The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP007804	Salmonella enterica subsp. enterica serovar Typhimurium strain VNP20009 chromosome, complete genome	4763557	926894	1025703	4763557	terminase,protease,lysis,portal,tail,tRNA,holin	Salmonella_phage(42.86%)	101	NA	NA
WP_001154025.1|926894_927698_+|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_001288828.1|927690_929013_+	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_000060025.1|928993_929698_+	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_000572724.1|929697_934164_+	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_000925872.1|934508_936350_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000357052.1|936609_937158_+	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	1.2e-05
WP_001109471.1|937185_937833_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_000462653.1|937894_939085_-	aspartate transaminase	NA	NA	NA	NA	NA
WP_000977713.1|939269_940361_-	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	51.7	2.2e-99
WP_000117870.1|940967_942368_-|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	35.1	4.5e-81
WP_000762342.1|942568_943030_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000544849.1|943346_944561_+	diaminopropionate ammonia-lyase	NA	NA	NA	NA	NA
WP_000893207.1|944805_946242_+	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_000191399.1|946319_947522_-	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001262308.1|947716_949009_-	DUF3596 domain-containing protein	NA	S4TSP2	Salmonella_phage	99.5	2.9e-252
WP_000065276.1|949053_949302_-	excisionase family protein	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
WP_001237031.1|949342_949582_-	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_001539618.1|949624_950782_-	recombinase RecT	NA	S4TTE8	Salmonella_phage	100.0	1.6e-217
WP_000017133.1|950744_953630_-	PD-(D/E)XK nuclease-like domain-containing protein	NA	S4TNL0	Salmonella_phage	97.3	0.0e+00
WP_001668146.1|953756_954056_-	hypothetical protein	NA	S4TSN6	Salmonella_phage	84.5	8.1e-49
WP_000917564.1|954077_954236_-	hypothetical protein	NA	H6WRX3	Salmonella_phage	98.1	1.2e-22
WP_014344008.1|954228_954489_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001038966.1|954538_954949_-	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	42.4	8.1e-07
WP_000370145.1|955068_955308_+	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	47.2	8.3e-12
WP_001574095.1|955273_955648_+	hypothetical protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
WP_000062941.1|955732_956716_+	replication protein	NA	H6WRX7	Salmonella_phage	100.0	1.9e-163
WP_000800013.1|956718_957468_+	ATP-binding protein	NA	S4TNF5	Salmonella_phage	99.2	1.1e-137
WP_000113629.1|957478_957826_+	DUF977 family protein	NA	H6WRX9	Salmonella_phage	89.6	5.4e-52
WP_000065108.1|957822_958134_+	ead/Ea22-like family protein	NA	A0A220NQV2	Salmonella_phage	97.2	7.2e-32
WP_014343823.1|958211_958502_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001217665.1|958793_959027_+	DinI family protein	NA	H6WRY5	Salmonella_phage	98.7	2.1e-36
WP_000807548.1|959138_959360_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000929805.1|959442_960045_+	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	98.5	8.3e-109
WP_001096552.1|960253_960865_+	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	91.6	6.9e-79
WP_001617856.1|960861_961008_+	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	97.9	4.3e-19
WP_001047631.1|960997_961795_+	antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.6	2.3e-151
WP_010989004.1|961861_962179_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001534733.1|962352_962478_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000798705.1|962613_963063_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001141973.1|963423_964110_-|protease	type III secretion system effector protease GtgA	protease	Q9MBM0	Phage_Gifsy-2	100.0	2.1e-132
WP_001574216.1|964385_964715_+|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_000984586.1|964698_965151_+	lysozyme	NA	A0A0M4R365	Salmonella_phage	97.3	2.3e-79
WP_001541990.1|965168_965648_+|lysis	lysis protein	lysis	Q56118	Enterobacteria_phage	77.0	1.4e-55
WP_000371784.1|965855_966389_+	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	48.1	1.0e-33
WP_000989241.1|966345_968484_+|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	72.6	3.4e-290
WP_000196190.1|968480_968687_+	hypothetical protein	NA	A0A1W6JT66	Pseudomonas_phage	53.3	2.9e-05
WP_001009207.1|968683_970231_+|portal	phage portal protein	portal	A0A291AWU2	Escherichia_phage	64.3	2.8e-177
WP_010989008.1|970154_972236_+|protease	Clp protease ClpP	protease	A0A291AWT6	Escherichia_phage	69.5	4.8e-265
WP_001107908.1|972326_972650_+	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	61.3	7.7e-29
WP_000774239.1|972642_972942_+	ATP-binding protein	NA	K7PH43	Enterobacteria_phage	45.1	4.5e-15
WP_000453194.1|972922_973489_+|tail	phage tail protein	tail	Q9G063	Phage_Gifsy-2	97.8	9.5e-14
WP_000196702.1|973485_973887_+|tail	tail protein	tail	K7PHM6	Enterobacterial_phage	60.9	1.5e-42
WP_000132756.1|973898_974648_+|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	68.6	3.7e-90
WP_000478859.1|974693_975092_+|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	56.8	8.6e-30
WP_010989009.1|975088_975418_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	50.9	5.0e-23
WP_010989010.1|975497_978485_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.1	8.2e-266
WP_000978296.1|978481_978814_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	61.5	3.3e-35
WP_000725267.1|978912_979410_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1B0VBR9	Salmonella_phage	36.6	1.4e-16
WP_000877926.1|979526_980060_-	superoxide dismutase [Cu-Zn]	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
WP_001152415.1|980149_980845_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.7	1.3e-89
WP_000606351.1|980854_981592_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	76.1	1.6e-114
WP_000246065.1|981489_982194_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	62.6	9.2e-67
WP_000033415.1|982265_985616_+	host specificity protein J	NA	A0A0K2FI38	Escherichia_phage	68.6	0.0e+00
WP_000178849.1|985654_985897_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001144679.1|985950_988389_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0K2FIZ6	Escherichia_phage	63.4	2.9e-91
WP_000143167.1|988388_988970_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	89.5	1.7e-95
WP_001526469.1|989445_990414_+	SPI-2 type III secretion system effector SseI	NA	Q9MBL9	Phage_Gifsy-2	100.0	7.1e-195
WP_000334547.1|991061_991688_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	63.2	1.4e-66
WP_010989011.1|991756_992056_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001525490.1|992040_992727_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000497441.1|992997_993189_-	DinI-like family protein	NA	S4TNM0	Salmonella_phage	95.2	6.2e-26
WP_000193784.1|993615_996228_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	6.3e-20
WP_000291723.1|996435_997446_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_001220671.1|997611_998154_+	cell division protein ZapC	NA	NA	NA	NA	NA
WP_000224069.1|998150_999260_-	YcbX family protein	NA	NA	NA	NA	NA
WP_001086485.1|999358_1001467_+	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_000053044.1|1001479_1003387_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
WP_000333152.1|1003401_1004655_+	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000433414.1|1004659_1006300_+	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000759136.1|1006296_1006860_+	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_001537784.1|1007115_1007283_+	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000227928.1|1007382_1007901_-	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_000156453.1|1007969_1009730_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000877172.1|1009915_1010368_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_001674965.1|1010439_1011492_-	porin OmpA	NA	NA	NA	NA	NA
WP_000288732.1|1011848_1012358_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_001202375.1|1012574_1013180_+	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_000950880.1|1013166_1015320_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001261222.1|1015338_1015785_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000420505.1|1015908_1017963_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	8.5e-20
WP_000424187.1|1017998_1018457_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000847719.1|1018551_1019214_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_001537782.1|1019387_1019801_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_000561983.1|1019845_1020163_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000140480.1|1020220_1021432_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000859419.1|1021646_1022195_+	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_000548082.1|1022220_1023000_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000072884.1|1023048_1023330_+	acylphosphatase	NA	NA	NA	NA	NA
WP_000904446.1|1023326_1023656_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000374050.1|1023742_1024402_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	51.9	2.3e-43
WP_000938191.1|1025022_1025703_-|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	70.6	8.3e-81
>prophage 2
NZ_CP007804	Salmonella enterica subsp. enterica serovar Typhimurium strain VNP20009 chromosome, complete genome	4763557	1164150	1220653	4763557	terminase,integrase,lysis,capsid,head,portal,tail,transposase,tRNA,holin	Enterobacteria_phage(34.62%)	69	1174878:1174892	1189276:1189290
WP_000502119.1|1164150_1164609_+|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
WP_001113672.1|1164699_1165989_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000456516.1|1166028_1167150_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_001031687.1|1167230_1168694_-	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_001537766.1|1168693_1169365_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000423763.1|1169491_1170862_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	45.3	8.5e-109
WP_001519653.1|1170865_1171507_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_000004541.1|1171593_1172700_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000476067.1|1172753_1173215_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_000825957.1|1173226_1173556_-	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_001249412.1|1173552_1174218_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000444507.1|1174389_1175640_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	90.7	1.1e-19
1174878:1174892	attL	TGAATGGAAAGCTGA	NA	NA	NA	NA
WP_000741325.1|1175752_1176895_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21929	Phage_21	80.3	8.2e-174
WP_000089141.1|1176884_1177121_-	excisionase	NA	NA	NA	NA	NA
WP_000069465.1|1177170_1177722_-	hypothetical protein	NA	A0A192Y7X3	Salmonella_phage	34.5	2.8e-10
WP_000066251.1|1177718_1178051_-	hypothetical protein	NA	S4TNP2	Salmonella_phage	81.8	8.8e-20
WP_001033922.1|1178043_1178364_-	hypothetical protein	NA	A0A222YY67	Escherichia_phage	59.2	1.8e-33
WP_001126029.1|1178399_1179230_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	72.0	1.3e-104
WP_022664343.1|1179222_1181934_-	PD-(D/E)XK nuclease-like domain-containing protein	NA	H6WRX1	Salmonella_phage	39.6	1.2e-125
WP_000551857.1|1182074_1182245_-	hypothetical protein	NA	K7PGY4	Enterobacteria_phage	49.0	9.7e-07
WP_000373340.1|1182644_1182851_+	hypothetical protein	NA	K7P7I0	Enterobacteria_phage	67.6	7.4e-17
WP_000368620.1|1182958_1184044_-	ParA family protein	NA	H2BD62	Pseudomonas_phage	38.0	1.5e-60
WP_000169863.1|1184195_1184663_-	helix-turn-helix domain-containing protein	NA	K7PHG0	Enterobacteria_phage	86.9	3.2e-68
WP_000145711.1|1184676_1184904_+	helix-turn-helix domain-containing protein	NA	K7PKS2	Enterobacteria_phage	95.9	1.5e-34
WP_072143007.1|1184869_1185244_+	hypothetical protein	NA	S4TTD7	Salmonella_phage	97.6	2.8e-62
WP_000024048.1|1185335_1186241_+	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	96.3	4.4e-170
WP_000788827.1|1186237_1186930_+	Replication protein 14	NA	G8C7U6	Escherichia_phage	60.2	1.8e-78
WP_000065092.1|1186944_1187610_+	ead/Ea22-like family protein	NA	A0A1V0E5L5	Salmonella_phage	44.9	2.8e-25
WP_000852188.1|1187611_1188082_+	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	80.1	1.1e-68
WP_000208067.1|1188084_1188738_+	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	52.0	6.3e-62
WP_000002116.1|1188730_1189012_+	ASCH domain-containing protein	NA	A0A0F6R7P5	Escherichia_coli_O157_typing_phage	95.7	3.2e-47
WP_001217669.1|1189573_1189807_+	DinI family protein	NA	H6WRY5	Salmonella_phage	100.0	5.6e-37
1189276:1189290	attR	TGAATGGAAAGCTGA	NA	NA	NA	NA
WP_014343878.1|1189923_1190172_+	hypothetical protein	NA	A0A0U2C0C8	Salmonella_phage	100.0	1.6e-42
WP_000929785.1|1190206_1190806_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	81.0	1.7e-93
WP_000784702.1|1190802_1190997_+	hypothetical protein	NA	S4TNP0	Salmonella_phage	61.5	1.4e-12
WP_000926953.1|1190978_1191275_+	DUF1364 family protein	NA	K7P7Q1	Enterobacteria_phage	79.1	3.9e-35
WP_000639984.1|1191271_1191826_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	65.3	3.4e-64
WP_000211401.1|1192092_1192653_+	ORF6N domain-containing protein	NA	A0A2R2Z302	Escherichia_phage	71.1	1.1e-41
WP_000658040.1|1192895_1193084_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000690097.1|1193237_1193456_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001533418.1|1193467_1193935_-	DUF2441 domain-containing protein	NA	NA	NA	NA	NA
WP_001533331.1|1194184_1194487_+|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_001208107.1|1194464_1195004_+	lysozyme	NA	S5MQK2	Escherichia_phage	74.1	5.7e-77
WP_086015771.1|1195321_1195777_+|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	78.8	8.0e-56
WP_000669689.1|1196003_1196405_-	PPC domain-containing protein	NA	NA	NA	NA	NA
WP_001102153.1|1196690_1197236_+|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	80.6	1.5e-56
WP_000623088.1|1197207_1199139_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.9	1.3e-259
WP_000201415.1|1199122_1199326_+	gpW family protein	NA	K7PM10	Enterobacteria_phage	73.8	1.9e-17
WP_000831821.1|1199322_1200903_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	62.8	9.6e-189
WP_001189493.1|1200892_1202389_+	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	52.7	4.3e-98
WP_000011260.1|1202401_1202749_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	52.7	9.2e-20
WP_000522566.1|1202803_1203832_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.1	1.7e-114
WP_000201486.1|1203889_1204249_+	DNA-packaging protein FI	NA	NA	NA	NA	NA
WP_000083294.1|1204259_1204643_+|head,tail	head-tail joining protein	head,tail	A0A0K2FJB7	Enterobacteria_phage	55.6	9.2e-29
WP_000677089.1|1204670_1205249_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	80.2	3.7e-82
WP_000817263.1|1205297_1206428_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q9G0F2	Phage_Gifsy-1	100.0	9.2e-218
WP_000033885.1|1206536_1206938_+|tail	tail protein	tail	Q9G0F3	Phage_Gifsy-1	100.0	8.1e-52
WP_000971954.1|1206945_1207692_+	Ig-like domain-containing protein	NA	A0A291AWU6	Escherichia_phage	76.9	1.9e-99
WP_000479607.1|1207742_1208138_+|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	56.5	2.3e-30
WP_010989052.1|1208134_1208473_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	62.4	1.3e-31
WP_000372072.1|1208444_1211540_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.3	6.1e-280
WP_000447369.1|1211542_1211872_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	70.4	1.3e-42
WP_001152689.1|1211881_1212580_+|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	76.3	5.5e-104
WP_000662739.1|1212586_1213324_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	85.0	5.2e-129
WP_000246126.1|1213221_1213869_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	77.7	2.1e-89
WP_000514918.1|1213930_1217293_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	79.9	0.0e+00
WP_000178849.1|1217331_1217574_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038407301.1|1217627_1220069_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0K2FIZ6	Escherichia_phage	62.0	2.5e-87
WP_000143179.1|1220068_1220653_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	84.8	1.7e-87
>prophage 3
NZ_CP007804	Salmonella enterica subsp. enterica serovar Typhimurium strain VNP20009 chromosome, complete genome	4763557	1866004	1872813	4763557	integrase,tail	Salmonella_phage(33.33%)	11	1860867:1860889	1870582:1870604
1860867:1860889	attL	AAAAAGAGACCGAATACGATTCC	NA	NA	NA	NA
WP_000275418.1|1866004_1866886_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	76.0	2.2e-65
WP_001521334.1|1867358_1867547_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000789530.1|1867611_1867779_+	lytic enzyme	NA	NA	NA	NA	NA
WP_001050882.1|1868035_1868569_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	48.3	1.4e-11
WP_001013467.1|1868622_1868853_-	hypothetical protein	NA	Q8HA86	Salmonella_phage	93.7	6.1e-28
WP_010989030.1|1869042_1869537_+	hypothetical protein	NA	A0A0U2I1R6	Escherichia_phage	68.9	8.2e-22
WP_187703527.1|1869608_1870451_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	50.5	9.6e-71
WP_000722368.1|1870824_1871178_-	YebY family protein	NA	NA	NA	NA	NA
1870582:1870604	attR	AAAAAGAGACCGAATACGATTCC	NA	NA	NA	NA
WP_000979702.1|1871194_1872070_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000168393.1|1872070_1872445_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000856224.1|1872582_1872813_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	2.9e-14
>prophage 4
NZ_CP007804	Salmonella enterica subsp. enterica serovar Typhimurium strain VNP20009 chromosome, complete genome	4763557	1947753	2027097	4763557	terminase,protease,integrase,lysis,capsid,head,portal,tail,transposase,holin,plate	Salmonella_phage(86.36%)	102	1954291:1954306	2028720:2028735
WP_000502119.1|1947753_1948212_-|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
WP_000659236.1|1948392_1949598_-	flagellin lysine-N-methylase	NA	NA	NA	NA	NA
WP_000079805.1|1949676_1951164_-	FliC/FljB family flagellin	NA	NA	NA	NA	NA
WP_000146802.1|1951420_1952824_+	flagellar filament capping protein FliD	NA	NA	NA	NA	NA
WP_000287764.1|1952838_1953246_+	flagellar export chaperone FliS	NA	NA	NA	NA	NA
WP_000204899.1|1953245_1953614_+	flagella biosynthesis regulatory protein FliT	NA	NA	NA	NA	NA
WP_000795487.1|1953685_1955170_+	alpha-amylase	NA	NA	NA	NA	NA
1954291:1954306	attL	TGAAAATATCGATTTT	NA	NA	NA	NA
WP_000754695.1|1955209_1955635_-	lipoprotein	NA	NA	NA	NA	NA
WP_001535233.1|1955820_1957026_+	selenium metabolism membrane protein YedE/FdhT	NA	NA	NA	NA	NA
WP_000790504.1|1957022_1957256_+	sulfurtransferase-like selenium metabolism protein YedF	NA	NA	NA	NA	NA
WP_000639596.1|1957520_1957907_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000719036.1|1958026_1958341_-	flagellar hook-basal body complex protein FliE	NA	NA	NA	NA	NA
WP_001276834.1|1958557_1960240_+	flagellar M-ring protein FliF	NA	NA	NA	NA	NA
WP_000067735.1|1960232_1961228_+	flagellar motor switch protein FliG	NA	NA	NA	NA	NA
WP_000064163.1|1961220_1961928_+	flagellar assembly protein FliH	NA	NA	NA	NA	NA
WP_000213257.1|1961927_1963298_+	flagellum-specific ATP synthase FliI	NA	NA	NA	NA	NA
WP_000046981.1|1963319_1963763_+	flagella biosynthesis chaperone FliJ	NA	NA	NA	NA	NA
WP_000631669.1|1963759_1964977_+	flagellar hook length control protein FliK	NA	NA	NA	NA	NA
WP_000132169.1|1965081_1965549_+	flagellar basal body-associated protein FliL	NA	NA	NA	NA	NA
WP_000502811.1|1965553_1966558_+	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
WP_001282115.1|1966554_1966968_+	flagellar motor switch protein FliN	NA	NA	NA	NA	NA
WP_000978276.1|1966967_1967345_+	flagellar type III secretion system protein FliO	NA	NA	NA	NA	NA
WP_001253410.1|1967344_1968082_+	flagellar type III secretion system pore protein FliP	NA	NA	NA	NA	NA
WP_000187355.1|1968091_1968361_+	flagellar biosynthesis protein FliQ	NA	NA	NA	NA	NA
WP_000616953.1|1968369_1969164_+	flagellar type III secretion system protein FliR	NA	NA	NA	NA	NA
WP_000103974.1|1969445_1970069_+	transcriptional regulator RcsA	NA	NA	NA	NA	NA
WP_000867218.1|1970107_1970302_-	protein DsrB	NA	NA	NA	NA	NA
WP_000844798.1|1970430_1970658_+	YodD family peroxide/acid resistance protein	NA	NA	NA	NA	NA
WP_000948794.1|1970967_1971783_+	mannosyl-3-phosphoglycerate phosphatase-related protein	NA	NA	NA	NA	NA
WP_001119821.1|1971761_1973474_-	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	37.4	1.2e-19
WP_000232161.1|1973638_1973824_-	YodC family protein	NA	NA	NA	NA	NA
WP_085983315.1|1973900_1974818_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_001212264.1|1974987_1975908_+	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_000785978.1|1975896_1976367_-	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	46.9	1.2e-30
WP_001157322.1|1976347_1977778_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
WP_000377041.1|1977851_1978547_-	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	2.8e-07
WP_000107430.1|1978638_1978938_-	membrane protein	NA	NA	NA	NA	NA
WP_001080680.1|1979587_1980784_+	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.1	1.8e-110
WP_024131109.1|1981044_1981233_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000208509.1|1981243_1981456_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_000457662.1|1981910_1983179_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	92.2	4.2e-227
WP_000394196.1|1983181_1983601_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_000500831.1|1983727_1983889_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001526483.1|1984519_1984741_-	helix-turn-helix domain-containing protein	NA	Q8HAB1	Salmonella_phage	100.0	1.2e-36
WP_000492926.1|1984953_1985961_+	type III secretion system effector arginine glycosyltransferase	NA	Q8HAB2	Salmonella_phage	100.0	7.9e-197
WP_015701331.1|1986245_1986845_-|tail	tail fiber assembly protein	tail	Q8HAB3	Salmonella_phage	100.0	5.9e-107
WP_000554737.1|1986814_1988377_-	hypothetical protein	NA	Q8HAB4	Salmonella_phage	100.0	2.6e-287
WP_001207832.1|1988363_1988951_-	DUF2313 domain-containing protein	NA	A0A192Y5V3	Salmonella_phage	100.0	2.9e-114
WP_014343855.1|1988953_1989475_-|plate	baseplate J/gp47 family protein	plate	Q8HAB6	Salmonella_phage	100.0	2.9e-94
WP_014343856.1|1989509_1990055_-|plate	baseplate J/gp47 family protein	plate	Q8HAB7	Salmonella_phage	100.0	9.2e-99
WP_000605050.1|1990026_1990440_-	phage GP46 family protein	NA	Q8HAB8	Salmonella_phage	100.0	1.1e-75
WP_001273649.1|1990444_1990978_-|plate	phage baseplate assembly protein	plate	Q8HAB9	Salmonella_phage	100.0	1.4e-96
WP_001066636.1|1990977_1992036_-	hypothetical protein	NA	Q8HAC0	Salmonella_phage	100.0	1.3e-202
WP_000863818.1|1992032_1993373_-	DNA circularization N-terminal domain-containing protein	NA	A0A192Y5U9	Salmonella_phage	99.6	5.7e-251
WP_000785385.1|1993406_1995335_-|tail	phage tail tape measure protein	tail	Q8HAC2	Salmonella_phage	99.8	0.0e+00
WP_000588852.1|1995419_1995746_-|tail	phage tail assembly protein	tail	Q8HAC3	Salmonella_phage	99.1	2.3e-52
WP_000515952.1|1995742_1996099_-|tail	phage tail tube protein	tail	A0A192Y8K0	Salmonella_phage	100.0	2.6e-62
WP_001007991.1|1996098_1997595_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	Q8HAC5	Salmonella_phage	100.0	2.7e-278
WP_000497739.1|1997584_1997749_-	DUF2635 domain-containing protein	NA	Q8HAC6	Salmonella_phage	100.0	1.0e-24
WP_000779218.1|1997752_1998313_-	hypothetical protein	NA	Q8HAC7	Salmonella_phage	100.0	3.0e-105
WP_001135697.1|1998309_1998822_-	hypothetical protein	NA	Q8HAC8	Salmonella_phage	100.0	4.6e-92
WP_000702408.1|1998793_1999198_-|head	phage head closure protein	head	Q8HAC9	Salmonella_phage	100.0	1.4e-72
WP_000927378.1|1999194_1999518_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A192Y8J4	Salmonella_phage	100.0	6.3e-55
WP_000601353.1|1999520_1999721_-	hypothetical protein	NA	Q8HAD1	Salmonella_phage	100.0	1.4e-28
WP_000257528.1|1999771_2000977_-|capsid	phage major capsid protein	capsid	Q8HAD2	Salmonella_phage	100.0	1.6e-223
WP_001193639.1|2000991_2001642_-|head,protease	HK97 family phage prohead protease	head,protease	Q8HAD3	Salmonella_phage	100.0	1.5e-119
WP_000466254.1|2001619_2002861_-|portal	phage portal protein	portal	Q8HAD4	Salmonella_phage	99.8	2.0e-242
WP_000605609.1|2002860_2003043_-	hypothetical protein	NA	Q8HAD5	Salmonella_phage	100.0	1.0e-25
WP_000088182.1|2003054_2004788_-|terminase	terminase large subunit	terminase	Q8HAD6	Salmonella_phage	100.0	0.0e+00
WP_000929191.1|2004784_2005279_-|terminase	phage terminase small subunit P27 family	terminase	Q8HAD7	Salmonella_phage	100.0	4.6e-89
WP_001135225.1|2005404_2005755_-	HNH endonuclease	NA	Q8HA82	Salmonella_phage	100.0	2.5e-65
WP_001292890.1|2005815_2006118_-	hypothetical protein	NA	Q8HA83	Salmonella_phage	100.0	3.6e-52
WP_000877027.1|2006337_2006757_-	KilA-N domain-containing protein	NA	Q8HA84	Salmonella_phage	100.0	4.8e-71
WP_001050825.1|2006969_2007455_-|lysis	lysis protein	lysis	Q8HA85	Salmonella_phage	100.0	5.9e-81
WP_001005901.1|2007451_2008066_-	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	100.0	9.3e-116
WP_001527046.1|2008068_2008413_-|holin	phage holin, lambda family	holin	Q8HA87	Salmonella_phage	100.0	5.3e-44
WP_014343859.1|2008574_2009009_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001527054.1|2008938_2009196_-	hypothetical protein	NA	Q8HA88	Salmonella_phage	100.0	5.2e-44
WP_000188927.1|2009328_2009952_-	hypothetical protein	NA	Q8HA89	Salmonella_phage	100.0	9.1e-119
WP_001202278.1|2009962_2010952_-	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.6	9.2e-190
WP_001061457.1|2010959_2011820_-	KilA-N domain-containing protein	NA	Q8HA92	Salmonella_phage	100.0	2.9e-163
WP_001241579.1|2011836_2012226_-	RusA family crossover junction endodeoxyribonuclease	NA	Q8HA93	Salmonella_phage	100.0	3.7e-70
WP_000066908.1|2012222_2013116_-	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	100.0	7.6e-175
WP_001684745.1|2013115_2013598_-	PerC family transcriptional regulator	NA	Q8HA95	Salmonella_phage	100.0	1.1e-87
WP_000061500.1|2013599_2014418_-	helix-turn-helix domain-containing protein	NA	Q8HA96	Salmonella_phage	100.0	2.8e-136
WP_000620702.1|2014414_2014639_-	hypothetical protein	NA	A0A1C9II64	Salmonella_phage	100.0	3.3e-39
WP_001087402.1|2014635_2015793_-	Rha family phage regulatory protein	NA	Q8HA97	Salmonella_phage	100.0	4.2e-218
WP_000509731.1|2015789_2016344_-	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	100.0	6.9e-102
WP_001191666.1|2016372_2016597_-	helix-turn-helix transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	100.0	1.9e-34
WP_001020636.1|2016694_2017390_+	helix-turn-helix transcriptional regulator	NA	Q8HAA0	Salmonella_phage	100.0	3.2e-128
WP_000997190.1|2018204_2018576_+	hypothetical protein	NA	Q8HAA1	Salmonella_phage	100.0	1.1e-63
WP_000080415.1|2018633_2019461_+	DUF2303 family protein	NA	Q8HAA2	Salmonella_phage	100.0	7.5e-153
WP_000008351.1|2019597_2020137_+	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	100.0	2.6e-98
WP_000764235.1|2020207_2020438_+	hypothetical protein	NA	Q8HAA4	Salmonella_phage	100.0	2.0e-34
WP_000071070.1|2020434_2020950_+	DUF262 domain-containing protein	NA	Q8HAA5	Salmonella_phage	100.0	7.4e-98
WP_000065095.1|2020946_2021564_+	ead/Ea22-like family protein	NA	Q8HAA6	Salmonella_phage	100.0	2.6e-113
WP_000208068.1|2021560_2022394_+	hypothetical protein	NA	Q8HAA7	Salmonella_phage	100.0	4.7e-163
WP_001061334.1|2022397_2022967_+	3'-5' exoribonuclease	NA	A0A192Y6E0	Salmonella_phage	100.0	7.1e-110
WP_001527041.1|2023006_2023234_+	DUF4224 domain-containing protein	NA	Q8HAA9	Salmonella_phage	100.0	3.2e-37
WP_000532847.1|2023235_2024225_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	100.0	8.6e-196
WP_000598920.1|2024516_2025314_+	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_001219015.1|2026623_2027097_+	peptidase	NA	A0A0F6TJ61	Escherichia_coli_O157_typing_phage	77.6	7.1e-39
2028720:2028735	attR	TGAAAATATCGATTTT	NA	NA	NA	NA
>prophage 5
NZ_CP007804	Salmonella enterica subsp. enterica serovar Typhimurium strain VNP20009 chromosome, complete genome	4763557	2113091	2123597	4763557		Enterobacteria_phage(37.5%)	10	NA	NA
WP_000126349.1|2113091_2114405_-	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
WP_000565905.1|2114431_2115511_-	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	6.6e-16
WP_000648784.1|2115515_2116289_-	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000018226.1|2116285_2117278_-	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000973708.1|2117283_2117835_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	2.2e-52
WP_000857529.1|2117835_2118714_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	9.3e-109
WP_001023662.1|2118761_2119661_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	1.4e-30
WP_000697840.1|2119660_2120746_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.2e-102
WP_000981469.1|2121122_2122016_-	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_001111841.1|2122193_2123597_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	27.1	3.1e-21
>prophage 6
NZ_CP007804	Salmonella enterica subsp. enterica serovar Typhimurium strain VNP20009 chromosome, complete genome	4763557	2191905	2201076	4763557	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000195332.1|2191905_2193939_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
WP_000703137.1|2194179_2194638_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_001197952.1|2194809_2195340_+	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000950413.1|2195396_2195864_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_000598637.1|2195910_2196630_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000272845.1|2196626_2198312_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	6.2e-279
WP_001240418.1|2198534_2199266_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_001261696.1|2199325_2199433_+	protein YohO	NA	NA	NA	NA	NA
WP_000824855.1|2199413_2200145_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000569166.1|2200128_2201076_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.7e-23
>prophage 7
NZ_CP007804	Salmonella enterica subsp. enterica serovar Typhimurium strain VNP20009 chromosome, complete genome	4763557	2220483	2286878	4763557	lysis,tail,holin	Salmonella_phage(28.57%)	60	NA	NA
WP_000989296.1|2220483_2221179_+|lysis	CidB/LrgB family autolysis modulator	lysis	NA	NA	NA	NA
WP_000553526.1|2221332_2222217_+	cytidine deaminase	NA	NA	NA	NA	NA
WP_000920081.1|2222393_2223113_+	outer membrane permeability protein SanA	NA	NA	NA	NA	NA
WP_000605187.1|2223109_2223355_+	DUF2542 family protein	NA	NA	NA	NA	NA
WP_001136409.1|2223559_2224801_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000956095.1|2224794_2226030_+	NAD-dependent dihydropyrimidine dehydrogenase subunit PreA	NA	NA	NA	NA	NA
WP_001275101.1|2226104_2227115_-	galactose/methyl galactoside ABC transporter permease MglC	NA	NA	NA	NA	NA
WP_000535907.1|2227130_2228651_-	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	31.9	1.0e-09
WP_001036943.1|2228784_2229783_-	galactose/glucose ABC transporter substrate-binding protein MglB	NA	NA	NA	NA	NA
WP_000628631.1|2230281_2231304_-	HTH-type transcriptional regulator GalS	NA	NA	NA	NA	NA
WP_001526153.1|2231453_2232596_-	DUF418 family protein	NA	NA	NA	NA	NA
WP_001139611.1|2232610_2233279_-	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.3	4.1e-56
WP_000425488.1|2233608_2234466_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000876817.1|2234454_2234844_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000443208.1|2234848_2236216_-	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_000022915.1|2236432_2237320_+	phosphoserine phosphatase SerB	NA	NA	NA	NA	NA
WP_000023807.1|2237352_2238675_+	MFS transporter	NA	NA	NA	NA	NA
WP_000488255.1|2238718_2240710_-	catecholate siderophore receptor CirA	NA	A0A0P0I887	Acinetobacter_phage	37.9	6.7e-14
WP_000535000.1|2241054_2242524_-	lysine-specific permease	NA	NA	NA	NA	NA
WP_000548308.1|2242713_2243577_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000137961.1|2243697_2244747_+	YeiH family protein	NA	NA	NA	NA	NA
WP_000873909.1|2244825_2245683_+	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	28.5	2.2e-22
WP_000854414.1|2245747_2247436_-	PTS fructose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_000091249.1|2247452_2248391_-	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_000487287.1|2248390_2249521_-	fused PTS fructose transporter subunit IIA/HPr protein	NA	NA	NA	NA	NA
WP_000551937.1|2249889_2251071_+	sugar efflux transporter SetB	NA	NA	NA	NA	NA
WP_001213882.1|2251135_2251801_-	membrane protein	NA	NA	NA	NA	NA
WP_001519564.1|2251802_2251925_-	membrane protein	NA	NA	NA	NA	NA
WP_010989043.1|2252312_2252567_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001136822.1|2252890_2253463_+	elongation factor P-like protein YeiP	NA	NA	NA	NA	NA
WP_000169350.1|2253675_2254662_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_000178095.1|2254691_2255411_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_000241015.1|2255824_2256397_+	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.9	8.1e-13
WP_000957746.1|2256722_2258279_+	cyclic di-GMP phosphodiesterase	NA	NA	NA	NA	NA
WP_000561748.1|2258385_2260191_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000501623.1|2260200_2261295_+	microcin C ABC transporter permease YejB	NA	NA	NA	NA	NA
WP_001137764.1|2261294_2262320_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000203622.1|2262321_2263911_+	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	32.5	8.5e-20
WP_001094639.1|2263914_2264259_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000213347.1|2264649_2265840_-	Bcr/CflA family multidrug efflux MFS transporter	NA	S4TR35	Salmonella_phage	22.2	2.4e-19
WP_001234836.1|2265867_2266563_-	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_000578121.1|2266714_2268475_+	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	41.6	1.9e-100
WP_000494192.1|2268599_2268884_+	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_000033440.1|2268992_2269613_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000050806.1|2269640_2270648_-	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	48.3	4.5e-83
WP_001135904.1|2270827_2271055_+	YejL family protein	NA	NA	NA	NA	NA
WP_000256150.1|2271086_2272847_+	cardiolipin transport protein PbgA	NA	NA	NA	NA	NA
WP_000806401.1|2273127_2273631_-	LexA family transcriptional regulator	NA	Q1MVE7	Enterobacteria_phage	71.3	9.5e-50
WP_000884778.1|2273658_2273949_+	DinI family protein	NA	S4TND2	Salmonella_phage	83.3	4.7e-25
WP_038407345.1|2274296_2276126_+	acyltransferase	NA	C6ZR20	Salmonella_phage	29.6	4.4e-60
WP_000022213.1|2276179_2276623_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	43.9	1.4e-28
WP_001215679.1|2277000_2277528_-|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	31.3	3.1e-11
WP_000554739.1|2277530_2278772_-	hypothetical protein	NA	Q8HAB4	Salmonella_phage	95.3	1.0e-52
WP_001120499.1|2279364_2279694_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	94.6	3.9e-36
WP_000894640.1|2279990_2281322_+	AAA family ATPase	NA	R9TRQ8	Vibrio_phage	28.5	2.1e-19
WP_010989045.1|2281350_2281719_-	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	81.7	7.4e-52
WP_014344510.1|2281733_2282723_-	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.3	2.4e-190
WP_001115840.1|2283051_2285418_-	SPI-2 type III secretion system effector E3 ubiquitin transferase SspH2	NA	Q9MBL9	Phage_Gifsy-2	88.7	2.9e-72
WP_001113462.1|2285586_2285790_-|tail	tail protein	tail	NA	NA	NA	NA
WP_000624225.1|2286086_2286878_-|tail	tail fiber protein	tail	Q1MVL8	Enterobacteria_phage	31.6	1.7e-48
>prophage 8
NZ_CP007804	Salmonella enterica subsp. enterica serovar Typhimurium strain VNP20009 chromosome, complete genome	4763557	2628427	2735575	4763557	terminase,protease,integrase,lysis,capsid,head,portal,tail,transposase,tRNA,holin	Salmonella_phage(33.33%)	112	2652972:2652988	2743479:2743495
WP_000940032.1|2628427_2629159_-|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
WP_000553467.1|2629277_2630081_+	inositol-1-monophosphatase	NA	NA	NA	NA	NA
WP_000174944.1|2630225_2631104_+	alpha/beta hydrolase	NA	A0A1C9C5K3	Heterosigma_akashiwo_virus	24.7	3.5e-15
WP_000985204.1|2631285_2632329_+	anaerobic sulfite reductase subunit A	NA	NA	NA	NA	NA
WP_000017587.1|2632332_2633151_+	anaerobic sulfite reductase subunit B	NA	NA	NA	NA	NA
WP_000020685.1|2633161_2634175_+	sulfite reductase subunit C	NA	NA	NA	NA	NA
WP_000111027.1|2634175_2635162_-	nickel/cobalt transporter	NA	NA	NA	NA	NA
WP_000805728.1|2635152_2635791_-	DUF1007 family protein	NA	NA	NA	NA	NA
WP_000982961.1|2635916_2637194_+	stationary phase inducible protein CsiE	NA	NA	NA	NA	NA
WP_001173729.1|2637188_2638328_-	3-phenylpropionate MFS transporter	NA	NA	NA	NA	NA
WP_000919178.1|2638523_2639777_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	53.0	1.3e-100
WP_000883146.1|2640101_2641292_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_001187150.1|2641473_2643018_+	lysine decarboxylation/transport transcriptional activator CadC	NA	NA	NA	NA	NA
WP_000100008.1|2643378_2644710_+	cadaverine/lysine antiporter	NA	NA	NA	NA	NA
WP_001100652.1|2644792_2646937_+	lysine decarboxylase CadA	NA	NA	NA	NA	NA
WP_000856793.1|2646992_2648453_+	dipeptide permease DtpD	NA	A0A0P0IY73	Acinetobacter_phage	28.8	1.7e-46
WP_000717694.1|2648501_2648840_-	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_000625591.1|2648916_2650254_-	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	29.2	1.8e-10
WP_001054236.1|2650250_2651015_-	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_001670672.1|2651016_2652447_-	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	26.1	2.0e-15
2652972:2652988	attL	CGCCTTATCCGGCCTAC	NA	NA	NA	NA
WP_000970045.1|2653096_2656984_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	57.6	1.4e-127
WP_001747289.1|2657005_2657239_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000734258.1|2657239_2658784_+	membrane-bound lytic murein transglycosylase MltF	NA	NA	NA	NA	NA
WP_001134566.1|2658834_2659386_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
WP_000253558.1|2659410_2660046_-	phosphatidylglycerophosphatase C	NA	NA	NA	NA	NA
WP_000361663.1|2660049_2661411_-	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_001048530.1|2661421_2662315_-	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_000995703.1|2662430_2663279_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000684022.1|2663317_2664235_-	oxidoreductase	NA	NA	NA	NA	NA
WP_001276370.1|2664256_2665453_-	OFA family MFS transporter	NA	NA	NA	NA	NA
WP_001022463.1|2665568_2666495_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	24.4	3.0e-09
WP_001196290.1|2666532_2666793_+	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	1.4e-17
WP_000986043.1|2666904_2667285_-	holo-ACP synthase	NA	NA	NA	NA	NA
WP_000818972.1|2667284_2668016_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_000399380.1|2668027_2668756_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_000102232.1|2668767_2669673_-	GTPase Era	NA	NA	NA	NA	NA
WP_001068341.1|2669669_2670350_-	ribonuclease III	NA	A0A2K9L5P0	Tupanvirus	31.8	7.4e-21
WP_000002559.1|2670623_2671598_-	signal peptidase I	NA	NA	NA	NA	NA
WP_000790154.1|2671614_2673414_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	24.9	7.2e-23
WP_010989047.1|2673818_2675312_+	type III secretion effector GogB	NA	Q9MBM1	Phage_Gifsy-1	100.0	3.4e-260
WP_001542312.1|2675790_2675928_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001526383.1|2676640_2676760_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_001738443.1|2677512_2677725_-	helix-turn-helix domain-containing protein	NA	S4TTF2	Salmonella_phage	90.6	3.8e-08
WP_010989049.1|2677831_2678059_+	phage virulence factor PagK family protein	NA	NA	NA	NA	NA
WP_000143154.1|2678155_2678734_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	88.9	3.6e-93
WP_000593433.1|2678723_2679548_-	macro domain-containing protein	NA	A0A0M4QWS3	Salmonella_phage	92.0	1.2e-145
WP_001144691.1|2679544_2681917_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0K2FIZ6	Escherichia_phage	65.6	1.1e-90
WP_000178853.1|2681970_2682213_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000514917.1|2682251_2685614_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	79.7	0.0e+00
WP_000246126.1|2685675_2686323_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	77.7	2.1e-89
WP_000662739.1|2686220_2686958_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	85.0	5.2e-129
WP_001152689.1|2686964_2687663_-|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	76.3	5.5e-104
WP_000447369.1|2687672_2688002_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	70.4	1.3e-42
WP_000372072.1|2688004_2691100_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.3	6.1e-280
WP_010989052.1|2691071_2691410_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	62.4	1.3e-31
WP_000479607.1|2691406_2691802_-|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	56.5	2.3e-30
WP_000971954.1|2691852_2692599_-	Ig-like domain-containing protein	NA	A0A291AWU6	Escherichia_phage	76.9	1.9e-99
WP_000033885.1|2692606_2693008_-|tail	tail protein	tail	Q9G0F3	Phage_Gifsy-1	100.0	8.1e-52
WP_038407360.1|2693116_2694247_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q9G0F2	Phage_Gifsy-1	99.2	1.9e-215
WP_001534814.1|2694295_2694874_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	80.7	1.7e-82
WP_000083294.1|2694901_2695285_-|head,tail	head-tail joining protein	head,tail	A0A0K2FJB7	Enterobacteria_phage	55.6	9.2e-29
WP_038407362.1|2695295_2695661_-	DNA-packaging protein FI	NA	NA	NA	NA	NA
WP_000522566.1|2695718_2696747_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.1	1.7e-114
WP_000011260.1|2696801_2697149_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	52.7	9.2e-20
WP_001189503.1|2697161_2698658_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	52.2	8.1e-97
WP_038407364.1|2698647_2700228_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	62.8	5.6e-189
WP_000201415.1|2700224_2700428_-	gpW family protein	NA	K7PM10	Enterobacteria_phage	73.8	1.9e-17
WP_000623091.1|2700411_2702343_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.7	6.3e-259
WP_001102153.1|2702314_2702860_-|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	80.6	1.5e-56
WP_000669690.1|2703146_2703548_+	PPC domain-containing protein	NA	NA	NA	NA	NA
WP_001533543.1|2703783_2704236_-|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	92.7	2.9e-66
WP_000984581.1|2704253_2704706_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	97.3	5.1e-79
WP_001574216.1|2704689_2705019_-|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_001110783.1|2705294_2705981_+|protease	type III secretion system effector protease GogA	protease	Q9MBM2	Phage_Gifsy-1	100.0	9.4e-133
WP_000657897.1|2706195_2706384_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000211410.1|2706890_2707454_-	ORF6N domain-containing protein	NA	A0A0P0ZC44	Stx2-converting_phage	92.2	7.6e-56
WP_001097241.1|2707726_2708404_-	antitermination protein	NA	I6PDF8	Cronobacter_phage	54.0	7.7e-63
WP_000801757.1|2708400_2708541_-	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	78.9	7.2e-08
WP_001096550.1|2708537_2709149_-	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	99.0	1.2e-91
WP_000929791.1|2709357_2709960_-	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	99.0	2.8e-109
WP_014343878.1|2709994_2710243_-	hypothetical protein	NA	A0A0U2C0C8	Salmonella_phage	100.0	1.6e-42
WP_001217669.1|2710359_2710593_-	DinI family protein	NA	H6WRY5	Salmonella_phage	100.0	5.6e-37
WP_000877757.1|2710835_2711468_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000664368.1|2711575_2712274_-	DUF550 domain-containing protein	NA	A0A0M4RTV1	Salmonella_phage	85.7	2.1e-63
WP_000801764.1|2712287_2712983_-	hypothetical protein	NA	G8C7U6	Escherichia_phage	45.4	2.1e-55
WP_000024044.1|2712979_2713864_-	replication protein	NA	K7PGT1	Enterobacteria_phage	47.2	1.3e-46
WP_010835408.1|2713955_2714330_-	hypothetical protein	NA	S4TTD7	Salmonella_phage	98.4	1.9e-63
WP_000643689.1|2714289_2714532_-	helix-turn-helix domain-containing protein	NA	A0A0M4QX15	Salmonella_phage	64.1	2.1e-23
WP_000660736.1|2714631_2715027_+	helix-turn-helix domain-containing protein	NA	K7PM35	Enterobacteria_phage	61.4	1.9e-37
WP_001111772.1|2715085_2715925_+	AAA family ATPase	NA	A0A1X9IGI7	Lactococcus_phage	33.3	1.5e-31
WP_000356948.1|2715917_2716304_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000950426.1|2716303_2716966_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000917562.1|2717422_2717581_+	hypothetical protein	NA	H6WRX3	Salmonella_phage	98.1	9.0e-23
WP_001539619.1|2717602_2717953_+	hypothetical protein	NA	S4TSN6	Salmonella_phage	97.4	1.1e-60
WP_000017125.1|2718079_2721007_+	PD-(D/E)XK nuclease-like domain-containing protein	NA	S4TNL0	Salmonella_phage	99.3	0.0e+00
WP_077248255.1|2720969_2722127_+	recombinase RecT	NA	S4TTE8	Salmonella_phage	99.5	3.9e-216
WP_001237031.1|2722169_2722409_+	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_001670787.1|2722449_2722734_+	excisionase Xis	NA	H6WRW8	Salmonella_phage	86.2	3.1e-42
WP_001007939.1|2722711_2723941_-|integrase	site-specific integrase	integrase	H6WRW7	Salmonella_phage	94.4	2.9e-233
WP_000589087.1|2724438_2724918_-	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
WP_000812017.1|2724914_2725871_-	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
WP_001168374.1|2725870_2726521_-	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_000003307.1|2726552_2727128_-	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_014344135.1|2727124_2727289_-	rpoE leader peptide RseD	NA	NA	NA	NA	NA
WP_022657248.1|2727552_2729175_+	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_000083343.1|2729159_2729897_-|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_000219174.1|2730027_2731362_+	ATP-dependent RNA helicase SrmB	NA	A0A1B1IS59	uncultured_Mediterranean_phage	29.7	1.6e-43
WP_001526875.1|2731379_2732279_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000188414.1|2732381_2732969_+	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000627811.1|2733030_2733414_-	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	74.0	6.1e-33
WP_000179978.1|2733732_2734422_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	49.5	4.6e-55
WP_000997368.1|2734537_2735575_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
2743479:2743495	attR	GTAGGCCGGATAAGGCG	NA	NA	NA	NA
>prophage 9
NZ_CP007804	Salmonella enterica subsp. enterica serovar Typhimurium strain VNP20009 chromosome, complete genome	4763557	4324748	4345168	4763557	holin,tail,plate	Burkholderia_phage(45.0%)	26	NA	NA
WP_000587738.1|4324748_4325477_-	hypothetical protein	NA	A0A077SLK3	Escherichia_phage	37.3	5.6e-35
WP_010989092.1|4325673_4325964_-	membrane protein	NA	NA	NA	NA	NA
WP_000084331.1|4326212_4326668_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001526208.1|4326664_4327270_-	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
WP_000368196.1|4327274_4329020_-|tail	tail fiber protein	tail	A0A0M3ULF6	Salmonella_phage	52.2	3.2e-52
WP_000359500.1|4329022_4329655_-|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	56.4	6.6e-24
WP_000951736.1|4329647_4330763_-|plate	baseplate J/gp47 family protein	plate	Q6QI99	Burkholderia_phage	52.2	1.8e-101
WP_001093501.1|4330753_4331113_-	GPW/gp25 family protein	NA	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
WP_001095011.1|4331276_4332824_-	membrane protein	NA	B9UDL6	Salmonella_phage	29.9	1.9e-48
WP_000703632.1|4332823_4333753_-	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	83.8	8.8e-150
WP_000593182.1|4333749_4334112_-	GtrA family protein	NA	I1TED9	Salmonella_phage	70.8	1.2e-43
WP_000679398.1|4334439_4335162_-|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	41.0	3.3e-11
WP_000818154.1|4335171_4336215_-	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	45.1	2.5e-76
WP_001269716.1|4336202_4336412_-|tail	tail protein X	tail	A4JWL2	Burkholderia_virus	60.3	9.8e-17
WP_000271423.1|4336411_4337365_-	methyl-accepting chemotaxis protein	NA	A4JWL1	Burkholderia_virus	50.8	2.3e-36
WP_001262500.1|4337364_4339719_-|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.6	6.9e-66
WP_001185654.1|4339815_4339944_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_001003642.1|4339903_4340221_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_000907494.1|4340272_4340797_-|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	2.8e-68
WP_000729852.1|4340796_4342224_-|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.9	1.1e-194
WP_000875314.1|4342213_4342411_-	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	8.6e-07
WP_000449433.1|4342407_4342863_-	Gp37 family protein	NA	NA	NA	NA	NA
WP_000777266.1|4343022_4343337_-	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
WP_001270440.1|4343349_4343955_-	lytic transglycosylase domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.4	1.2e-59
WP_001226442.1|4343957_4344245_-|holin	putative holin	holin	Q6QIC8	Burkholderia_phage	49.1	2.3e-16
WP_000615248.1|4344820_4345168_+	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
>prophage 1
NZ_CP008745	Salmonella enterica subsp. enterica serovar Typhimurium strain VNP20009 plasmid pSLT_VNP20009, complete sequence	93833	40862	50158	93833	transposase	Escherichia_phage(28.57%)	11	NA	NA
WP_001541564.1|40862_41279_+	hypothetical protein	NA	O64348	Escherichia_phage	42.9	8.2e-07
WP_001527010.1|41462_41798_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001541562.1|41854_42421_+	DUF2913 family protein	NA	NA	NA	NA	NA
WP_000728917.1|42452_43394_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	54.3	2.0e-72
WP_000427676.1|43808_45014_+	AAA family ATPase	NA	A0A077SL49	Escherichia_phage	69.3	1.5e-162
WP_000064274.1|45013_45988_+	ParB/RepB/Spo0J family partition protein	NA	A0A1B0V750	Salmonella_phage	53.2	5.1e-84
WP_000457541.1|46069_47344_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	64.5	3.0e-156
WP_000925627.1|47343_47766_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	51.6	1.0e-28
WP_000490265.1|48276_48747_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000369839.1|48739_49096_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000088645.1|49477_50158_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.4	1.6e-28
