NA
WP_000908522.1|244677_245250_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_000583417.1|245343_245703_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_002100659.1|245859_246810_+	outer membrane lipoprotein carrier protein LolA	NA	NA	NA	NA	NA
WP_000390616.1|246927_248097_+	alanine racemase	NA	NA	NA	NA	NA
WP_000004570.1|248405_248693_+	antitoxin EndoAI	NA	NA	NA	NA	NA
WP_042969335.1|248697_249048_+	type II toxin-antitoxin system endoribonuclease NdoA	NA	A0A2P0ZKX3	Lactobacillus_phage	37.7	3.8e-13
WP_042969336.1|249115_251284_+	RNA-binding transcriptional accessory protein	NA	NA	NA	NA	NA
WP_001143642.1|251342_251459_-	cortex morphogenetic protein CmpA	NA	NA	NA	NA	NA
WP_000344239.1|251654_252113_+	SprT family protein	NA	NA	NA	NA	NA
256853:256871	attL	CGAGGAGAGAATCCTAAGG	NA	NA	NA	NA
WP_000049649.1|258606_259080_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_000865756.1|259060_259753_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_000367190.1|259766_260210_+	ribosomal-protein-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_042969337.1|260209_261226_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	43.1	1.6e-67
WP_001987845.1|261711_263691_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	29.9	2.8e-52
WP_000372699.1|263824_264454_+	redox-sensing transcriptional repressor Rex	NA	NA	NA	NA	NA
WP_001246200.1|264483_264675_-	YdiK family protein	NA	NA	NA	NA	NA
WP_000745326.1|264671_265421_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000917311.1|265812_266097_+	co-chaperone GroES	NA	A0A221S3C8	uncultured_virus	54.8	1.2e-20
WP_001029993.1|266135_267770_+	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	58.0	1.5e-157
WP_042969339.1|267848_269027_-|integrase	site-specific integrase	integrase	S6C485	Thermus_phage	62.4	3.7e-137
WP_016090298.1|269075_269660_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016090297.1|269882_270152_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016090295.1|270454_270781_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042969341.1|270882_273312_+	DUF927 domain-containing protein	NA	Q4ZE73	Staphylococcus_phage	32.6	2.2e-83
WP_016090293.1|273643_273871_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016090291.1|274024_275221_+|portal	phage portal protein	portal	A0A1L2BY94	Clostridium_phage	35.9	5.0e-65
WP_016090290.1|275217_275796_+|head,protease	HK97 family phage prohead protease	head,protease	Q8SBP9	Clostridium_phage	30.2	2.6e-11
WP_016090289.1|275800_277063_+|capsid	phage major capsid protein	capsid	NA	NA	NA	NA
WP_016090288.1|277129_277417_+|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
WP_016090287.1|277409_277700_+	HNH endonuclease	NA	R9TNN2	Paenibacillus_phage	53.2	1.6e-25
WP_016090286.1|277826_278174_+	hypothetical protein	NA	A0A290GJQ7	Caldibacillus_phage	43.9	3.9e-18
WP_044157420.1|278226_279819_+|terminase	terminase large subunit	terminase	A0A290GJW3	Caldibacillus_phage	52.6	2.8e-156
WP_016090284.1|279835_280165_+|head	phage head closure protein	head	NA	NA	NA	NA
WP_016090283.1|280177_280387_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155269684.1|281106_282645_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	31.7	8.8e-22
WP_001123356.1|282710_283778_-|integrase	site-specific integrase	integrase	A0A0S2MV79	Bacillus_phage	99.7	3.3e-201
WP_000654304.1|283804_284245_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A0S2MV59	Bacillus_phage	97.9	6.5e-79
WP_000435973.1|284258_284738_-	helix-turn-helix transcriptional regulator	NA	A0A0S2MVI1	Bacillus_phage	99.4	6.9e-82
WP_001042666.1|284923_285178_+	DUF739 family protein	NA	A0A0S2MVA3	Bacillus_phage	98.8	5.5e-38
WP_000383685.1|285191_285380_+	hypothetical protein	NA	A0A0S2MV91	Bacillus_phage	100.0	4.5e-29
WP_042969345.1|285605_286421_+	antirepressor	NA	A0A0S2MV65	Bacillus_phage	81.2	6.8e-122
WP_000665325.1|286433_286631_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000235015.1|287870_288746_+	ATP-binding protein	NA	Q2I8C8	Bacillus_phage	47.2	4.3e-66
WP_000337986.1|288761_288956_+	hypothetical protein	NA	A0A0U3K3J8	Bacillus_phage	76.6	1.0e-20
WP_000805170.1|288981_289155_+	DUF3954 domain-containing protein	NA	A0A1B1P7U5	Bacillus_phage	91.2	2.6e-23
WP_000811696.1|289169_289424_+	hypothetical protein	NA	A0A1B0T6B9	Bacillus_phage	88.1	1.4e-36
WP_038413245.1|289432_289897_+	hypothetical protein	NA	A0A2H4J8I5	uncultured_Caudovirales_phage	35.4	5.7e-17
WP_000665841.1|289923_290136_+	hypothetical protein	NA	A0A1B0T6B5	Bacillus_phage	93.5	1.5e-25
WP_002134037.1|290180_290366_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000387671.1|290417_290816_+	hypothetical protein	NA	A0A068ELY9	Bacillus_phage	79.1	2.8e-57
WP_000805074.1|290840_291263_+	hypothetical protein	NA	A0A1B1P7B4	Bacillus_phage	82.9	2.3e-65
WP_000397931.1|291438_291705_+	hypothetical protein	NA	D2XR50	Bacillus_phage	42.7	2.2e-13
WP_000404182.1|291742_292141_+	hypothetical protein	NA	W8CYU3	Bacillus_phage	75.0	1.2e-52
WP_000365653.1|292427_292646_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000234108.1|292832_293015_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001202682.1|293265_293469_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000525861.1|293513_293795_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049866900.1|293910_294255_+	hypothetical protein	NA	A0A0S2GLJ9	Bacillus_phage	91.7	6.1e-24
WP_001012113.1|294254_294797_+|integrase	site-specific integrase	integrase	W8CYP1	Bacillus_phage	92.2	1.3e-89
WP_000124642.1|295472_295733_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000336221.1|295874_296279_+	hypothetical protein	NA	Q2I8B8	Bacillus_phage	75.0	2.7e-47
WP_038413249.1|296275_296611_+	HNH endonuclease	NA	D2XR61	Bacillus_phage	91.0	6.8e-52
WP_038413251.1|296761_297097_+	hypothetical protein	NA	A0A1B1P762	Bacillus_phage	31.5	2.3e-07
WP_000615714.1|297093_298752_+|terminase	terminase large subunit	terminase	A0A2H4JHE9	uncultured_Caudovirales_phage	79.3	1.0e-257
WP_044157418.1|298817_299924_+|portal	phage portal protein	portal	A0A2H4JAJ1	uncultured_Caudovirales_phage	89.9	2.4e-186
WP_038413253.1|299907_300684_+|protease	Clp protease ClpP	protease	A0A0A7RWX3	Clostridium_phage	57.7	4.3e-57
WP_038413255.1|300704_301868_+	hypothetical protein	NA	A0A2H4JH29	uncultured_Caudovirales_phage	96.1	1.6e-209
WP_001243199.1|301880_302177_+	hypothetical protein	NA	A0A2H4JF26	uncultured_Caudovirales_phage	87.8	1.6e-41
WP_000818829.1|302540_302978_+	hypothetical protein	NA	A0A2H4JBV5	uncultured_Caudovirales_phage	93.1	7.4e-75
WP_038413259.1|307810_308176_+	hypothetical protein	NA	A0A0S2MVE0	Bacillus_phage	55.7	5.0e-32
WP_038413261.1|308302_308527_+	hypothetical protein	NA	A0A1B1P780	Bacillus_phage	86.5	1.2e-25
WP_038413263.1|308602_309028_+|holin	phage holin family protein	holin	A0A1B1P787	Bacillus_phage	94.3	1.0e-68
WP_000403436.1|309027_309966_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A0S2MV84	Bacillus_phage	94.7	3.3e-136
WP_080703592.1|310417_311668_+|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	41.6	3.0e-68
WP_000956437.1|312671_312938_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002134199.1|312953_313145_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000741567.1|313486_314563_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	86.6	1.2e-171
322709:322727	attR	CCTTAGGATTCTCTCCTCG	NA	NA	NA	NA
>prophage 2
NZ_CP004870	Bacillus thuringiensis serovar kurstaki str. HD-1, complete genome	5631672	396866	497905	5631672	protease,terminase,transposase,capsid,head,integrase,tRNA,portal,tail	Bacillus_phage(50.0%)	105	414578:414606	448892:448920
WP_000086999.1|396866_397157_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_000051441.1|397172_398630_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_001047685.1|398644_400072_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_000977679.1|400629_401535_+	diacylglycerol kinase	NA	A0A1V0SBJ0	Catovirus	30.8	4.1e-27
WP_000416667.1|401674_402418_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_000890399.1|402497_403937_+	4-aminobutyrate--2-oxoglutarate transaminase	NA	NA	NA	NA	NA
WP_042969370.1|404052_405420_+	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_042969372.1|405412_406864_+	NADP-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000263262.1|406911_407235_+	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_003283018.1|407351_407858_+	DUF4352 domain-containing protein	NA	NA	NA	NA	NA
WP_000007357.1|407903_409133_-	aminopeptidase	NA	NA	NA	NA	NA
WP_001233712.1|409249_410332_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_000875595.1|410868_411576_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001200489.1|411622_412819_-	NupC family nucleoside transporter	NA	NA	NA	NA	NA
WP_000105033.1|413244_414624_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	46.7	3.8e-117
414578:414606	attL	ATACGACTCATGTGGAGTGTGTGGCTTGG	NA	NA	NA	NA
WP_000679465.1|414682_415807_-|integrase	site-specific integrase	integrase	A0A1B0T6A8	Bacillus_phage	98.1	2.0e-212
WP_000703672.1|415965_416829_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000838797.1|417390_418530_+	hypothetical protein	NA	H0UST6	Bacillus_phage	58.6	1.6e-124
WP_000172107.1|419043_419397_-	helix-turn-helix transcriptional regulator	NA	A0A1B0T6A7	Bacillus_phage	85.5	9.6e-49
WP_000022043.1|419618_419861_+	helix-turn-helix transcriptional regulator	NA	A0A1B0T6B2	Bacillus_phage	83.3	1.1e-24
WP_001246222.1|419857_420208_+	helix-turn-helix domain-containing protein	NA	A0A1B0T6C2	Bacillus_phage	87.1	7.5e-54
WP_000969632.1|420204_420372_+	hypothetical protein	NA	A0A0U3B230	Bacillus_phage	79.6	6.0e-17
WP_000190244.1|420582_421323_+	DnaD domain protein	NA	A0A1B0T6C0	Bacillus_phage	82.5	2.4e-81
WP_001148230.1|421270_422134_+	ATP-binding protein	NA	A0A1B0T6C3	Bacillus_phage	94.9	3.1e-133
WP_000337984.1|422136_422331_+	hypothetical protein	NA	A0A0U3K3J8	Bacillus_phage	81.2	6.5e-23
WP_000799098.1|422347_422626_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A2I7SC16	Paenibacillus_phage	59.3	1.6e-11
WP_001125972.1|422618_422978_+	hypothetical protein	NA	A0A1B1P7A1	Bacillus_phage	54.2	4.9e-32
WP_000717829.1|422996_423164_+	DUF3954 domain-containing protein	NA	A0A1B0T6B8	Bacillus_phage	64.2	9.5e-15
WP_000109543.1|423189_423441_+	hypothetical protein	NA	A0A0K2CNP4	Brevibacillus_phage	42.2	2.2e-07
WP_001054607.1|423460_423970_+	dUTPase	NA	A0A1L2JY27	Aeribacillus_phage	44.9	1.4e-27
WP_001134294.1|424010_424484_+	hypothetical protein	NA	A0A0H3UZ60	Geobacillus_virus	57.5	2.7e-30
WP_000331942.1|424528_424918_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000323893.1|424953_425151_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001030635.1|425143_425677_+	hypothetical protein	NA	U5PUK4	Bacillus_phage	59.4	4.4e-53
WP_000455138.1|425706_426090_+	hypothetical protein	NA	Q2LI92	Bacillus_phage	44.1	1.1e-24
WP_001268380.1|426133_426406_+	hypothetical protein	NA	I7J4K9	Bacillus_phage	58.1	2.7e-19
WP_000670920.1|426445_426655_+	hypothetical protein	NA	A0A068EPB6	Bacillus_phage	47.1	2.4e-07
WP_000350118.1|426996_427425_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002134061.1|427665_428031_+	hypothetical protein	NA	I7J6W4	Bacillus_phage	100.0	3.6e-59
WP_000351065.1|428276_428474_+	hypothetical protein	NA	I7IDJ9	Bacillus_phage	100.0	5.6e-30
WP_000873130.1|428470_428749_+	hypothetical protein	NA	I7J4K9	Bacillus_phage	100.0	8.1e-43
WP_001226456.1|428868_429255_+	hypothetical protein	NA	I7I4E2	Bacillus_phage	100.0	5.2e-72
WP_042970018.1|429581_430064_+	ArpU family transcriptional regulator	NA	H0USV3	Bacillus_phage	81.2	2.7e-70
WP_042969377.1|431146_431389_+	hypothetical protein	NA	A0A0S2MVA9	Bacillus_phage	83.8	4.4e-29
WP_042969379.1|431381_431816_+	hypothetical protein	NA	A0A0A7AQA1	Bacillus_phage	55.0	3.3e-14
WP_002134055.1|431812_432040_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001091354.1|432044_432209_+	helix-turn-helix domain-containing protein	NA	A0A142F1N8	Bacillus_phage	64.4	2.0e-09
WP_000869623.1|432211_432457_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000924768.1|432437_432851_+	HNH endonuclease	NA	Q0SPJ9	Clostridium_phage	43.0	1.6e-23
WP_000113652.1|432950_433472_+|terminase	phage terminase small subunit P27 family	terminase	Q9ZXG2	Bacillus_phage	63.7	5.6e-53
WP_001082759.1|433481_435197_+|terminase	terminase large subunit	terminase	A0A0A7RVS5	Clostridium_phage	63.2	5.3e-217
WP_000264107.1|435210_436431_+|portal	phage portal protein	portal	A6M949	Geobacillus_virus	53.0	5.4e-123
WP_000499523.1|436525_437719_-|transposase	IS110-like element ISBth13 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	26.1	1.1e-24
WP_002134054.1|438009_438708_+|protease	Clp protease ClpP	protease	A0A0A7RTN2	Clostridium_phage	59.0	2.7e-71
WP_001123701.1|438745_439918_+|capsid	phage major capsid protein	capsid	A0A2H4JHG1	uncultured_Caudovirales_phage	62.5	2.4e-128
WP_000904085.1|439952_440246_+	hypothetical protein	NA	A0A0A7S0C9	Clostridium_phage	39.6	4.6e-12
WP_001068032.1|440242_440587_+|head	phage head closure protein	head	A0A2H4JHA9	uncultured_Caudovirales_phage	71.1	7.0e-44
WP_000818832.1|440574_441012_+	hypothetical protein	NA	A0A2H4JBV5	uncultured_Caudovirales_phage	80.7	4.5e-64
WP_001243517.1|441008_441371_+	DUF3168 domain-containing protein	NA	A0A2H4JBW1	uncultured_Caudovirales_phage	84.2	2.4e-55
WP_001251821.1|441386_441971_+|tail	tail protein	tail	A0A2H4JET9	uncultured_Caudovirales_phage	93.3	2.9e-98
WP_015382157.1|442027_442402_+	hypothetical protein	NA	A0A2H4JBU8	uncultured_Caudovirales_phage	86.8	1.8e-53
WP_049870874.1|442566_447609_+|tail	phage tail protein	tail	A0A2H4JI37	uncultured_Caudovirales_phage	83.5	0.0e+00
WP_000566707.1|449096_450086_+|tRNA	tRNA-dihydrouridine synthase	tRNA	NA	NA	NA	NA
448892:448920	attR	ATACGACTCATGTGGAGTGTGTGGCTTGG	NA	NA	NA	NA
WP_001251702.1|450436_450955_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	36.5	4.3e-21
WP_000233735.1|451050_451758_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_000217543.1|451958_452654_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000704490.1|452668_453778_-	dipeptide epimerase	NA	Q6A202	Oenococcus_phage	25.6	5.0e-19
WP_000972812.1|453871_455143_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000853511.1|456845_457961_+	amidohydrolase	NA	NA	NA	NA	NA
WP_001005631.1|458195_458801_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000599501.1|458834_460361_-	alkyl hydroperoxide reductase subunit F	NA	A0A1W6JNB4	Lactococcus_phage	30.8	1.2e-18
WP_000924420.1|460375_460939_-	peroxiredoxin	NA	NA	NA	NA	NA
WP_000033255.1|461530_462760_+	S-methyl-5-thioribose kinase	NA	NA	NA	NA	NA
WP_033679657.1|462769_463816_+	S-methyl-5-thioribose-1-phosphate isomerase	NA	NA	NA	NA	NA
WP_000926553.1|463869_464511_+	L-fuculose-phosphate aldolase	NA	NA	NA	NA	NA
WP_042969383.1|464556_465564_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_042969385.1|465560_466601_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_000732593.1|466649_467567_-	iron-hydroxamate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001078266.1|467900_468950_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000235475.1|469145_469514_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000276022.1|469709_469940_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000051528.1|470175_470685_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042969387.1|470705_471155_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042969388.1|471316_471985_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000434752.1|472223_473489_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001046104.1|473626_474853_+	two-component sensor histidine kinase	NA	NA	NA	NA	NA
WP_000424119.1|475081_475462_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000862985.1|475489_476122_-	cyclase family protein	NA	NA	NA	NA	NA
WP_000147471.1|476468_477578_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001208232.1|477689_478472_+	nucleotidyltransferase domain-containing protein	NA	Q8SCS5	Pseudomonas_phage	43.5	1.4e-44
WP_001182683.1|478485_479787_-	aromatic acid/H+ symport family MFS transporter	NA	NA	NA	NA	NA
WP_001053969.1|480922_482359_-|transposase	IS4-like element IS231C family transposase	transposase	NA	NA	NA	NA
WP_000661226.1|483704_484790_+	acyl-CoA desaturase	NA	NA	NA	NA	NA
WP_003283038.1|484843_485599_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_000823769.1|485642_486437_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_000616925.1|486559_487282_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.8	1.4e-33
WP_042969390.1|487493_488786_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	42.7	9.1e-12
WP_000711827.1|488932_489382_+	arginine repressor	NA	NA	NA	NA	NA
WP_000682331.1|489650_490883_+	arginine deiminase	NA	NA	NA	NA	NA
WP_000930287.1|490913_491912_+	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_042969394.1|492011_493427_+	arginine-ornithine antiporter	NA	NA	NA	NA	NA
WP_000113948.1|493464_494427_+	carbamate kinase	NA	NA	NA	NA	NA
WP_001081906.1|494628_495318_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_000619194.1|495474_496158_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042969396.1|496609_497905_+|transposase	IS21-like element IS232 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	28.8	5.3e-12
>prophage 3
NZ_CP004870	Bacillus thuringiensis serovar kurstaki str. HD-1, complete genome	5631672	775558	816837	5631672	protease,transposase,integrase	Bacillus_phage(85.19%)	38	785306:785324	814203:814221
WP_001252962.1|775558_777958_+|protease	M6 family metalloprotease domain-containing protein	protease	NA	NA	NA	NA
WP_000658667.1|778276_778618_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000964468.1|778639_779065_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000873276.1|778985_780140_-	MFS transporter	NA	NA	NA	NA	NA
WP_000645827.1|780365_781418_+	(R,R)-butanediol dehydrogenase	NA	E3SJ82	Synechococcus_phage	27.6	3.9e-21
WP_000948209.1|781537_781882_+	two pore domain potassium channel family protein	NA	NA	NA	NA	NA
WP_087874946.1|781984_783143_+|transposase	IS3-like element ISBth8 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	42.0	2.5e-37
WP_000730997.1|783426_784278_+	phospholipase C	NA	NA	NA	NA	NA
WP_000676802.1|784354_785401_+	sphingomyelin phosphodiesterase	NA	A0A1P8L6H7	Staphylococcus_phage	59.0	1.1e-87
785306:785324	attL	AATGATTACTCTGATCATT	NA	NA	NA	NA
WP_000262047.1|785339_786440_-|integrase	site-specific integrase	integrase	A0A0S2GLI2	Bacillus_phage	100.0	8.6e-205
WP_000466636.1|786957_788196_+	hypothetical protein	NA	I7J4K0	Bacillus_phage	100.0	8.2e-236
WP_000511082.1|788595_788940_-	helix-turn-helix transcriptional regulator	NA	I7J6V3	Bacillus_phage	100.0	4.2e-57
WP_000813892.1|789088_789325_+	helix-turn-helix transcriptional regulator	NA	A0A0S2GLE0	Bacillus_phage	100.0	8.7e-38
WP_000549466.1|789357_789546_+	helix-turn-helix transcriptional regulator	NA	A0A0S2GLE9	Bacillus_phage	100.0	3.2e-27
WP_038413302.1|790570_791668_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0E3M2X0	Bacillus_phage	23.4	2.1e-09
WP_001028065.1|791664_793674_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_000247457.1|793666_794071_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000349585.1|794139_794931_-	glyoxalase	NA	A0A288WG17	Bacillus_phage	68.4	6.8e-103
WP_000027993.1|794971_795745_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_000794364.1|795833_796622_-	hypothetical protein	NA	A0A288WG17	Bacillus_phage	51.4	2.8e-64
WP_002133890.1|796668_796977_+	YolD-like family protein	NA	NA	NA	NA	NA
WP_038413304.1|797021_797840_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A0S2GLD4	Bacillus_phage	92.6	2.0e-153
WP_000159646.1|797839_798046_-	hypothetical protein	NA	D2XR32	Bacillus_phage	97.1	1.3e-32
WP_000215408.1|798048_798330_-	hypothetical protein	NA	A0A0S2GM64	Bacillus_phage	81.7	2.4e-34
WP_038413306.1|798366_798744_-	hypothetical protein	NA	A0A0S2MVE0	Bacillus_phage	56.8	8.7e-32
WP_155266935.1|802133_802571_+	hypothetical protein	NA	A0A0S2MV63	Bacillus_phage	91.0	1.5e-72
WP_042969440.1|807471_808431_+|integrase	site-specific integrase	integrase	A0A0S2GLC8	Bacillus_phage	99.1	2.6e-181
WP_000151530.1|808444_808726_+	hypothetical protein	NA	A0A0S2GM64	Bacillus_phage	100.0	9.1e-42
WP_001076454.1|808728_808941_+	hypothetical protein	NA	A0A0S2GM50	Bacillus_phage	100.0	1.4e-34
WP_042969441.1|808940_809759_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A0S2GLD4	Bacillus_phage	99.3	7.9e-163
WP_000423300.1|809799_810129_-	hypothetical protein	NA	A0A0S2GLG3	Bacillus_phage	100.0	2.4e-54
WP_000467327.1|810197_810419_-	helix-turn-helix transcriptional regulator	NA	A0A0S2GLH4	Bacillus_phage	100.0	2.9e-35
WP_000495118.1|810881_811202_+	hypothetical protein	NA	A0A0S2GLK1	Bacillus_phage	100.0	1.9e-51
WP_000511371.1|811212_812379_+	DNA translocase FtsK	NA	A0A0S2GLG9	Bacillus_phage	100.0	9.4e-226
WP_000842173.1|812368_812977_+	hypothetical protein	NA	A0A0S2GLL8	Bacillus_phage	100.0	3.3e-113
WP_000730127.1|812981_813863_-	HTH domain-containing protein	NA	I7ILW0	Bacillus_phage	100.0	1.5e-159
WP_000373746.1|814360_815533_+	amino acid deaminase/aldolase	NA	NA	NA	NA	NA
814203:814221	attR	AATGATTACTCTGATCATT	NA	NA	NA	NA
WP_000948949.1|815520_816837_+	FAD-binding protein	NA	A0A2K9L0J9	Tupanvirus	22.1	5.3e-07
>prophage 4
NZ_CP004870	Bacillus thuringiensis serovar kurstaki str. HD-1, complete genome	5631672	1295031	1335078	5631672	protease,terminase,transposase,capsid,head,portal	Bacillus_phage(60.71%)	63	NA	NA
WP_000333967.1|1295031_1296810_+	asparagine synthase (glutamine-hydrolyzing)	NA	A0A1V0SGM7	Hokovirus	27.3	1.6e-22
WP_000650392.1|1296840_1298244_-	recombinase family protein	NA	A0A2I7SDG6	Paenibacillus_phage	44.8	1.5e-113
WP_000289677.1|1298387_1298606_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000130922.1|1298621_1299305_-	LexA family transcriptional regulator	NA	D7RWF2	Brochothrix_phage	34.2	1.3e-22
WP_000385074.1|1299454_1299727_+	helix-turn-helix transcriptional regulator	NA	A0A141E0W0	Streptococcus_phage	50.0	3.0e-10
WP_001186272.1|1300722_1300911_+	hypothetical protein	NA	A0A2H4J4V8	uncultured_Caudovirales_phage	96.8	6.1e-26
WP_000453494.1|1300937_1301372_+	hypothetical protein	NA	A0A0S2MVA8	Bacillus_phage	99.3	1.1e-73
WP_000178948.1|1301390_1302104_+	hypothetical protein	NA	A0A0S2MV99	Bacillus_phage	98.7	3.6e-127
WP_015382226.1|1302103_1302319_+	hypothetical protein	NA	A0A1C8E9A6	Bacillus_phage	97.2	5.5e-31
WP_042969553.1|1302251_1302590_+	hypothetical protein	NA	A0A0S2MVH7	Bacillus_phage	99.1	3.1e-52
WP_000510887.1|1302683_1303637_+	DnaD domain protein	NA	A0A0S2MVA0	Bacillus_phage	90.5	1.4e-147
WP_000933911.1|1303648_1304128_+	hypothetical protein	NA	A0A1C8E9A8	Bacillus_phage	93.7	1.3e-80
WP_000139236.1|1304120_1304351_+	hypothetical protein	NA	A0A1C8E9C2	Bacillus_phage	97.4	2.2e-33
WP_001245742.1|1304374_1304719_+	hypothetical protein	NA	A0A1C8E9A7	Bacillus_phage	58.6	2.9e-42
WP_001245745.1|1304702_1305263_+	hypothetical protein	NA	A0A1C8E9B1	Bacillus_phage	90.3	2.8e-95
WP_001053197.1|1305301_1305736_+	hypothetical protein	NA	A0A2H4JBD8	uncultured_Caudovirales_phage	94.4	1.5e-75
WP_001268030.1|1305794_1306085_+	hypothetical protein	NA	A0A1C8EA94	Bacillus_phage	97.9	2.2e-51
WP_042969554.1|1306132_1306909_+	prohibitin family protein	NA	A0A1C8E9A9	Bacillus_phage	99.2	6.4e-138
WP_000288161.1|1307202_1307631_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000383972.1|1307665_1307893_+	hypothetical protein	NA	A0A1B1P7B8	Bacillus_phage	74.7	2.0e-23
WP_000862932.1|1307889_1308144_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000858115.1|1308181_1308877_+	hypothetical protein	NA	A0A1I9S6E4	Bacillus_phage	81.0	2.1e-111
WP_000590882.1|1308916_1309228_+	hypothetical protein	NA	A0A0A7AR06	Bacillus_phage	86.4	3.1e-43
WP_000540090.1|1309263_1309791_+	Holliday junction resolvase RecU	NA	A0A1C8E9C3	Bacillus_phage	97.1	9.2e-96
WP_000540086.1|1310328_1310856_-	Holliday junction resolvase RecU	NA	A0A1C8E9C3	Bacillus_phage	97.7	4.1e-96
WP_000590881.1|1310891_1311203_-	hypothetical protein	NA	A0A0A7AR06	Bacillus_phage	84.5	1.0e-41
WP_000858114.1|1311247_1311943_-	hypothetical protein	NA	A0A1I9S6E4	Bacillus_phage	81.5	3.2e-112
WP_000520932.1|1311978_1312233_-	hypothetical protein	NA	I7ILU4	Staphylococcus_phage	100.0	1.2e-40
WP_080711282.1|1312315_1313215_-	hypothetical protein	NA	A0A1C8E9A9	Bacillus_phage	99.0	3.2e-104
WP_155269695.1|1313371_1313506_+	addiction module toxin, HicA family	NA	A0A0U4KLG1	Pseudomonas_phage	73.2	1.5e-10
WP_001187283.1|1313758_1313947_+	hypothetical protein	NA	A0A2H4J4V8	uncultured_Caudovirales_phage	62.9	2.6e-13
WP_000453495.1|1313973_1314417_+	hypothetical protein	NA	A0A0S2MVA8	Bacillus_phage	90.5	9.8e-67
WP_042969555.1|1314435_1315149_+	hypothetical protein	NA	A0A0S2MV99	Bacillus_phage	97.9	4.0e-126
WP_000355713.1|1315148_1315364_+	hypothetical protein	NA	A0A1C8E9A6	Bacillus_phage	98.6	1.1e-31
WP_002133909.1|1315293_1315635_+	hypothetical protein	NA	A0A0S2MVH7	Bacillus_phage	97.3	9.9e-51
WP_000510889.1|1315728_1316682_+	DnaD domain protein	NA	A0A0S2MVA0	Bacillus_phage	90.2	8.4e-148
WP_016100029.1|1316693_1317173_+	hypothetical protein	NA	A0A1C8E9A8	Bacillus_phage	98.1	1.1e-84
WP_155269696.1|1317401_1317713_+	hypothetical protein	NA	A0A1C8E9B1	Bacillus_phage	83.9	3.0e-06
WP_001010921.1|1317751_1318186_+	hypothetical protein	NA	A0A1C8E9B0	Bacillus_phage	95.1	1.3e-76
WP_001268033.1|1318244_1318535_+	hypothetical protein	NA	A0A1C8EA94	Bacillus_phage	94.8	8.4e-51
WP_042969556.1|1318681_1319473_+	prohibitin family protein	NA	A0A1C8E9A9	Bacillus_phage	98.9	4.8e-141
WP_000356654.1|1319557_1319740_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000389429.1|1319899_1320304_+	hypothetical protein	NA	I6TG10	Staphylococcus_virus	37.1	7.7e-10
WP_042969558.1|1320537_1320849_+	hypothetical protein	NA	A0A0A7AR06	Bacillus_phage	83.5	2.2e-41
WP_000540088.1|1320884_1321412_+	Holliday junction resolvase RecU	NA	A0A1C8E9C3	Bacillus_phage	98.3	5.4e-96
WP_016099930.1|1321408_1321735_+	hypothetical protein	NA	A0A1C8E9C1	Bacillus_phage	98.1	1.0e-57
WP_033676375.1|1321772_1322174_+	hypothetical protein	NA	A0A1C8E9D1	Bacillus_phage	98.5	1.8e-67
WP_000711196.1|1322556_1322976_-	HicB family protein	NA	A0A2H4J4X8	uncultured_Caudovirales_phage	79.9	7.6e-61
WP_071686481.1|1323027_1323210_-	type II toxin-antitoxin system HicA family toxin	NA	A0A0U4KLG1	Pseudomonas_phage	67.2	9.4e-16
WP_000499523.1|1323506_1324700_+|transposase	IS110-like element ISBth13 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	26.1	1.1e-24
WP_000196707.1|1324971_1325172_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001051281.1|1325188_1325491_+	HNH endonuclease	NA	A0A1B0YEC6	Lactobacillus_phage	48.5	1.5e-18
WP_001149928.1|1325493_1325889_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001282601.1|1325981_1326344_+	hypothetical protein	NA	A0A290GJQ7	Caldibacillus_phage	43.5	2.4e-18
WP_033676369.1|1326352_1328041_+|terminase	terminase large subunit	terminase	A0A290GJW3	Caldibacillus_phage	72.6	3.9e-249
WP_000522435.1|1328054_1329233_+|portal	phage portal protein	portal	A0A0A8WJ25	Clostridium_phage	61.6	5.5e-141
WP_000361708.1|1330816_1331401_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2I7SBY1	Paenibacillus_phage	44.6	2.7e-32
WP_001031425.1|1331417_1332602_+|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	24.4	5.1e-09
WP_001016250.1|1332617_1332875_+	hypothetical protein	NA	A6XMJ7	Bacillus_virus	43.2	1.1e-06
WP_000600950.1|1332871_1333144_+	DNA-packaging protein	NA	R9TMB7	Paenibacillus_phage	53.9	3.0e-18
WP_000998123.1|1333140_1333440_+|head	phage head closure protein	head	NA	NA	NA	NA
WP_042969560.1|1333785_1334115_+	hypothetical protein	NA	A0A2H4JAG4	uncultured_Caudovirales_phage	83.5	6.4e-47
WP_042969562.1|1334715_1335078_+	hypothetical protein	NA	A0A2H4JAG8	uncultured_Caudovirales_phage	67.5	3.2e-39
>prophage 5
NZ_CP004870	Bacillus thuringiensis serovar kurstaki str. HD-1, complete genome	5631672	1345826	1352905	5631672	holin	Bacillus_phage(42.86%)	8	NA	NA
WP_042969568.1|1345826_1346201_+	hypothetical protein	NA	A0A0S2MVE0	Bacillus_phage	96.0	1.1e-63
WP_000373898.1|1346238_1346664_+|holin	phage holin family protein	holin	A0A0S2MVC4	Bacillus_phage	100.0	2.6e-72
WP_042969569.1|1347850_1348417_-	hypothetical protein	NA	A6XML2	Bacillus_virus	45.7	5.9e-24
WP_042969571.1|1348556_1348775_+	hypothetical protein	NA	A0A2H4JC50	uncultured_Caudovirales_phage	88.9	2.3e-29
WP_000100788.1|1348799_1349090_+	hypothetical protein	NA	A0A1C8E992	Bacillus_phage	90.7	9.3e-42
WP_000730207.1|1349107_1349941_-	hypothetical protein	NA	A0A2H4J6G7	uncultured_Caudovirales_phage	81.9	2.6e-121
WP_000163133.1|1350419_1351379_+	ferrochelatase	NA	NA	NA	NA	NA
WP_001069180.1|1351438_1352905_+	catalase	NA	A0A2K9L572	Tupanvirus	47.4	1.0e-123
>prophage 6
NZ_CP004870	Bacillus thuringiensis serovar kurstaki str. HD-1, complete genome	5631672	2046602	2054753	5631672		Bacillus_phage(66.67%)	7	NA	NA
WP_000755525.1|2046602_2047883_+	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	31.5	3.4e-11
WP_001194306.1|2047982_2048747_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000453861.1|2048987_2050748_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	98.0	2.4e-273
WP_000612414.1|2050833_2051511_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	99.1	1.1e-122
WP_001231621.1|2051507_2052581_+	HAMP domain-containing sensor histidine kinase	NA	W8CYF6	Bacillus_phage	98.0	6.1e-187
WP_000818979.1|2052870_2053590_+	3-ketoacyl-ACP reductase	NA	W8CYX9	Bacillus_phage	100.0	5.9e-61
WP_001258538.1|2053880_2054753_+	aminoglycoside 6-adenylyltransferase	NA	A0A1X9I6F2	Streptococcus_phage	44.7	2.1e-65
>prophage 7
NZ_CP004870	Bacillus thuringiensis serovar kurstaki str. HD-1, complete genome	5631672	2073425	2133526	5631672	protease,transposase,coat	Bacillus_phage(25.0%)	59	NA	NA
WP_000710470.1|2073425_2074583_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q331V1	Clostridium_botulinum_C_phage	59.0	1.8e-123
WP_001163356.1|2074739_2076548_+	Petrobactin biosynthesis protein AsbA	NA	NA	NA	NA	NA
WP_000798699.1|2077274_2078027_-	AAA family ATPase	NA	A0A059NT77	Lactococcus_phage	47.3	7.0e-57
WP_042969697.1|2078016_2079312_-|transposase	IS21-like element IS232 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	28.8	5.3e-12
WP_042969700.1|2080622_2081861_+	AMP-binding protein	NA	NA	NA	NA	NA
WP_001250558.1|2081857_2082124_+	petrobactin biosynthesis protein AsbD	NA	NA	NA	NA	NA
WP_000200704.1|2082147_2083131_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000877670.1|2083168_2084011_+	sugar phosphate isomerase/epimerase	NA	NA	NA	NA	NA
WP_000113545.1|2084135_2084342_+	alpha/beta-type small acid-soluble spore protein	NA	Q77YX0	Bacillus_phage	63.1	3.4e-14
WP_033667350.1|2084577_2085807_+	MFS transporter	NA	NA	NA	NA	NA
WP_001287305.1|2085860_2086475_-	amino acid transporter	NA	NA	NA	NA	NA
WP_000439399.1|2086593_2088036_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_000816391.1|2088048_2088216_+	DUF3933 domain-containing protein	NA	NA	NA	NA	NA
WP_000686789.1|2088329_2089295_-	patatin-like phospholipase family protein	NA	A0A1V0SKV5	Klosneuvirus	31.2	1.1e-25
WP_000540423.1|2089382_2089523_-	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_001034835.1|2089746_2090499_+	DUF1963 domain-containing protein	NA	NA	NA	NA	NA
WP_000520856.1|2090649_2091810_+	peptidase	NA	NA	NA	NA	NA
WP_001048102.1|2091915_2092113_+	DUF4083 domain-containing protein	NA	NA	NA	NA	NA
WP_000024999.1|2092144_2092606_+	NUDIX hydrolase	NA	A0A2I6PFL2	Proteus_phage	35.1	8.5e-05
WP_000174901.1|2092655_2093474_-	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	63.3	1.7e-93
WP_001026002.1|2093749_2095630_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000648325.1|2095745_2096033_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A2I7SC16	Paenibacillus_phage	56.5	1.2e-12
WP_000099756.1|2096307_2097255_+|protease	serine protease	protease	A0A127AWU5	Bacillus_phage	57.4	1.4e-94
WP_001259906.1|2097296_2097605_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000874082.1|2097711_2098647_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_001082497.1|2098694_2099870_+	MFS transporter	NA	NA	NA	NA	NA
WP_001101741.1|2099918_2100125_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001198794.1|2100268_2100631_+	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_000162602.1|2100830_2101055_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000426317.1|2101139_2101487_-	DUF4257 domain-containing protein	NA	NA	NA	NA	NA
WP_001073075.1|2102392_2103445_+	ribosome small subunit-dependent GTPase A	NA	NA	NA	NA	NA
WP_042969701.1|2103645_2105628_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	31.0	3.5e-23
WP_000539571.1|2105824_2106130_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000965059.1|2106452_2106818_+	DUF3979 domain-containing protein	NA	NA	NA	NA	NA
WP_042969703.1|2106709_2107873_-	membrane protein	NA	NA	NA	NA	NA
WP_000105199.1|2108113_2108557_+	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	62.1	6.2e-45
WP_000488206.1|2108659_2109115_+	DUF3939 domain-containing protein	NA	NA	NA	NA	NA
WP_000798320.1|2109330_2110275_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087942833.1|2110335_2111678_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	37.3	6.3e-32
WP_042969704.1|2111790_2112792_-	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000683357.1|2112896_2113088_-	DUF3896 domain-containing protein	NA	NA	NA	NA	NA
WP_001168116.1|2113265_2114729_+	flavin monoamine oxidase family protein	NA	A0A2K9L022	Tupanvirus	22.3	1.2e-15
WP_001068749.1|2114813_2115398_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000376357.1|2115422_2116325_-	aldo/keto reductase family oxidoreductase	NA	NA	NA	NA	NA
WP_042969705.1|2116586_2118056_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	G3MB42	Bacillus_virus	41.7	2.7e-68
WP_000613420.1|2118153_2119104_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_001048676.1|2119216_2119687_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001126151.1|2119825_2120776_-	zinc ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_042969706.1|2121040_2121220_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001100112.1|2122451_2122631_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001042736.1|2124948_2125608_+	oxidoreductase	NA	NA	NA	NA	NA
WP_001083648.1|2125637_2126675_-	NADPH dehydrogenase NamA	NA	NA	NA	NA	NA
WP_000283913.1|2126808_2127261_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	41.0	1.1e-25
WP_002098546.1|2127286_2128273_+	DUF2628 domain-containing protein	NA	NA	NA	NA	NA
WP_000824280.1|2128357_2130019_+	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000943769.1|2130078_2130495_+	FosB/FosD family fosfomycin resistance bacillithiol transferase	NA	Q2LI91	Bacillus_phage	64.8	1.3e-39
WP_000858822.1|2131067_2131679_+	phosphoserine phosphatase 1	NA	NA	NA	NA	NA
WP_000817485.1|2131725_2132268_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000937997.1|2132449_2133526_+|coat	spore coat protein CotH	coat	NA	NA	NA	NA
>prophage 8
NZ_CP004870	Bacillus thuringiensis serovar kurstaki str. HD-1, complete genome	5631672	2171144	2177857	5631672	integrase,bacteriocin	Bacillus_phage(70.0%)	10	2162041:2162059	2178201:2178219
2162041:2162059	attL	ATGGTCACAGTGTTTCTTA	NA	NA	NA	NA
WP_042969713.1|2171144_2172092_+|integrase	site-specific integrase	integrase	A0A0U3B271	Bacillus_phage	94.1	4.0e-166
WP_000389067.1|2172111_2172342_+|bacteriocin	bacteriocin biosynthesis protein	bacteriocin	A0A1B1P7Q9	Bacillus_phage	93.4	5.3e-32
WP_000751888.1|2172338_2173403_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A2H4JAS1	uncultured_Caudovirales_phage	93.8	5.4e-196
WP_000669561.1|2173472_2174276_-	hypothetical protein	NA	A6M971	Geobacillus_virus	41.3	5.4e-23
WP_000941958.1|2174275_2174482_-	helix-turn-helix transcriptional regulator	NA	A0A288WG80	Bacillus_phage	41.5	4.1e-07
WP_001257568.1|2174670_2174985_+	hypothetical protein	NA	H0USY0	Bacillus_phage	96.2	7.7e-50
WP_000170790.1|2174981_2175164_+	hypothetical protein	NA	A0A288WGN6	Bacillus_phage	90.0	1.1e-21
WP_000891545.1|2175279_2176461_+	cell division protein FtsK	NA	H0USY1	Bacillus_phage	93.4	1.9e-213
WP_042969716.1|2176402_2177023_+	phage protein	NA	H0USY2	Bacillus_phage	95.1	5.3e-111
WP_000730123.1|2177032_2177857_-	helix-turn-helix domain-containing protein	NA	A0A2H4J969	uncultured_Caudovirales_phage	66.9	2.1e-99
2178201:2178219	attR	ATGGTCACAGTGTTTCTTA	NA	NA	NA	NA
>prophage 9
NZ_CP004870	Bacillus thuringiensis serovar kurstaki str. HD-1, complete genome	5631672	2227312	2284429	5631672	transposase,integrase	Bacillus_phage(36.36%)	49	2248561:2248577	2285911:2285927
WP_042969723.1|2227312_2228542_+|transposase	IS110-like element ISBth166 family transposase	transposase	M1NSC9	Streptococcus_phage	49.1	1.4e-83
WP_000675562.1|2228881_2229460_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_001174543.1|2230195_2230630_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000754973.1|2230716_2231688_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_001236345.1|2232043_2233273_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	49.4	4.5e-85
WP_000844984.1|2233502_2233712_-	DUF3925 domain-containing protein	NA	NA	NA	NA	NA
WP_000219434.1|2233935_2234418_+	glutathione peroxidase	NA	Q70H87	Fowlpox_virus	40.6	3.5e-25
WP_002134082.1|2234501_2236730_-	DUF4129 domain-containing protein	NA	NA	NA	NA	NA
WP_000827540.1|2236726_2237941_-	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_001135816.1|2237940_2238903_-	MoxR family ATPase	NA	NA	NA	NA	NA
WP_001236345.1|2239542_2240772_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	49.4	4.5e-85
WP_000730783.1|2241127_2244811_+	nitrate reductase subunit alpha	NA	NA	NA	NA	NA
WP_000692704.1|2244800_2246276_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	47.3	1.2e-20
WP_001249921.1|2246295_2246826_+	nitrate reductase molybdenum cofactor assembly chaperone	NA	NA	NA	NA	NA
WP_000969223.1|2246843_2247533_+	respiratory nitrate reductase subunit gamma	NA	NA	NA	NA	NA
WP_000013866.1|2247669_2248362_-	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
2248561:2248577	attL	TGTAGCTTCTTTTTTAT	NA	NA	NA	NA
WP_000545028.1|2248639_2249653_+	GTP 3',8-cyclase MoaA	NA	NA	NA	NA	NA
WP_001158130.1|2249670_2250684_+	molybdopterin-synthase adenylyltransferase MoeB	NA	NA	NA	NA	NA
WP_000884821.1|2250727_2252017_+	molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
WP_000616827.1|2252061_2252484_+	molybdenum cofactor biosynthesis protein MoaE	NA	NA	NA	NA	NA
WP_000573683.1|2252480_2252714_+	molybdopterin converting factor subunit 1	NA	NA	NA	NA	NA
WP_000841857.1|2252794_2253964_+	nitrate transporter NarK	NA	NA	NA	NA	NA
WP_000043362.1|2254276_2254654_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000282595.1|2254844_2255318_-	precorrin-2 dehydrogenase	NA	NA	NA	NA	NA
WP_000676479.1|2255310_2256021_-	sirohydrochlorin chelatase	NA	NA	NA	NA	NA
WP_001014978.1|2256017_2257442_-	uroporphyrin-III C-methyltransferase	NA	NA	NA	NA	NA
WP_000616694.1|2257500_2257818_-	nitrite reductase small subunit NirD	NA	NA	NA	NA	NA
WP_000401358.1|2260447_2261155_-	iron-sulfur cluster repair di-iron protein	NA	NA	NA	NA	NA
WP_042969726.1|2261357_2262086_-	calcium-binding protein	NA	NA	NA	NA	NA
WP_000395679.1|2262294_2262447_+	exosporium protein ExsG	NA	NA	NA	NA	NA
WP_000824207.1|2262663_2262873_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001238710.1|2264340_2265942_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000536153.1|2266094_2266643_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000427801.1|2267253_2267529_+	stage V sporulation protein S	NA	J9PTX7	Bacillus_phage	41.2	2.9e-08
WP_000071989.1|2267749_2267989_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000283853.1|2268156_2268612_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_003284113.1|2268873_2269182_-	YolD-like family protein	NA	NA	NA	NA	NA
WP_000794364.1|2269478_2270267_+	hypothetical protein	NA	A0A288WG17	Bacillus_phage	51.4	2.8e-64
WP_000027993.1|2270355_2271129_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_000349585.1|2271169_2271961_+	glyoxalase	NA	A0A288WG17	Bacillus_phage	68.4	6.8e-103
WP_000247457.1|2272029_2272434_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001028065.1|2272426_2274436_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_000477499.1|2274432_2275530_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0E3M2X0	Bacillus_phage	23.4	2.1e-09
WP_000709202.1|2276982_2277108_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000165969.1|2278278_2278926_+	HD domain-containing protein	NA	S4W232	Pandoravirus	28.3	9.5e-10
WP_000783186.1|2278922_2280818_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2H4UUX5	Bodo_saltans_virus	25.5	2.2e-46
WP_001260655.1|2280893_2281625_+	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_000975140.1|2281730_2281985_+	DUF4318 domain-containing protein	NA	NA	NA	NA	NA
WP_000116992.1|2282998_2284429_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
2285911:2285927	attR	ATAAAAAAGAAGCTACA	NA	NA	NA	NA
>prophage 10
NZ_CP004870	Bacillus thuringiensis serovar kurstaki str. HD-1, complete genome	5631672	4620244	4627930	5631672		Bacillus_phage(33.33%)	9	NA	NA
WP_000221066.1|4620244_4621168_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	43.5	1.5e-45
WP_000609140.1|4621293_4622229_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	24.8	9.2e-22
WP_000018029.1|4622230_4622923_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	38.2	3.7e-36
WP_001014310.1|4623265_4623460_+	YwbE family protein	NA	NA	NA	NA	NA
WP_001255971.1|4623498_4624698_-	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	41.2	1.6e-71
WP_000587826.1|4624993_4625317_+	heme oxygenase	NA	NA	NA	NA	NA
WP_001086121.1|4625389_4626154_-	class B sortase	NA	NA	NA	NA	NA
WP_000403760.1|4626186_4626957_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	28.6	7.6e-14
WP_001036847.1|4626946_4627930_-	iron ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	27.2	2.5e-17
>prophage 11
NZ_CP004870	Bacillus thuringiensis serovar kurstaki str. HD-1, complete genome	5631672	4979121	5072727	5631672	protease,terminase,transposase,capsid,coat,head,integrase,holin,tRNA,portal,tail	Bacillus_phage(73.58%)	90	4970027:4970048	5053190:5053211
4970027:4970048	attL	ATAAAGTGAAACTTTAATCAGC	NA	NA	NA	NA
WP_000287147.1|4979121_4980498_+|tRNA	glycine--tRNA ligase	tRNA	A0A1V0SIF1	Klosneuvirus	27.9	5.8e-49
WP_155269692.1|4980611_4981953_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	37.6	6.3e-32
WP_001140612.1|4982008_4982392_-	hotdog fold thioesterase	NA	NA	NA	NA	NA
WP_000810336.1|4982487_4983231_+	DUF3298 and DUF4163 domain-containing protein	NA	NA	NA	NA	NA
WP_001252163.1|4983281_4983875_+	biotin transporter BioY	NA	NA	NA	NA	NA
WP_002097988.1|4983920_4984808_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	54.1	7.0e-80
WP_001104221.1|4984915_4986640_-	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	53.5	1.6e-176
WP_000545253.1|4986783_4987389_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000487942.1|4987563_4989048_-	cytosol aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	36.9	8.7e-59
WP_000920098.1|4989207_4989834_-	hypothetical protein	NA	A0A0H3UZG2	Geobacillus_virus	42.1	6.1e-14
WP_000027016.1|4989920_4990238_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000415321.1|4990234_4990741_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_000856612.1|4990864_4992073_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000829788.1|4992534_4993524_+	NAD(P)/FAD-dependent oxidoreductase	NA	Q9JRK7	Streptococcus_phage	52.4	3.0e-31
WP_000902159.1|5004064_5004544_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_042969867.1|5004709_5005957_+	MFS transporter	NA	NA	NA	NA	NA
WP_000535259.1|5005974_5006856_-	decarboxylase	NA	NA	NA	NA	NA
WP_000635484.1|5006935_5007397_+	DUF523 domain-containing protein	NA	NA	NA	NA	NA
WP_000710530.1|5007719_5008547_+	hypothetical protein	NA	A0A2H4J6G7	uncultured_Caudovirales_phage	69.5	1.8e-101
WP_042969869.1|5008556_5009177_-	phage protein	NA	H0USY2	Bacillus_phage	91.7	6.1e-107
WP_042969870.1|5009118_5010300_-	cell division protein FtsK	NA	H0USY1	Bacillus_phage	93.6	1.4e-213
WP_042969871.1|5010415_5010598_-	hypothetical protein	NA	Q2I8E2	Bacillus_phage	88.3	2.0e-21
WP_001257569.1|5010594_5010912_-	hypothetical protein	NA	H0USY0	Bacillus_phage	98.1	6.4e-52
WP_000649833.1|5011094_5011292_+	helix-turn-helix transcriptional regulator	NA	A0A288WG80	Bacillus_phage	76.2	3.4e-19
WP_001137905.1|5011300_5011480_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000043398.1|5011485_5012064_+	hypothetical protein	NA	H0USX9	Bacillus_phage	88.5	2.2e-95
WP_000119484.1|5012117_5012456_+	hypothetical protein	NA	A0A1B1P7R0	Bacillus_phage	92.9	4.6e-48
WP_042969874.1|5015315_5015741_-|holin	phage holin family protein	holin	H0USX7	Bacillus_phage	96.5	5.9e-69
WP_042969875.1|5021368_5021602_-	hypothetical protein	NA	W8CYT7	Bacillus_phage	98.5	2.5e-29
WP_000344049.1|5025612_5025789_-	hypothetical protein	NA	W8CYG0	Bacillus_phage	100.0	6.7e-27
WP_015382489.1|5025818_5026136_-	hypothetical protein	NA	W8CYN3	Bacillus_phage	97.1	4.9e-52
WP_042969876.1|5026791_5027151_-	DUF3168 domain-containing protein	NA	H0USX0	Bacillus_phage	93.3	3.4e-57
WP_001068025.1|5027616_5027940_-|head	phage head closure protein	head	H0USW8	Bacillus_phage	95.3	1.8e-54
WP_000244589.1|5027926_5028214_-|head,tail	phage gp6-like head-tail connector protein	head,tail	H0USW7	Bacillus_phage	98.9	2.6e-44
WP_000357562.1|5028234_5029407_-|capsid	phage major capsid protein	capsid	W8CYN2	Bacillus_phage	93.3	7.3e-202
WP_001259165.1|5029444_5030155_-|protease	Clp protease ClpP	protease	W8CYT5	Bacillus_phage	96.2	3.7e-124
WP_000577424.1|5030141_5031395_-|portal	phage portal protein	portal	A0A2H4J371	uncultured_Caudovirales_phage	95.2	7.2e-232
WP_042969877.1|5031583_5033278_-|terminase	terminase large subunit	terminase	H0USW3	Bacillus_phage	98.2	0.0e+00
WP_042969878.1|5033912_5034290_-	HNH endonuclease	NA	A0A0S2GLI5	Bacillus_phage	82.4	2.4e-53
WP_042969879.1|5034668_5034881_-	hypothetical protein	NA	H0USV9	Bacillus_phage	94.3	1.1e-28
WP_042969880.1|5034897_5035137_-	hypothetical protein	NA	A0A0S2GLE8	Bacillus_phage	87.2	7.0e-19
WP_000464752.1|5035396_5035624_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000017440.1|5035660_5035948_-	hypothetical protein	NA	H0USV6	Bacillus_phage	91.6	1.7e-43
WP_049870882.1|5036350_5036539_-	hypothetical protein	NA	W8CYG8	Bacillus_phage	98.2	8.2e-23
WP_080711298.1|5036763_5037087_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0S2GLG4	Bacillus_phage	99.0	5.2e-49
WP_000166155.1|5037083_5037569_-	ArpU family transcriptional regulator	NA	A0A0S2GLJ9	Bacillus_phage	99.4	1.8e-85
WP_000965619.1|5037926_5038208_-	hypothetical protein	NA	A0A0S2GLD3	Bacillus_phage	100.0	8.7e-45
WP_000404184.1|5039616_5040024_-	hypothetical protein	NA	A0A0S2GLF8	Bacillus_phage	100.0	4.9e-73
WP_042969883.1|5040377_5040677_-	hypothetical protein	NA	A0A0S2GLL5	Bacillus_phage	99.0	7.9e-52
WP_000705118.1|5040827_5041127_+	hypothetical protein	NA	A0A0S2GLD6	Bacillus_phage	100.0	1.9e-50
WP_042969885.1|5041123_5041339_-	aspartate ammonia-lyase	NA	A0A0S2GLC6	Bacillus_phage	98.6	2.5e-36
WP_042969886.1|5041356_5041521_-	DUF3954 domain-containing protein	NA	A0A0S2GLF5	Bacillus_phage	98.1	3.8e-24
WP_042969887.1|5041592_5041859_-	hypothetical protein	NA	A0A0S2GLK4	Bacillus_phage	97.7	5.6e-41
WP_042970116.1|5041927_5042713_-	DNA replication protein	NA	A0A0S2GLK2	Bacillus_phage	98.1	6.5e-146
WP_049870883.1|5043988_5044594_-	sigma-70 family RNA polymerase sigma factor	NA	A0A0S2GLJ1	Bacillus_phage	98.0	1.7e-106
WP_000218620.1|5044868_5045183_-	hypothetical protein	NA	A0A0S2GLB6	Bacillus_phage	100.0	1.1e-51
WP_000277643.1|5046134_5046323_-	helix-turn-helix domain-containing protein	NA	A0A1B2APY7	Phage_Wrath	80.6	2.6e-21
WP_000368216.1|5046467_5046713_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000005253.1|5046960_5047290_+	helix-turn-helix transcriptional regulator	NA	H0UST7	Bacillus_phage	97.2	5.6e-51
WP_001164934.1|5047692_5048823_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000896931.1|5048990_5049221_-	hypothetical protein	NA	H0UST5	Bacillus_phage	90.8	8.5e-30
WP_000237487.1|5050183_5051245_+|integrase	site-specific integrase	integrase	A0A1B2AQ00	Phage_Wrath	83.9	3.5e-171
WP_000833145.1|5051333_5051687_-	YxeA family protein	NA	A0A0K2CYS5	Paenibacillus_phage	39.7	4.5e-14
WP_000834606.1|5052310_5053075_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087942842.1|5053500_5054845_+|transposase	IS3-like element ISBth10 family transposase	transposase	A0A1B1P773	Bacillus_phage	74.4	3.6e-112
5053190:5053211	attR	ATAAAGTGAAACTTTAATCAGC	NA	NA	NA	NA
WP_000573825.1|5054927_5055281_-	iron-sulfur cluster assembly accessory protein	NA	A0A2H4N7M3	Lake_Baikal_phage	43.3	3.7e-16
WP_000077397.1|5055322_5056189_-	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_000595026.1|5056457_5056697_-	YuzB family protein	NA	NA	NA	NA	NA
WP_000682077.1|5057043_5058114_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_001054089.1|5058347_5058521_+	aspartyl-phosphate phosphatase Spo0E family protein	NA	NA	NA	NA	NA
WP_000470265.1|5058576_5059236_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.7	1.3e-22
WP_000679246.1|5059219_5060017_+	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_000212737.1|5060237_5060579_-	alkylphosphonate utilization operon protein PhnA	NA	NA	NA	NA	NA
WP_000622258.1|5060738_5061020_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003285671.1|5061089_5061887_-	DUF2628 domain-containing protein	NA	NA	NA	NA	NA
WP_000607080.1|5062175_5062559_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000383681.1|5062595_5062850_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000843107.1|5062939_5063410_+	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_002101500.1|5063396_5064035_+	DUF4304 domain-containing protein	NA	NA	NA	NA	NA
WP_000049707.1|5064085_5064754_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002101505.1|5064876_5065671_-	DUF4111 domain-containing protein	NA	NA	NA	NA	NA
WP_000248588.1|5065723_5066032_-	YuzD family protein	NA	NA	NA	NA	NA
WP_000431159.1|5066227_5066464_+	NifU family protein	NA	Q58MC7	Prochlorococcus_phage	46.6	2.0e-10
WP_001125494.1|5066658_5066874_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000614218.1|5066935_5067937_-|coat	spore coat protein CotS	coat	NA	NA	NA	NA
WP_000665094.1|5068057_5068549_+	phosphatidylglycerophosphatase A	NA	G3MBC5	Bacillus_virus	53.8	3.5e-41
WP_021727531.1|5068572_5069052_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001106091.1|5069214_5070318_+	HpcH/HpaI aldolase/citrate lyase family protein	NA	NA	NA	NA	NA
WP_000856300.1|5070262_5071609_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000241505.1|5071614_5072727_+|protease	cysteine protease StiP family protein	protease	NA	NA	NA	NA
>prophage 12
NZ_CP004870	Bacillus thuringiensis serovar kurstaki str. HD-1, complete genome	5631672	5229635	5237536	5631672	holin	Bacillus_phage(75.0%)	8	NA	NA
WP_042969913.1|5229635_5230463_+	cytosolic protein	NA	A0A1C8EA76	Bacillus_phage	90.9	1.7e-136
WP_001273481.1|5230478_5230772_-	hypothetical protein	NA	A0A1C8E992	Bacillus_phage	87.6	2.7e-41
WP_000734384.1|5232275_5232494_-	hypothetical protein	NA	A0A2H4JBB8	uncultured_Caudovirales_phage	73.8	1.7e-16
WP_000993515.1|5232493_5233609_-	tetratricopeptide repeat protein	NA	A0A2H4J8G3	uncultured_Caudovirales_phage	54.9	4.0e-109
WP_042969916.1|5233812_5234748_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A0S2MVR5	Bacillus_phage	80.7	6.1e-151
WP_042969917.1|5236300_5236744_-|holin	phage holin family protein	holin	A0A0S2MVC4	Bacillus_phage	97.1	6.2e-69
WP_000390477.1|5236819_5237044_-	hypothetical protein	NA	A0A1B1P780	Bacillus_phage	89.2	1.1e-26
WP_015382147.1|5237170_5237536_-	hypothetical protein	NA	A0A0S2MVE0	Bacillus_phage	59.0	3.7e-35
>prophage 1
NZ_CP004876	Bacillus thuringiensis serovar kurstaki str. HD-1 plasmid pBMB299, complete sequence	299843	181199	262151	299843	holin,transposase	Bacillus_phage(35.71%)	44	NA	NA
WP_151156144.1|181199_182141_-|transposase	IS3 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	57.6	2.9e-68
WP_042970264.1|182080_182728_-	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	43.5	5.2e-40
WP_033679387.1|183231_183636_+|transposase	IS200/IS605 family transposase	transposase	A0A286QN76	Streptococcus_phage	67.6	1.4e-40
WP_000929144.1|184885_185182_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042970265.1|186298_187417_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	S6AND0	Bacillus_phage	80.9	1.3e-171
WP_000701098.1|188773_189847_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000369347.1|189958_190870_+	DMT family transporter	NA	NA	NA	NA	NA
WP_042970266.1|193352_194672_+	HBL/NHE enterotoxin family protein	NA	NA	NA	NA	NA
WP_080711324.1|194734_195982_+	alpha-helical pore-forming toxin family protein	NA	NA	NA	NA	NA
WP_042970267.1|196013_197147_+	alpha-helical pore-forming toxin family protein	NA	NA	NA	NA	NA
WP_015406629.1|200681_201677_+	DUF4046 domain-containing protein	NA	NA	NA	NA	NA
WP_000998670.1|202559_202829_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001227945.1|202828_203431_+	SdpI family protein	NA	NA	NA	NA	NA
WP_000827070.1|203875_204406_+	SdpA family antimicrobial peptide system protein	NA	NA	NA	NA	NA
WP_000473523.1|204390_205341_+	membrane protein	NA	NA	NA	NA	NA
WP_000724589.1|205384_206005_+	sporulation delaying protein family toxin	NA	NA	NA	NA	NA
WP_000526840.1|206194_206587_+	thiol-disulfide oxidoreductase DCC family protein	NA	NA	NA	NA	NA
WP_000730548.1|206906_208223_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_015406631.1|208858_209392_-	YitT family protein	NA	M1Q1P6	Streptococcus_phage	29.9	7.3e-16
WP_078405493.1|209454_209655_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000864460.1|211782_212235_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000275580.1|213894_215190_+|transposase	IS21-like element IS232 family transposase	transposase	A0A059NT83	Lactococcus_phage	31.0	1.0e-42
WP_000798699.1|215179_215932_+	AAA family ATPase	NA	A0A059NT77	Lactococcus_phage	47.3	7.0e-57
WP_000357137.1|217158_218574_+	HTH domain-containing protein	NA	NA	NA	NA	NA
WP_001039073.1|221036_223406_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042970268.1|226143_228045_+	pesticidal protein Cry2Ab	NA	NA	NA	NA	NA
WP_016090221.1|229975_231706_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.6	1.6e-16
WP_001026061.1|232542_233037_+	cation:proton antiporter regulatory subunit	NA	NA	NA	NA	NA
WP_000380161.1|233041_234241_+	cation:proton antiporter	NA	NA	NA	NA	NA
WP_042970269.1|234651_235608_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A0S2MV84	Bacillus_phage	39.8	1.4e-49
WP_042970271.1|235897_239428_+	pesticidal protein	NA	NA	NA	NA	NA
WP_000769223.1|239934_242094_+	pesticidal crystal protein cry1Ia	NA	NA	NA	NA	NA
WP_014481901.1|242308_243415_-	tyrosine recombinase XerS	NA	A0A1B1IQT7	uncultured_Mediterranean_phage	28.4	2.0e-07
WP_000591046.1|243580_244606_-	macro domain-containing protein	NA	A0A0B4N0V6	Escherichia_phage	40.4	9.1e-23
WP_042970272.1|247396_249298_-	pesticidal protein Cry2Ab	NA	NA	NA	NA	NA
WP_000922362.1|249387_250146_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000545193.1|250312_250816_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033679389.1|252936_253188_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000892197.1|253548_253971_-|holin	phage holin family protein	holin	A0A0S2MVC4	Bacillus_phage	77.3	1.3e-52
WP_000495521.1|256464_256869_-	DUF3221 domain-containing protein	NA	NA	NA	NA	NA
WP_001243454.1|258064_259114_+	Fic family protein	NA	NA	NA	NA	NA
WP_016090225.1|259279_259582_-	hypothetical protein	NA	A0A0S2MVJ2	Bacillus_phage	47.3	5.0e-14
WP_000086972.1|260444_260699_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015406602.1|261032_262151_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	S6AND0	Bacillus_phage	80.6	3.7e-171
>prophage 1
NZ_CP004877	Bacillus thuringiensis serovar kurstaki str. HD-1 plasmid pBMB431, complete sequence	431546	72089	143046	431546	transposase	Bacillus_phage(31.25%)	59	NA	NA
WP_087942833.1|72089_73431_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	37.3	6.3e-32
WP_016090591.1|73519_74194_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087971388.1|74981_75107_-	Phr family secreted Rap phosphatase inhibitor	NA	NA	NA	NA	NA
WP_000219740.1|75260_75557_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001236345.1|75907_77137_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	49.4	4.5e-85
WP_042970398.1|78487_80104_+	SH3 domain-containing protein	NA	A0A1J0MS59	Bacillus_phage	53.7	2.8e-42
WP_042970330.1|81112_82039_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000582601.1|83675_84308_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016090594.1|84304_84940_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016090595.1|85236_85620_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016090596.1|85636_86275_+	NERD domain-containing protein	NA	A0A2R2ZH57	Clostridioides_phage	35.1	2.8e-22
WP_016090597.1|86566_87310_+	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_016090598.1|88085_89483_-	S8 family serine peptidase	NA	A0A2H4PQH1	Staphylococcus_phage	43.6	2.2e-88
WP_000906771.1|89703_90351_-	ABC-2 transporter permease	NA	NA	NA	NA	NA
WP_001103609.1|90340_91207_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.6	1.6e-20
WP_000706800.1|91203_91587_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_033679607.1|93100_94489_+	radical SAM/SPASM domain-containing protein	NA	NA	NA	NA	NA
WP_016090599.1|94653_96363_+	ABC transporter ATP-binding protein	NA	F2Y302	Organic_Lake_phycodnavirus	30.1	6.0e-19
WP_016090600.1|96397_96685_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016090601.1|97050_97836_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	33.5	3.0e-26
WP_016090602.1|97852_98710_-	glucose uptake protein glcU	NA	NA	NA	NA	NA
WP_016090603.1|99498_100095_+	thermonuclease family protein	NA	NA	NA	NA	NA
WP_001004894.1|100146_100350_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000084567.1|100422_100635_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000210390.1|101263_101557_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001206759.1|102103_102517_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071686443.1|103059_103239_-	RNA-binding protein Hfq	NA	NA	NA	NA	NA
WP_000762752.1|103429_103828_+|transposase	IS200/IS605 family transposase	transposase	A0A286QN76	Streptococcus_phage	68.9	3.1e-51
WP_016097410.1|103839_104952_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A288TXV8	Enterococcus_phage	47.9	1.1e-79
WP_016090607.1|105234_105366_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033679611.1|105362_106472_-	tetratricopeptide repeat protein	NA	A0A2H4J8G3	uncultured_Caudovirales_phage	46.1	5.8e-92
WP_001014799.1|106669_106864_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016090610.1|109246_109447_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000958635.1|109839_110133_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016090611.1|111914_112250_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155269723.1|112835_112994_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016097411.1|113262_113697_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_087942842.1|114538_115884_-|transposase	IS3-like element ISBth10 family transposase	transposase	A0A1B1P773	Bacillus_phage	74.4	3.6e-112
WP_016090613.1|115938_116784_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016090614.1|116923_117628_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016090615.1|118272_118533_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016090616.1|119611_120844_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	25.1	2.8e-18
WP_016090617.1|120848_121541_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_016090618.1|122242_123043_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016090619.1|123064_123778_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.1	3.0e-33
WP_016090620.1|123774_126243_+	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_016090621.1|126710_127031_-	TM2 domain-containing protein	NA	A0A127AZ85	Bacillus_phage	40.9	1.6e-10
WP_016090622.1|127685_128267_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001187351.1|128377_129631_-	MFS transporter	NA	NA	NA	NA	NA
WP_042970332.1|130585_132670_+	alpha-amylase	NA	NA	NA	NA	NA
WP_016090624.1|132838_134161_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016090625.1|134189_135278_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016090626.1|135442_135760_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016090627.1|135798_137151_+	long-chain fatty acid--CoA ligase	NA	NA	NA	NA	NA
WP_074628990.1|137333_137756_-	DoxX family protein	NA	NA	NA	NA	NA
WP_016090629.1|137866_138628_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016090630.1|139902_140094_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016090632.1|140828_141716_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038413276.1|141750_143046_+|transposase	IS21-like element IS232 family transposase	transposase	A0A059NT83	Lactococcus_phage	31.0	1.3e-42
>prophage 2
NZ_CP004877	Bacillus thuringiensis serovar kurstaki str. HD-1 plasmid pBMB431, complete sequence	431546	154231	211634	431546	transposase	uncultured_Caudovirales_phage(18.18%)	39	NA	NA
WP_044157304.1|154231_154831_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.1	1.8e-34
WP_000647561.1|155138_155585_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000169374.1|155918_157226_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	29.7	8.6e-26
WP_001100112.1|157399_157579_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016097421.1|158380_158923_-	recombinase family protein	NA	A0A219YA40	Aeromonas_phage	31.5	3.4e-13
WP_016097422.1|159103_160567_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	57.2	8.1e-142
WP_016090463.1|160589_161009_+	universal stress protein	NA	NA	NA	NA	NA
WP_016090464.1|161095_162763_+	ribonuclease J	NA	NA	NA	NA	NA
WP_140159901.1|163121_164051_-	collagen-like protein	NA	NA	NA	NA	NA
WP_016090232.1|165591_166188_+	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_016090231.1|166466_166877_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_016090230.1|167006_167768_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_016090229.1|167895_168282_-	DUF202 domain-containing protein	NA	NA	NA	NA	NA
WP_016090228.1|168314_169127_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_016090227.1|169443_169989_+	recombinase family protein	NA	M9Q1K0	Clostridium_phage	41.0	1.1e-30
WP_040120008.1|170031_172980_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	26.7	1.4e-79
WP_016090640.1|173842_174763_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_000116992.1|175098_176529_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_000364215.1|176677_177088_-	DUF1878 family protein	NA	NA	NA	NA	NA
WP_016090641.1|177375_177747_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001053969.1|177933_179370_+|transposase	IS4-like element IS231C family transposase	transposase	NA	NA	NA	NA
WP_016090564.1|180172_187771_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	28.3	4.2e-165
WP_016090563.1|188136_189063_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_016090562.1|189549_191094_+	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_001019438.1|191305_191950_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016090561.1|192259_192670_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001105580.1|192796_193015_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016090560.1|193160_193487_+	helix-turn-helix transcriptional regulator	NA	A0A059T669	Listeria_phage	36.8	1.3e-10
WP_033679622.1|194193_194760_-	acyltransferase	NA	NA	NA	NA	NA
WP_001053969.1|194899_196336_-|transposase	IS4-like element IS231C family transposase	transposase	NA	NA	NA	NA
WP_016090558.1|196313_196931_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016090557.1|196940_197366_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016090556.1|197804_203444_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080943790.1|203719_203947_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016090555.1|204409_205501_+	tetratricopeptide repeat protein	NA	A0A2H4J8G3	uncultured_Caudovirales_phage	46.1	8.6e-88
WP_016090553.1|206520_206862_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153580446.1|207190_207346_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016090552.1|207995_210053_-	ATP-dependent helicase	NA	S5MMD7	Bacillus_phage	25.6	1.3e-41
WP_042969396.1|210338_211634_+|transposase	IS21-like element IS232 family transposase	transposase	A0A059NT83	Lactococcus_phage	31.0	1.7e-42
>prophage 3
NZ_CP004877	Bacillus thuringiensis serovar kurstaki str. HD-1 plasmid pBMB431, complete sequence	431546	287076	341307	431546	transposase,protease,integrase	Bacillus_phage(68.18%)	53	314841:314857	344992:345008
WP_087942837.1|287076_288445_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	65.3	2.2e-93
WP_000420168.1|289113_289314_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000895161.1|289381_289570_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016090505.1|289636_289981_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000765882.1|290074_290518_-	DUF5065 family protein	NA	NA	NA	NA	NA
WP_000922179.1|291140_291716_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016090503.1|292045_293101_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0T6C8	Bacillus_phage	72.1	6.2e-152
WP_000570185.1|293097_293337_-	hypothetical protein	NA	A0A0A7AR38	Bacillus_phage	75.9	2.7e-26
WP_016090502.1|294921_295155_-	XpaF1 protein	NA	A0A2H4J382	uncultured_Caudovirales_phage	83.8	8.1e-12
WP_042970354.1|295345_296230_-	N-acetylmuramoyl-L-alanine amidase family protein	NA	A0A0S2MVR5	Bacillus_phage	51.8	1.0e-75
WP_042970356.1|296502_297387_-	N-acetylmuramoyl-L-alanine amidase family protein	NA	A0A0S2MVR5	Bacillus_phage	52.1	4.7e-76
WP_042970358.1|297659_298481_-	M23 family metallopeptidase	NA	A0A218KCJ1	Bacillus_phage	41.5	2.7e-25
WP_016099955.1|298622_299591_-	lysozyme family protein	NA	A0A223LKM8	Bacillus_phage	41.7	4.5e-32
WP_000460733.1|299828_300215_-	hypothetical protein	NA	A0A288WG73	Bacillus_phage	69.8	2.6e-47
WP_042970359.1|300317_301244_-	DnaD domain protein	NA	A0A1C8E9B4	Bacillus_phage	63.5	2.9e-76
WP_000527101.1|301316_301553_-	helix-turn-helix transcriptional regulator	NA	W8CYU0	Bacillus_phage	60.0	9.7e-13
WP_000579788.1|301689_302118_+	helix-turn-helix transcriptional regulator	NA	Q786F1	Bacillus_phage	51.4	9.3e-30
WP_000673778.1|302140_302569_+	ImmA/IrrE family metallo-endopeptidase	NA	Q9T201	Bacillus_phage	55.1	7.3e-35
WP_016090274.1|302833_304045_-	S-layer homology domain-containing protein	NA	NA	NA	NA	NA
WP_000762747.1|304429_304828_+|transposase	IS200/IS605-like element ISBth16 family transposase	transposase	A0A286QN76	Streptococcus_phage	68.9	5.2e-51
WP_042970361.1|304839_305952_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A286QQB7	Streptococcus_phage	45.0	4.4e-79
WP_016090272.1|306093_307482_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_000797393.1|307710_308424_+	azaleucine resistance protein AzlC	NA	NA	NA	NA	NA
WP_000178819.1|308420_308756_+	branched-chain amino acid transporter AzlD	NA	NA	NA	NA	NA
WP_000691090.1|309460_309613_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016090271.1|309982_310987_-	DUF4065 domain-containing protein	NA	I6R0L8	Salmonella_phage	34.6	1.1e-07
WP_016090270.1|311027_311480_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013555075.1|312108_313389_-	xanthine/uracil/vitamin C permease	NA	NA	NA	NA	NA
WP_016090269.1|313516_313966_-	cyanase	NA	NA	NA	NA	NA
WP_000926479.1|313997_314579_-	carbonic anhydrase	NA	NA	NA	NA	NA
WP_000677474.1|314746_315178_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
314841:314857	attL	AAAAAATACATATGACT	NA	NA	NA	NA
WP_016090268.1|315340_317023_-	DUF2075 domain-containing protein	NA	NA	NA	NA	NA
WP_033679414.1|317169_317499_-	nucleotide pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_033679417.1|317567_317795_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016090265.1|318004_318928_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_016090264.1|319364_320114_-	AAA family ATPase	NA	A0A2H4J4U1	uncultured_Caudovirales_phage	41.2	5.8e-35
WP_000824502.1|320588_320972_-	(deoxy)nucleoside triphosphate pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_042970365.1|321326_322301_+	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_016090261.1|322411_322627_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016090260.1|322925_324020_+	tetratricopeptide repeat protein	NA	A0A2H4J8G3	uncultured_Caudovirales_phage	49.9	2.8e-94
WP_000733519.1|324874_325291_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001167047.1|325363_325579_-	alpha/beta-type small acid-soluble spore protein	NA	A0A1P8CX76	Bacillus_phage	68.7	3.7e-19
WP_016090258.1|325745_327488_-	methyl-accepting chemotaxis protein	NA	NA	NA	NA	NA
WP_000913857.1|328469_328955_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_016090256.1|329587_330001_-	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_000577229.1|329990_330398_-	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_042970367.1|330827_331946_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	S6AND0	Bacillus_phage	79.8	1.9e-170
WP_016090254.1|332162_332510_-	YxeA family protein	NA	A0A0K2CYS5	Paenibacillus_phage	36.1	1.3e-10
WP_000688781.1|332720_334370_-	S8 family serine peptidase	NA	A0A217EQY2	Bacillus_phage	24.4	7.0e-09
WP_016090253.1|334723_335191_+	RsfA family transcriptional regulator	NA	NA	NA	NA	NA
WP_016090252.1|335351_337049_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042970369.1|338393_340127_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087971406.1|341175_341307_+|integrase	integrase	integrase	NA	NA	NA	NA
344992:345008	attR	AGTCATATGTATTTTTT	NA	NA	NA	NA
>prophage 1
NZ_CP004871	Bacillus thuringiensis serovar kurstaki str. HD-1 plasmid pBMB46, complete sequence	46634	0	46387	46634	holin,integrase,terminase,portal,tail,head	Bacillus_phage(100.0%)	64	4132:4148	27749:27765
WP_016049858.1|407_836_+	hypothetical protein	NA	A0A0S2MV94	Bacillus_phage	100.0	1.5e-72
WP_044129691.1|940_1147_+	hypothetical protein	NA	A0A0S2MV68	Bacillus_phage	100.0	5.6e-33
WP_016049860.1|1147_4087_+|tail	phage tail tape measure protein	tail	A0A0S2MVC9	Bacillus_phage	100.0	0.0e+00
WP_016049861.1|4099_5578_+|tail	phage tail fiber protein	tail	A0A0S2MVB9	Bacillus_phage	100.0	9.9e-297
4132:4148	attL	GAAAAGAAATTCAAATG	NA	NA	NA	NA
WP_016090411.1|5574_10284_+	phage minor structural protein	NA	A0A0S2MVH9	Bacillus_phage	100.0	0.0e+00
WP_016090410.1|10383_11343_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A068EP13	Bacillus_phage	100.0	4.8e-183
WP_016090409.1|11358_11598_+	hypothetical protein	NA	A0A0S2MVH5	Bacillus_phage	100.0	4.8e-36
WP_016090408.1|11640_11871_+|holin	phage holin	holin	A0A0S2MVE8	Bacillus_phage	100.0	1.1e-34
WP_016090407.1|11887_12823_+	L-alanyl-D-glutamate peptidase	NA	A0A0S2MVR5	Bacillus_phage	100.0	5.7e-189
WP_016090406.1|13117_13402_-	hypothetical protein	NA	A0A0S2MVK9	Bacillus_phage	100.0	2.7e-49
WP_000539769.1|13836_14070_-	helix-turn-helix transcriptional regulator	NA	A0A0S2MVM0	Bacillus_phage	100.0	7.3e-37
WP_016090405.1|14155_14686_-	hypothetical protein	NA	A0A0S2MVP2	Bacillus_phage	100.0	7.1e-96
WP_031303572.1|14697_15078_-	hypothetical protein	NA	A0A0S2MVE7	Bacillus_phage	100.0	2.8e-62
WP_016090403.1|15195_15528_-	hypothetical protein	NA	A0A0S2MVL6	Bacillus_phage	99.1	4.6e-53
WP_016090402.1|15487_16519_-	ParM/StbA family protein	NA	A0A0S2MVG2	Bacillus_phage	100.0	1.1e-196
WP_016090401.1|16801_17464_-	hypothetical protein	NA	A0A0S2MVD6	Bacillus_phage	100.0	5.3e-125
WP_016090400.1|17487_18591_-	hypothetical protein	NA	A0A0S2MVK1	Bacillus_phage	100.0	1.5e-172
WP_016090399.1|19190_19535_-	DUF4064 domain-containing protein	NA	A0A0S2MVJ2	Bacillus_phage	100.0	5.3e-52
WP_016090398.1|19554_20082_-	DUF4352 domain-containing protein	NA	A0A0S2MVG4	Bacillus_phage	100.0	2.0e-90
WP_016090397.1|20692_21010_-	helix-turn-helix transcriptional regulator	NA	A0A0S2MVM8	Bacillus_phage	100.0	5.8e-53
WP_016090396.1|21574_22762_+	helix-turn-helix transcriptional regulator	NA	A0A0S2MVK2	Bacillus_phage	100.0	4.6e-220
WP_016090393.1|23249_23600_-	helix-turn-helix transcriptional regulator	NA	A0A0S2MVD3	Bacillus_phage	100.0	4.7e-56
WP_016090392.1|23813_24011_+	helix-turn-helix transcriptional regulator	NA	A0A0S2MVJ7	Bacillus_phage	100.0	1.4e-28
WP_016090391.1|24077_24806_+	rha family phage regulatory protein	NA	A0A0S2MVD8	Bacillus_phage	100.0	2.6e-133
WP_016090390.1|24817_25192_+	hypothetical protein	NA	A0A0S2MVH3	Bacillus_phage	100.0	5.6e-63
WP_016090389.1|25215_25923_+	hypothetical protein	NA	A0A0S2MVI5	Bacillus_phage	100.0	1.0e-129
WP_016090388.1|25922_26102_+	hypothetical protein	NA	A0A0S2MVI7	Bacillus_phage	100.0	5.4e-24
WP_016090387.1|26091_26421_+	hypothetical protein	NA	A0A0S2MVM3	Bacillus_phage	100.0	8.1e-50
WP_016090386.1|26566_27070_+	hypothetical protein	NA	A0A0S2MVD2	Bacillus_phage	100.0	8.5e-91
WP_016090385.1|27038_27422_+	hypothetical protein	NA	A0A0S2MVI0	Bacillus_phage	100.0	1.1e-69
WP_016090384.1|27441_27798_+	hypothetical protein	NA	A0A0S2MVL2	Bacillus_phage	100.0	5.1e-66
27749:27765	attR	GAAAAGAAATTCAAATG	NA	NA	NA	NA
WP_016090383.1|27821_28289_+	hypothetical protein	NA	A0A0S2MVF1	Bacillus_phage	100.0	1.3e-85
WP_016090382.1|28402_28840_+	hypothetical protein	NA	A0A0S2MVD9	Bacillus_phage	100.0	1.0e-76
WP_016090381.1|28839_29292_+	hypothetical protein	NA	A0A0S2MVJ1	Bacillus_phage	100.0	7.9e-88
WP_016090380.1|29288_29870_+	hypothetical protein	NA	A0A0S2MVD0	Bacillus_phage	100.0	3.0e-108
WP_016090379.1|29891_30374_+	hypothetical protein	NA	A0A0S2MVE6	Bacillus_phage	100.0	2.5e-87
WP_016090378.1|30507_30807_+	hypothetical protein	NA	A0A0S2MVI8	Bacillus_phage	100.0	1.1e-50
WP_016090376.1|31035_31443_+	hypothetical protein	NA	A0A0S2MVF6	Bacillus_phage	100.0	6.9e-75
WP_016090479.1|32044_32290_+	hypothetical protein	NA	A0A0S2MVC7	Bacillus_phage	100.0	8.4e-36
WP_016090480.1|32339_32564_+	hypothetical protein	NA	A0A0S2MVG0	Bacillus_phage	100.0	4.5e-36
WP_016090481.1|32605_32983_+	hypothetical protein	NA	A0A0S2MVH4	Bacillus_phage	100.0	1.1e-50
WP_016090449.1|33107_33290_+	hypothetical protein	NA	A0A0S2MVH2	Bacillus_phage	100.0	4.3e-29
WP_016049864.1|33320_33851_+	Holliday junction resolvase RecU	NA	A0A0S2MVB5	Bacillus_phage	100.0	1.2e-98
WP_016090448.1|33870_34194_+	hypothetical protein	NA	A0A0S2MV86	Bacillus_phage	100.0	3.3e-56
WP_016090447.1|34338_34839_+	sigma-70 family RNA polymerase sigma factor	NA	A0A0S2MVE1	Bacillus_phage	100.0	1.2e-89
WP_016049869.1|35731_35974_+	hypothetical protein	NA	A0A0S2MVA9	Bacillus_phage	100.0	2.9e-36
WP_016049870.1|35966_36233_+	hypothetical protein	NA	A0A0S2MVC8	Bacillus_phage	100.0	2.3e-39
WP_016049871.1|36371_36614_+	DUF2829 domain-containing protein	NA	A0A0S2MV73	Bacillus_phage	100.0	8.6e-41
WP_016049872.1|36613_36877_+	DUF2829 domain-containing protein	NA	A0A0S2MVC6	Bacillus_phage	100.0	9.0e-44
WP_016049873.1|37136_37457_+	hypothetical protein	NA	A0A0S2MVH6	Bacillus_phage	100.0	4.8e-55
WP_016049874.1|37484_37868_+	hypothetical protein	NA	I7J6Y9	Bacillus_phage	100.0	2.2e-67
WP_016049845.1|37900_38230_+	hypothetical protein	NA	A0A0S2MVB8	Bacillus_phage	100.0	1.7e-52
WP_000762692.1|38216_38429_+	hypothetical protein	NA	A0A0S2MV92	Bacillus_phage	100.0	7.1e-31
WP_016049846.1|38579_39494_+|terminase	phage terminase small subunit	terminase	A0A0S2MVB6	Bacillus_phage	100.0	2.5e-141
WP_016049847.1|39483_40758_+|terminase	PBSX family phage terminase large subunit	terminase	A0A0S2MVC1	Bacillus_phage	100.0	2.4e-254
WP_016049848.1|40770_42204_+|portal	phage portal protein	portal	A0A0S2MVB2	Bacillus_phage	100.0	8.5e-277
WP_016090413.1|42277_43045_+	hypothetical protein	NA	A0A0S2MVF0	Bacillus_phage	100.0	1.1e-142
WP_016049850.1|43044_43317_+	DUF2829 domain-containing protein	NA	A0A0S2MV93	Bacillus_phage	100.0	2.5e-49
WP_016049851.1|43396_44077_+	DUF4355 domain-containing protein	NA	A0A0S2MVA2	Bacillus_phage	100.0	9.7e-106
WP_016049852.1|44094_44937_+	hypothetical protein	NA	A0A0S2MVF8	Bacillus_phage	100.0	2.2e-155
WP_016049853.1|44987_45296_+	phage related protein gp15	NA	A0A0S2MVF2	Bacillus_phage	100.0	3.1e-51
WP_016049854.1|45292_45637_+|head,tail	phage head-tail adaptor	head,tail	A0A0S2MVD7	Bacillus_phage	100.0	6.7e-63
WP_016049855.1|45611_46019_+	HK97 gp10 family phage protein	NA	A0A0S2MVE4	Bacillus_phage	100.0	1.4e-67
WP_016049856.1|46024_46387_+	hypothetical protein	NA	A0A0S2MV90	Bacillus_phage	100.0	1.1e-63
>prophage 1
NZ_CP004874	Bacillus thuringiensis serovar kurstaki str. HD-1 plasmid pBMB74, complete sequence	74480	58522	65811	74480	transposase,integrase	Bacillus_phage(33.33%)	8	58305:58318	66747:66760
58305:58318	attL	ATCATTTGCATTTG	NA	NA	NA	NA
WP_016097325.1|58522_59521_-|integrase	site-specific integrase	integrase	A0A1B1P793	Bacillus_phage	35.1	3.1e-36
WP_016097326.1|59492_60110_-	recombinase family protein	NA	A0A1V0E035	Clostridioides_phage	32.0	2.7e-14
WP_016097327.1|60770_61355_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016097328.1|61431_61677_+	hypothetical protein	NA	NA	NA	NA	NA
WP_090782881.1|61772_62932_-|transposase	IS3 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	41.6	1.5e-37
WP_016097331.1|63083_63458_-	hypothetical protein	NA	D2XQ01	Bacillus_virus	51.3	1.5e-28
WP_016097332.1|63917_64553_+	DUF3967 domain-containing protein	NA	A0A1Z1LZN4	Bacillus_phage	28.4	8.7e-08
WP_016097333.1|64695_65811_+	transcriptional regulator	NA	A0A2H4J8G3	uncultured_Caudovirales_phage	52.2	1.2e-92
66747:66760	attR	CAAATGCAAATGAT	NA	NA	NA	NA
>prophage 1
NZ_CP004882	Bacillus thuringiensis serovar kurstaki str. HD-1 plasmid pBMBLin15, complete sequence	14870	352	14730	14870		Bacillus_phage(100.0%)	21	NA	NA
WP_015976754.1|352_529_+	helix-turn-helix domain-containing protein	NA	Q5ILD1	Bacillus_phage	100.0	1.2e-23
WP_015976755.1|544_1045_+	hypothetical protein	NA	Q5ILD0	Bacillus_phage	100.0	2.6e-84
WP_015976756.1|1116_1341_+	hypothetical protein	NA	Q5ILC9	Bacillus_phage	100.0	6.8e-32
WP_016090431.1|1399_2137_+	hypothetical protein	NA	Q5ILC8	Bacillus_phage	99.6	2.2e-132
WP_016090430.1|2123_4328_+	hypothetical protein	NA	A0A160LKS5	Bacillus_phage	98.9	0.0e+00
WP_000957403.1|4344_4545_+	LexA repressor	NA	A0A161ISH4	Bacillus_phage	100.0	1.9e-30
WP_015976760.1|4828_5083_+	hypothetical protein	NA	Q5ILC4	Bacillus_phage	100.0	2.2e-39
WP_042970424.1|5057_5426_+	hypothetical protein	NA	Q5ILC3	Bacillus_phage	96.7	7.8e-17
WP_016097524.1|5413_5998_+	hypothetical protein	NA	Q5ILC2	Bacillus_phage	99.5	4.3e-70
WP_016090421.1|6343_6982_+	hypothetical protein	NA	Q5ILB9	Bacillus_phage	99.5	1.9e-124
WP_016090418.1|7414_7684_+	hypothetical protein	NA	Q5ILB5	Bacillus_phage	98.9	8.7e-42
WP_016090417.1|7683_8754_+	hypothetical protein	NA	Q5ILB4	Bacillus_phage	99.7	3.5e-203
WP_000523934.1|8795_9026_+	hypothetical protein	NA	Q5ILB3	Bacillus_phage	100.0	9.4e-37
WP_015976770.1|9261_9693_+	hypothetical protein	NA	Q5ILB0	Bacillus_phage	100.0	1.5e-56
WP_015976771.1|10020_10296_+	hypothetical protein	NA	Q5ILA7	Bacillus_phage	100.0	2.2e-48
WP_015976772.1|10299_10914_+	hypothetical protein	NA	Q5ILA6	Bacillus_phage	100.0	4.5e-78
WP_015976773.1|10917_11670_+	lytic enzyme	NA	Q5ILA5	Bacillus_phage	100.0	4.5e-136
WP_015976774.1|11617_12130_+	hypothetical protein	NA	Q5ILA4	Bacillus_phage	100.0	1.7e-91
WP_015976775.1|12143_13037_+	hypothetical protein	NA	Q5ILA3	Bacillus_phage	100.0	2.2e-150
WP_015976776.1|13040_13922_+	hypothetical protein	NA	Q5ILA2	Bacillus_phage	100.0	2.5e-170
WP_016090416.1|13938_14730_+	N-acetylmuramoyl-L-alanine amidase	NA	Q5ILA1	Bacillus_phage	100.0	7.3e-129
