The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP008797	Klebsiella pneumoniae subsp. pneumoniae KPNIH24 chromosome, complete genome	5396164	590779	596604	5396164		Enterobacteria_phage(100.0%)	8	NA	NA
WP_004152202.1|590779_591346_-	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	63.8	9.7e-59
WP_004152203.1|591363_591609_-	ogr/Delta-like zinc finger family protein	NA	Q7M294	Enterobacteria_phage	56.8	5.5e-19
WP_004152204.1|591605_592343_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	59.4	1.1e-70
WP_000556592.1|592903_593170_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	71.6	2.0e-30
WP_004153681.1|593166_593715_+	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	69.4	1.1e-30
WP_004152205.1|593711_593939_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152206.1|593935_594256_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_004152207.1|594270_596604_+	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	83.9	0.0e+00
>prophage 2
NZ_CP008797	Klebsiella pneumoniae subsp. pneumoniae KPNIH24 chromosome, complete genome	5396164	961972	1067038	5396164	head,capsid,portal,terminase,tRNA,integrase,tail,protease	uncultured_Caudovirales_phage(54.55%)	102	1015268:1015285	1031263:1031280
WP_002889286.1|961972_963406_+|protease	serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	30.3	3.9e-24
WP_002889289.1|963572_964730_+	DNA-binding transcriptional regulator CdaR	NA	NA	NA	NA	NA
WP_002889292.1|964848_965235_-	DUF3461 family protein	NA	NA	NA	NA	NA
WP_002889295.1|965342_966167_-	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
WP_004151931.1|966197_968861_-	bifunctional uridylyltransferase/uridylyl-removing protein GlnD	NA	NA	NA	NA	NA
WP_002889297.1|968918_969713_-	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_002889299.1|970035_970761_+	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_004151930.1|970880_971732_+	elongation factor Ts	NA	NA	NA	NA	NA
WP_002889306.1|971882_972608_+	UMP kinase	NA	NA	NA	NA	NA
WP_002889308.1|972758_973316_+	ribosome recycling factor	NA	NA	NA	NA	NA
WP_002889310.1|973544_974747_+	1-deoxy-D-xylulose-5-phosphate reductoisomerase	NA	NA	NA	NA	NA
WP_002889316.1|974984_975743_+	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	40.7	6.1e-24
WP_002889318.1|975755_976613_+	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_002889320.1|976624_977977_+|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
WP_002889322.1|978008_980438_+	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_002889325.1|980559_981045_+	molecular chaperone Skp	NA	NA	NA	NA	NA
WP_002889327.1|981048_982074_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_004145858.1|982179_982635_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_002889371.1|982638_983427_+	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_002889374.1|983426_984578_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_002889376.1|984574_985174_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	39.6	1.6e-27
WP_002889378.1|985191_988674_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.4	9.1e-208
WP_002889381.1|988686_989646_+	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_002889384.1|989759_991913_+	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
WP_002889387.1|991959_992349_+	VOC family protein	NA	NA	NA	NA	NA
WP_014342876.1|992402_993716_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_002889424.1|993729_993990_-	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_002889429.1|993976_994177_-	YaeP family protein	NA	NA	NA	NA	NA
WP_002889431.1|994373_994919_+	YaeQ family protein	NA	NA	NA	NA	NA
WP_002889433.1|994915_995329_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_002889435.1|995371_996070_+	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_002889437.1|996201_997044_-	YaeF family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_004151928.1|997103_998822_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_002889441.1|998934_999642_-|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_002889443.1|999638_1000046_-	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_002889445.1|1000153_1000969_-	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_002889448.1|1001012_1001666_-	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_002889450.1|1001658_1002690_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	39.3	9.4e-36
WP_002889452.1|1002878_1003445_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_002919103.1|1009376_1009598_-	membrane protein	NA	NA	NA	NA	NA
WP_002919102.1|1009891_1013002_-	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_002919101.1|1013014_1014154_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_004150972.1|1014532_1015183_+	acrEF/envCD operon transcriptional regulator	NA	NA	NA	NA	NA
1015268:1015285	attL	GTATCAGTTCATGCCGTA	NA	NA	NA	NA
WP_004150971.1|1015458_1016685_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	62.2	1.8e-150
WP_004150970.1|1016777_1017719_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001547839.1|1017900_1018185_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_004150969.1|1018195_1018975_+	phage antirepressor KilAC domain-containing protein	NA	Q8HA02	Enterobacteria_phage	51.5	6.2e-40
WP_106918304.1|1019426_1019696_+	host cell division inhibitor Icd-like protein	NA	A0A2H4JGW3	uncultured_Caudovirales_phage	94.4	2.4e-44
WP_001549752.1|1019688_1019877_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150967.1|1019869_1020184_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150966.1|1020180_1020549_+	hypothetical protein	NA	A0A2H4JCX7	uncultured_Caudovirales_phage	81.1	3.7e-51
WP_001549749.1|1020545_1020911_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150965.1|1020910_1023046_+	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	62.4	3.4e-205
WP_004150964.1|1023388_1023724_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150963.1|1023772_1024285_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001549743.1|1024548_1025715_+|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	95.9	9.8e-207
WP_001547826.1|1025766_1026327_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	95.7	1.2e-98
WP_004150962.1|1026328_1027570_+|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	96.5	1.0e-230
WP_004150961.1|1027566_1027902_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	57.8	3.7e-26
WP_001547824.1|1027898_1028198_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	80.8	3.4e-39
WP_004150959.1|1028197_1028641_+	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	91.8	2.8e-77
WP_004150957.1|1028633_1028786_+	hypothetical protein	NA	A0A2H4JCY9	uncultured_Caudovirales_phage	88.0	2.4e-17
WP_000113647.1|1028916_1029273_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	99.2	5.5e-60
WP_004150955.1|1029256_1030918_+|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	98.0	0.0e+00
WP_004150954.1|1030920_1031112_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000462905.1|1031265_1031562_-	DNA-binding transcriptional regulator Fis	NA	NA	NA	NA	NA
1031263:1031280	attR	GTATCAGTTCATGCCGTA	NA	NA	NA	NA
WP_004144972.1|1031586_1032552_-|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_002918745.1|1032909_1033791_-	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_002918742.1|1033802_1035254_-	sodium/pantothenate symporter	NA	NA	NA	NA	NA
WP_002918740.1|1035243_1035486_-	YhdT family protein	NA	NA	NA	NA	NA
WP_002918738.1|1035596_1036946_-	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_002918736.1|1036956_1037424_-	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_002918732.1|1037446_1037899_-	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_002918689.1|1038122_1038731_-	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
WP_002918688.1|1038730_1039732_-	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
WP_002918687.1|1039960_1040152_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002918686.1|1040231_1042172_+	RNase E specificity factor CsrD	NA	NA	NA	NA	NA
WP_002918653.1|1042477_1043521_+	rod shape-determining protein MreB	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
WP_004149974.1|1043591_1044584_+	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_002918648.1|1044583_1045072_+	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_002918646.1|1045079_1045661_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_002918644.1|1045663_1047133_+	ribonuclease G	NA	NA	NA	NA	NA
WP_004150952.1|1047170_1050968_+	AsmA2 domain-containing protein YhdP	NA	NA	NA	NA	NA
WP_002918642.1|1051056_1052502_+|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_002918641.1|1052537_1053467_-	HTH-type transcriptional activator AaeR	NA	NA	NA	NA	NA
WP_002918640.1|1053598_1053802_+	AaeX family protein	NA	NA	NA	NA	NA
WP_002918639.1|1053809_1054742_+	p-hydroxybenzoic acid efflux pump subunit AaeA	NA	NA	NA	NA	NA
WP_002918632.1|1054747_1056715_+	p-hydroxybenzoic acid efflux pump subunit AaeB	NA	NA	NA	NA	NA
WP_002918629.1|1056794_1057070_+	barstar family protein	NA	NA	NA	NA	NA
WP_002918627.1|1057120_1057387_-	peroxide/acid stress response protein YhcN	NA	NA	NA	NA	NA
WP_002918626.1|1057485_1057749_-	peroxide/acid stress response protein YhcN	NA	NA	NA	NA	NA
WP_002918625.1|1058124_1058595_-	transcriptional regulator ArgR	NA	NA	NA	NA	NA
WP_002918570.1|1059009_1059948_+	malate dehydrogenase	NA	NA	NA	NA	NA
WP_002918568.1|1060084_1061143_-	outer membrane-stress sensor serine endopeptidase DegS	NA	NA	NA	NA	NA
WP_002918566.1|1061230_1062598_-|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.3	6.0e-22
WP_002918565.1|1062771_1063170_-	DUF1043 family protein	NA	NA	NA	NA	NA
WP_004144945.1|1063360_1064488_+	cell division protein ZapE	NA	NA	NA	NA	NA
WP_002918559.1|1064753_1065182_+	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_000829818.1|1065197_1065590_+	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_135801240.1|1065647_1065932_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002918467.1|1065901_1066540_+	stringent starvation protein A	NA	NA	NA	NA	NA
WP_002918465.1|1066543_1067038_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	54.8	1.5e-26
>prophage 3
NZ_CP008797	Klebsiella pneumoniae subsp. pneumoniae KPNIH24 chromosome, complete genome	5396164	2218418	2225325	5396164	tRNA	Planktothrix_phage(33.33%)	6	NA	NA
WP_004175147.1|2218418_2219282_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	5.7e-10
WP_002912638.1|2219292_2220066_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.3	1.5e-25
WP_004151134.1|2220308_2221205_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
WP_002912635.1|2221447_2222809_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	94.5	2.5e-206
WP_002912634.1|2223127_2223850_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	6.4e-31
WP_004151135.1|2223846_2225325_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	1.1e-29
>prophage 4
NZ_CP008797	Klebsiella pneumoniae subsp. pneumoniae KPNIH24 chromosome, complete genome	5396164	2506869	2563509	5396164	plate,transposase,protease	Staphylococcus_phage(15.38%)	55	NA	NA
WP_002910830.1|2506869_2507616_+|protease	proteasome-type protease	protease	NA	NA	NA	NA
WP_002910809.1|2508054_2509041_+	fatty acid desaturase	NA	NA	NA	NA	NA
WP_004151439.1|2509033_2509834_+	PhnD/SsuA/transferrin family substrate-binding protein	NA	NA	NA	NA	NA
WP_002910767.1|2509820_2509994_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004219597.1|2510291_2510435_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002910764.1|2510611_2511553_+	transcriptional regulator TdcA	NA	NA	NA	NA	NA
WP_002910762.1|2511646_2512636_+	bifunctional threonine ammonia-lyase/L-serine ammonia-lyase TdcB	NA	NA	NA	NA	NA
WP_004145486.1|2512661_2513993_+	threonine/serine transporter TdcC	NA	NA	NA	NA	NA
WP_002910759.1|2514020_2515229_+	propionate kinase	NA	NA	NA	NA	NA
WP_004152312.1|2515257_2517552_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.8	2.3e-159
WP_004225356.1|2517603_2517750_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002910729.1|2518039_2519098_+	branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002910727.1|2519207_2520122_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_002910725.1|2520131_2521409_+	high-affinity branched-chain amino acid ABC transporter permease LivM	NA	NA	NA	NA	NA
WP_002910722.1|2521405_2522281_+	ATP-binding cassette domain-containing protein	NA	A0A285PWH2	Cedratvirus	25.5	1.5e-10
WP_002910721.1|2522277_2522997_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.0	2.5e-11
WP_002910720.1|2523002_2523896_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002910719.1|2524179_2525823_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	50.4	9.8e-136
WP_002910717.1|2525872_2526349_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002910715.1|2526447_2527374_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004152313.1|2527677_2528973_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	36.8	1.3e-61
WP_004899032.1|2528984_2529794_+	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_004152315.1|2529768_2530668_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002910657.1|2530777_2531260_-	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_002910654.1|2531450_2532149_+	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	27.2	2.6e-05
WP_002910652.1|2532174_2532714_-	DUF2058 domain-containing protein	NA	NA	NA	NA	NA
WP_002910650.1|2532828_2533158_-	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_002910645.1|2533726_2535067_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_004152316.1|2535063_2535717_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_004152317.1|2535720_2537418_+	OmpA family protein	NA	NA	NA	NA	NA
WP_004152319.1|2540381_2541737_+	S-type pyocin domain-containing protein	NA	NA	NA	NA	NA
WP_002910593.1|2541737_2542247_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002910591.1|2542243_2542750_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002910589.1|2542844_2542997_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002910586.1|2542986_2543496_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022644641.1|2545101_2546070_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	96.3	6.5e-180
WP_004199326.1|2546211_2546394_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004153085.1|2546390_2546720_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002910551.1|2546716_2547223_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072093244.1|2547682_2548714_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002910547.1|2548737_2549043_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002910544.1|2549064_2549958_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A7H6	Microcystis_virus	30.5	6.7e-14
WP_004217423.1|2550003_2550120_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152633.1|2550141_2551035_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A075BSL8	Microcystis_phage	27.3	1.7e-12
WP_038435084.1|2551060_2551189_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002910539.1|2551210_2552104_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A075BSL8	Microcystis_phage	27.1	2.8e-12
WP_004152632.1|2552279_2553170_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A7H6	Microcystis_virus	29.8	4.1e-11
WP_000019473.1|2553506_2554487_+|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_000019473.1|2554706_2555687_+|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_171815252.1|2555744_2556047_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072093174.1|2556307_2556493_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002910497.1|2556790_2557057_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_004198077.1|2557060_2558218_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152262.1|2558201_2561612_+	type VI secretion protein VasK	NA	NA	NA	NA	NA
WP_002910495.1|2561745_2563509_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
>prophage 5
NZ_CP008797	Klebsiella pneumoniae subsp. pneumoniae KPNIH24 chromosome, complete genome	5396164	3232496	3243383	5396164		Escherichia_phage(87.5%)	9	NA	NA
WP_004151613.1|3232496_3235604_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.6	0.0e+00
WP_004151612.1|3235658_3236924_+	MFS transporter	NA	NA	NA	NA	NA
WP_001620097.1|3236954_3238043_-	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
WP_002904006.1|3238129_3238390_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	97.7	3.5e-40
WP_004176269.1|3238687_3239548_+	class A broad-spectrum beta-lactamase SHV-11	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
WP_002210513.1|3239568_3240330_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_004151610.1|3240590_3241493_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.3	7.7e-159
WP_022644633.1|3241504_3242770_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.3	1.1e-232
WP_002210516.1|3242762_3243383_+	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
>prophage 6
NZ_CP008797	Klebsiella pneumoniae subsp. pneumoniae KPNIH24 chromosome, complete genome	5396164	3436876	3619750	5396164	lysis,plate,terminase,holin,integrase,tail,transposase	Klebsiella_phage(22.94%)	199	3487998:3488015	3619471:3619486
WP_002902268.1|3436876_3437962_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_004151598.1|3437925_3439680_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_004151599.1|3441351_3444777_-	type VI secretion protein VasK	NA	NA	NA	NA	NA
WP_002902254.1|3444760_3445900_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002902252.1|3445896_3446154_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_004151601.1|3446198_3448616_-	DUF2235 domain-containing protein	NA	NA	NA	NA	NA
WP_002902180.1|3448603_3449134_-	T6SS immunity phospholipase A1-binding lipoprotein Tli1-KP	NA	NA	NA	NA	NA
WP_002902178.1|3449201_3449732_-	T6SS immunity phospholipase A1-binding lipoprotein Tli1-KP	NA	NA	NA	NA	NA
WP_002902176.1|3449800_3450331_-	T6SS immunity phospholipase A1-binding lipoprotein Tli1-KP	NA	NA	NA	NA	NA
WP_002902174.1|3450398_3450929_-	T6SS immunity phospholipase A1-binding lipoprotein Tli1-KP	NA	NA	NA	NA	NA
WP_002902172.1|3450997_3451528_-	T6SS immunity phospholipase A1-binding lipoprotein Tli1-KP	NA	NA	NA	NA	NA
WP_002902169.1|3451591_3452371_-	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_004228410.1|3452371_3454741_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	33.8	9.1e-18
WP_002902163.1|3454742_3457397_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	33.4	2.5e-96
WP_002902160.1|3457661_3458153_-	type VI secretion system effector Hcp	NA	NA	NA	NA	NA
WP_004151602.1|3458157_3459864_-	OmpA family protein	NA	NA	NA	NA	NA
WP_004151603.1|3459860_3460550_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_004218490.1|3460546_3461890_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_002902148.1|3461899_3463444_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_002902144.1|3463486_3463978_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_002902136.1|3464823_3465072_+	DinI-like family protein	NA	S5MQI1	Escherichia_phage	70.4	1.4e-25
WP_002902133.1|3465294_3465579_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002902131.1|3465683_3465893_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002902128.1|3465889_3466621_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004218487.1|3466631_3467360_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152577.1|3469710_3469908_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152576.1|3469907_3470774_-	hypothetical protein	NA	A0A2H4IYR0	uncultured_Caudovirales_phage	64.5	1.9e-34
WP_004152575.1|3470773_3471547_-	DUF2612 domain-containing protein	NA	A0A2H4J1A9	uncultured_Caudovirales_phage	54.4	2.8e-77
WP_004152574.1|3471543_3472740_-|plate	baseplate J/gp47 family protein	plate	A0A0M4RD32	Salmonella_phage	72.9	3.9e-158
WP_004152573.1|3472739_3473093_-	hypothetical protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	80.3	2.3e-50
WP_004152572.1|3473094_3473748_-	hypothetical protein	NA	A0A2H4J8H6	uncultured_Caudovirales_phage	63.5	1.0e-59
WP_004152571.1|3473801_3474368_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004199301.1|3474410_3474593_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152570.1|3474642_3474984_-	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	46.6	1.8e-23
WP_004152569.1|3474983_3476006_-	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	54.2	9.2e-100
WP_004217362.1|3476008_3476236_-	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	56.0	4.6e-20
WP_004152567.1|3476311_3476911_-	hypothetical protein	NA	A0A2H4J1B3	uncultured_Caudovirales_phage	57.6	9.9e-54
WP_004152566.1|3476910_3478914_-	lytic transglycosylase domain-containing protein	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	63.6	1.2e-247
WP_004152565.1|3478903_3479056_-	hypothetical protein	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	88.0	7.6e-19
WP_004152564.1|3479091_3479517_-	hypothetical protein	NA	A0A2H4J2V6	uncultured_Caudovirales_phage	63.4	2.6e-40
WP_085955245.1|3479843_3481035_+|transposase	IS3-like element ISKpn18 family transposase	transposase	U5P429	Shigella_phage	43.5	3.5e-50
WP_004152178.1|3480976_3481267_-	DUF3277 family protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	85.5	2.6e-23
WP_004152177.1|3481277_3482423_-	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	76.9	6.3e-166
WP_004152176.1|3482426_3482867_-	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	51.7	1.6e-40
WP_001116156.1|3482961_3483348_-	hypothetical protein	NA	A0A2H4J1A4	uncultured_Caudovirales_phage	78.2	1.1e-48
WP_000834982.1|3483347_3483854_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000113538.1|3483850_3484270_-	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	60.7	3.3e-40
WP_000725700.1|3484238_3484520_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001132269.1|3484559_3485501_-	DUF2184 domain-containing protein	NA	A0A2H4J191	uncultured_Caudovirales_phage	77.1	1.7e-137
WP_000528476.1|3485512_3486007_-	hypothetical protein	NA	A0A2H4JHM9	uncultured_Caudovirales_phage	62.7	4.2e-50
WP_004199270.1|3486010_3487213_-	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	54.1	2.6e-106
WP_004152174.1|3487264_3487813_-	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	56.3	3.0e-49
WP_004152173.1|3487868_3489320_-	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	68.8	3.8e-192
3487998:3488015	attL	CTGCCACTGTTTCGCCGC	NA	NA	NA	NA
WP_004152172.1|3489557_3490958_-|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	69.0	9.4e-188
3487998:3488015	attL	CTGCCACTGTTTCGCCGC	NA	NA	NA	NA
WP_004218030.1|3490908_3491397_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152170.1|3491762_3492083_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004153952.1|3492317_3492707_-	lipase chaperone	NA	A0A192Y6H8	Salmonella_phage	49.2	9.4e-21
WP_004152169.1|3492703_3493234_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	77.1	2.7e-79
WP_004146526.1|3493236_3493485_-|holin	class II holin family protein	holin	NA	NA	NA	NA
WP_004152167.1|3493890_3494673_-	antitermination protein	NA	F1C595	Cronobacter_phage	76.8	7.2e-113
WP_004198239.1|3494669_3495146_-	hypothetical protein	NA	A0A286N2Q1	Klebsiella_phage	100.0	1.8e-90
WP_004198233.1|3495142_3496105_-	toprim domain-containing protein	NA	A0A286N2Q0	Klebsiella_phage	99.4	4.8e-183
WP_004198228.1|3496106_3497765_-	DEAD/DEAH box helicase	NA	A0A286N2P9	Klebsiella_phage	96.0	0.0e+00
WP_004152162.1|3498341_3498563_-	helix-turn-helix transcriptional regulator	NA	A0A286S2C1	Klebsiella_phage	100.0	3.0e-32
WP_004152161.1|3498660_3499329_+	LexA family transcriptional regulator	NA	A0A286S2B2	Klebsiella_phage	99.5	2.4e-125
WP_004152160.1|3499499_3499814_+	hypothetical protein	NA	A0A286S1T9	Klebsiella_phage	100.0	1.0e-49
WP_004152159.1|3499806_3499995_+	hypothetical protein	NA	A0A286S1P8	Klebsiella_phage	100.0	4.6e-26
WP_004152158.1|3500164_3500530_+	hypothetical protein	NA	A0A286S1Q6	Klebsiella_phage	99.2	6.9e-58
WP_004152157.1|3500522_3500777_+	hypothetical protein	NA	A0A286SGR4	Klebsiella_phage	97.6	3.1e-41
WP_004177208.1|3500748_3500967_+	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	98.6	6.6e-32
WP_004152156.1|3500963_3501389_+	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	77.9	3.5e-53
WP_004152155.1|3501385_3501580_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152154.1|3501576_3502404_+	hypothetical protein	NA	Q8W654	Enterobacteria_phage	84.0	5.5e-111
WP_004152153.1|3502508_3503027_+	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	98.8	1.7e-94
WP_004154298.1|3503032_3503743_+	Rha family transcriptional regulator	NA	A0A286S260	Klebsiella_phage	88.3	2.1e-111
WP_004152151.1|3503732_3503957_+	hypothetical protein	NA	A0A286S2B3	Klebsiella_phage	89.2	3.1e-29
WP_004152150.1|3503953_3504166_+	hypothetical protein	NA	A0A286S2B6	Klebsiella_phage	98.6	3.4e-33
WP_014343018.1|3504408_3504642_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004198245.1|3504714_3504861_+	hypothetical protein	NA	A0A1B5FPC2	Escherichia_phage	70.8	2.9e-15
WP_004152148.1|3504820_3505063_+	hypothetical protein	NA	A0A0M4RTZ2	Salmonella_phage	73.8	2.2e-20
WP_004152147.1|3505043_3506225_-|integrase	site-specific integrase	integrase	A0A0M4QX09	Salmonella_phage	84.2	5.6e-202
WP_016197745.1|3506421_3506970_+	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
WP_004152145.1|3507168_3508701_-	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	30.0	1.1e-21
WP_004152144.1|3508917_3509679_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.5	2.4e-20
WP_004152143.1|3509787_3510702_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004176439.1|3511002_3511191_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152141.1|3511737_3512607_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	42.1	5.7e-50
WP_004218007.1|3512685_3513888_-	MFS transporter	NA	NA	NA	NA	NA
WP_004152139.1|3513960_3515097_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_004152138.1|3515269_3516154_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004152137.1|3516278_3517112_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152136.1|3517342_3517729_+	glyoxalase/bleomycin resistance/dioxygenase family protein	NA	NA	NA	NA	NA
WP_004152135.1|3517896_3519513_-	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004148146.1|3519509_3519626_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152134.1|3519698_3520406_+	murein tripeptide amidase MpaA	NA	NA	NA	NA	NA
WP_004152133.1|3520402_3521368_-	L-Ala-D/L-Glu epimerase	NA	NA	NA	NA	NA
WP_004152131.1|3521470_3521977_+	thiol peroxidase	NA	NA	NA	NA	NA
WP_004152128.1|3522047_3523100_-	AbrB family transcriptional regulator	NA	NA	NA	NA	NA
WP_002901979.1|3523201_3524743_-	transcriptional regulator TyrR	NA	NA	NA	NA	NA
WP_002901977.1|3524915_3526229_-	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
WP_071531198.1|3526360_3527242_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004152127.1|3527331_3528393_-	TIGR01620 family protein	NA	NA	NA	NA	NA
WP_002901917.1|3528389_3529787_-	YcjX family protein	NA	NA	NA	NA	NA
WP_002901915.1|3529889_3530108_-	phage shock protein PspD	NA	NA	NA	NA	NA
WP_002901913.1|3530136_3530496_-	envelope stress response membrane protein PspC	NA	NA	NA	NA	NA
WP_002901911.1|3530495_3530720_-	envelope stress response membrane protein PspB	NA	NA	NA	NA	NA
WP_002901908.1|3530775_3531444_-	phage shock protein PspA	NA	NA	NA	NA	NA
WP_004148137.1|3531596_3532586_+	phage shock protein operon transcriptional activator	NA	NA	NA	NA	NA
WP_002901901.1|3532576_3533968_-	MFS transporter	NA	NA	NA	NA	NA
WP_002901900.1|3533993_3535163_-	amidohydrolase	NA	NA	NA	NA	NA
WP_004152126.1|3535334_3537644_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004171423.1|3537622_3538453_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004231410.1|3538560_3539469_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_002901817.1|3539802_3541446_+	peptide ABC transporter substrate-binding protein SapA	NA	NA	NA	NA	NA
WP_002901816.1|3541442_3542408_+	peptide ABC transporter permease SapB	NA	NA	NA	NA	NA
WP_002901815.1|3542612_3543284_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	59.6	4.5e-79
WP_071531199.1|3543470_3544298_+	FRG domain-containing protein	NA	A0A1S6KZX9	Salmonella_phage	30.2	8.4e-19
WP_002901813.1|3544373_3545639_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	82.7	9.6e-208
3545172:3545189	attR	CTGCCACTGTTTCGCCGC	NA	NA	NA	NA
WP_002901812.1|3545640_3546060_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	57.5	1.4e-35
3545172:3545189	attR	CTGCCACTGTTTCGCCGC	NA	NA	NA	NA
WP_004178082.1|3546139_3547627_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_001067855.1|3549536_3550241_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_004152552.1|3553569_3553719_-|lysis	colicin release lysis protein	lysis	NA	NA	NA	NA
WP_004152553.1|3553803_3554061_-	cloacin	NA	NA	NA	NA	NA
WP_004199321.1|3554070_3554892_-	cytotoxic family protein	NA	NA	NA	NA	NA
WP_001067855.1|3555232_3555937_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_004152552.1|3559265_3559415_-|lysis	colicin release lysis protein	lysis	NA	NA	NA	NA
WP_004152553.1|3559499_3559757_-	cloacin	NA	NA	NA	NA	NA
WP_004199321.1|3559766_3560588_-	cytotoxic family protein	NA	NA	NA	NA	NA
WP_001067855.1|3560928_3561633_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001389365.1|3561809_3562574_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_000376623.1|3563080_3563581_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000259031.1|3563708_3564548_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
WP_000679427.1|3564541_3564889_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_001261740.1|3565052_3565844_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_001067855.1|3566839_3567544_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_004152703.1|3567792_3569736_+	hypothetical protein	NA	A0A286S1P0	Klebsiella_phage	69.8	1.1e-37
WP_004152702.1|3569977_3570577_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152700.1|3570801_3571533_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024940942.1|3571536_3572271_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152652.1|3574567_3577636_-	hypothetical protein	NA	A0A286S259	Klebsiella_phage	97.5	0.0e+00
WP_004152651.1|3577632_3578013_-	hypothetical protein	NA	A0A286S2A6	Klebsiella_phage	99.2	1.8e-72
WP_004152650.1|3578022_3578505_-	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	94.4	1.7e-80
WP_004152649.1|3578685_3579150_-	hypothetical protein	NA	A0A286S298	Klebsiella_phage	67.8	6.7e-58
WP_000019473.1|3579708_3580689_-|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_004217331.1|3580801_3583699_-|tail	phage tail length tape measure family protein	tail	A0A2H4J107	uncultured_Caudovirales_phage	32.7	1.6e-104
WP_099119318.1|3583960_3584152_-	hypothetical protein	NA	S4TR42	Salmonella_phage	78.3	7.8e-05
WP_004217333.1|3584376_3584733_-	hypothetical protein	NA	A0A1V0E5P9	Salmonella_phage	75.0	1.1e-44
WP_016831940.1|3584809_3585016_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004226994.1|3585153_3585636_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004217341.1|3585689_3586862_-	Ig domain-containing protein	NA	A0A0D4DBN5	Acinetobacter_phage	27.0	1.2e-23
WP_004190640.1|3586885_3587278_-	electron transfer flavoprotein subunit beta	NA	NA	NA	NA	NA
WP_004217343.1|3587274_3587826_-	hypothetical protein	NA	G8C7Q1	Escherichia_phage	39.9	1.3e-28
WP_004217344.1|3587827_3588211_-	hypothetical protein	NA	A0A0S2SYG4	Pseudomonas_phage	45.2	7.1e-21
WP_004190646.1|3588197_3588431_-	hypothetical protein	NA	A0A2H4J0Y9	uncultured_Caudovirales_phage	47.1	5.8e-10
WP_004217346.1|3588440_3588695_-	hypothetical protein	NA	J9Q7U0	Salmonella_phage	52.4	1.0e-20
WP_004217348.1|3588696_3589092_-	hypothetical protein	NA	A0A1B1P9F2	Acinetobacter_phage	38.5	4.3e-13
WP_142689607.1|3589132_3589405_-	Ig-like domain-containing protein	NA	NA	NA	NA	NA
WP_004190653.1|3589413_3590367_-	Ig domain-containing protein	NA	A0A1B0VMF8	Pseudomonas_phage	74.4	5.0e-132
WP_004217351.1|3590377_3591163_-	hypothetical protein	NA	A0A1B0VMG1	Pseudomonas_phage	63.9	1.0e-66
WP_004227000.1|3591276_3591453_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019405022.1|3591693_3592806_-	hypothetical protein	NA	I6PD76	Cronobacter_phage	55.1	5.6e-111
WP_004218551.1|3592789_3594190_-	DUF4055 domain-containing protein	NA	A0A1B0VMH0	Pseudomonas_phage	53.5	1.1e-127
WP_004190663.1|3594189_3595497_-|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	58.9	3.6e-149
WP_004218556.1|3595474_3596479_-|terminase	terminase small subunit	terminase	Q5QF76	Pseudomonas_virus	45.5	1.5e-38
WP_004218558.1|3597341_3597587_-	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	96.3	4.6e-34
WP_004190672.1|3598545_3598821_-	hypothetical protein	NA	A0A286N2Q8	Klebsiella_phage	72.5	2.2e-08
WP_004190674.1|3598817_3599162_-	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	80.7	2.0e-38
WP_004218565.1|3599158_3599698_-	glycoside hydrolase family 108 protein	NA	A0A286N2Q6	Klebsiella_phage	98.9	3.3e-101
WP_024940884.1|3599694_3599994_-|holin	phage holin family protein	holin	A0A286N2Q5	Klebsiella_phage	100.0	4.5e-47
WP_022644626.1|3600472_3601519_-|transposase	IS481-like element ISKpn28 family transposase	transposase	A0A0M3LR35	Mannheimia_phage	21.9	1.3e-05
WP_004232548.1|3601744_3602434_-	antiterminator-like protein	NA	I6PDF8	Cronobacter_phage	53.1	2.1e-55
WP_004218534.1|3602433_3602574_-	YlcG family protein	NA	NA	NA	NA	NA
WP_004218533.1|3602570_3603209_-	recombination protein NinG	NA	H6WRY9	Salmonella_phage	69.8	3.2e-74
WP_004218532.1|3603201_3603870_-	metallophosphoesterase	NA	K7P6H8	Enterobacteria_phage	78.7	1.4e-104
WP_004243010.1|3603866_3604034_-	NinE family protein	NA	K7P7K0	Enterobacteria_phage	62.5	4.6e-09
WP_004218531.1|3604014_3604482_-	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	45.8	3.4e-33
WP_004243011.1|3604614_3604893_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004218530.1|3605002_3606031_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004196831.1|3606238_3606484_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004218528.1|3606539_3606842_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004201118.1|3606838_3607687_-	ATP-binding protein	NA	K7PLU3	Enterobacteria_phage	60.1	5.1e-88
WP_004201117.1|3607683_3608544_-	replication protein	NA	K7PGT1	Enterobacteria_phage	53.3	1.0e-59
WP_001548453.1|3608629_3608851_-	hypothetical protein	NA	G8EYH8	Enterobacteria_phage	41.7	6.9e-05
WP_004201115.1|3608891_3609119_-	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	77.1	1.4e-24
WP_004201113.1|3609230_3609929_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	84.1	3.7e-108
WP_004201109.1|3610216_3611293_+	ParA family protein	NA	H2BD62	Pseudomonas_phage	37.9	9.1e-58
WP_004201108.1|3611374_3611578_-	hypothetical protein	NA	A0A192Y6Q5	Salmonella_phage	71.6	3.9e-18
WP_004219883.1|3611888_3612014_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004135674.1|3612006_3612201_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004201105.1|3612289_3612574_+	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	79.8	1.1e-39
WP_004201103.1|3612589_3613435_+	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	59.2	1.8e-69
WP_088224434.1|3613431_3613719_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004201102.1|3613720_3614401_+	YqaJ viral recombinase family protein	NA	A0A0M3ULE0	Salmonella_phage	91.2	8.2e-121
WP_004151898.1|3614397_3614826_+	hypothetical protein	NA	M9NYX4	Enterobacteria_phage	80.3	7.5e-64
WP_004151899.1|3614822_3615485_+	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	84.6	2.7e-105
WP_004151900.1|3615692_3616910_-|integrase	site-specific integrase	integrase	K7PGY1	Enterobacteria_phage	51.9	8.6e-121
WP_004151901.1|3617056_3617947_+	peptide ABC transporter permease SapC	NA	NA	NA	NA	NA
WP_004140266.1|3617946_3618939_+	peptide ABC transporter ATP-binding protein SapD	NA	G9BWD6	Planktothrix_phage	27.2	3.0e-07
WP_004140269.1|3618940_3619750_+	peptide ABC transporter ATP-binding protein SapF	NA	A0A2H4PQG7	Staphylococcus_phage	28.9	2.1e-14
>prophage 7
NZ_CP008797	Klebsiella pneumoniae subsp. pneumoniae KPNIH24 chromosome, complete genome	5396164	3908716	3924796	5396164	holin	Salmonella_phage(50.0%)	14	NA	NA
WP_004199491.1|3908716_3908992_+	hypothetical protein	NA	A0A0M3ULK3	Salmonella_phage	60.9	1.9e-23
WP_004199521.1|3908965_3909535_-	recombinase family protein	NA	A0A286S1P7	Klebsiella_phage	86.8	3.9e-84
WP_022644622.1|3909625_3911137_+	hypothetical protein	NA	H6X4Y6	Enterobacteria_phage	33.5	1.3e-57
WP_022644621.1|3911147_3911342_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022644620.1|3911540_3913976_-	hypothetical protein	NA	A0A0A8J9V7	Klebsiella_phage	34.5	1.7e-67
WP_004199504.1|3914067_3914220_-	DUF1378 family protein	NA	NA	NA	NA	NA
WP_009308366.1|3914216_3914747_-	hypothetical protein	NA	K7P6W1	Enterobacteria_phage	48.9	2.4e-35
WP_004191039.1|3914743_3915283_-	lysozyme	NA	H6WRZ4	Salmonella_phage	78.1	1.0e-81
WP_004191041.1|3915284_3915500_-|holin	class II holin family protein	holin	A5LH82	Enterobacteria_phage	55.9	1.4e-10
WP_022644619.1|3915712_3916963_+	hypothetical protein	NA	NA	NA	NA	NA
WP_127897200.1|3917410_3917734_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022644617.1|3917730_3920448_-	hypothetical protein	NA	Q858F8	Salmonella_phage	51.2	8.5e-262
WP_022644616.1|3920447_3922289_-	hypothetical protein	NA	Q858F9	Salmonella_phage	33.4	9.4e-79
WP_022644615.1|3922288_3924796_-	transglycosylase SLT domain-containing protein	NA	Q858G0	Salmonella_phage	26.4	7.6e-55
>prophage 8
NZ_CP008797	Klebsiella pneumoniae subsp. pneumoniae KPNIH24 chromosome, complete genome	5396164	3929912	3952568	5396164	integrase,head,tail	Pectobacterium_phage(28.57%)	33	3920692:3920706	3953652:3953666
3920692:3920706	attL	AACTGCGCAAACTGA	NA	NA	NA	NA
WP_004191050.1|3929912_3930386_-	hypothetical protein	NA	K4NYY6	Pseudomonas_phage	46.3	1.8e-26
WP_004191051.1|3930424_3931420_-	hypothetical protein	NA	W6MW28	Pseudomonas_phage	60.2	2.7e-104
WP_004199538.1|3931430_3932168_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004199528.1|3932154_3932478_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004141558.1|3932480_3934145_-|head,tail	head-tail connector protein	head,tail	A0A221SAN2	Ralstonia_phage	39.4	3.1e-105
WP_004199513.1|3934144_3935539_-	hypothetical protein	NA	A0A0E3JIA1	Rhodoferax_phage	36.4	2.4e-58
WP_004199526.1|3935623_3936076_-	DNA-packaging protein	NA	A3EYX3	Salmonella_phage	66.4	1.1e-49
WP_004199477.1|3936082_3936343_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004199520.1|3936326_3936560_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004199492.1|3936621_3937146_-	DUF2829 domain-containing protein	NA	A0A1B0VMG3	Pseudomonas_phage	54.1	2.5e-45
WP_004199525.1|3937186_3937627_-	phage family protein	NA	R9TRJ4	Aeromonas_phage	43.8	4.3e-14
WP_022644607.1|3937632_3937980_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_071570746.1|3937967_3938291_-	DUF968 domain-containing protein	NA	A0A1I9KFA7	Aeromonas_phage	55.8	6.8e-25
WP_004199500.1|3938280_3938874_-	DUF1367 family protein	NA	H9C173	Pectobacterium_phage	72.1	7.2e-81
WP_029499143.1|3938942_3939134_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032409673.1|3939314_3939653_-	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	82.0	8.6e-47
WP_022644604.1|3939665_3940283_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_004141582.1|3940279_3940510_-	hypothetical protein	NA	A0A2H4JCC5	uncultured_Caudovirales_phage	37.3	5.0e-06
WP_022644602.1|3941229_3942015_-	chromosome partitioning protein ParB	NA	C7BGF1	Burkholderia_phage	54.9	7.8e-67
WP_022644601.1|3942054_3942288_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022644600.1|3942291_3942942_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022644599.1|3942980_3944369_-	AAA family ATPase	NA	Q8HA30	Enterobacteria_phage	46.6	7.5e-105
WP_032409672.1|3944365_3945349_-	helix-turn-helix domain-containing protein	NA	H9C164	Pectobacterium_phage	73.8	1.3e-39
WP_016197573.1|3945351_3945510_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022644597.1|3945593_3946040_-	hypothetical protein	NA	H9C162	Pectobacterium_phage	56.1	5.7e-30
WP_022644596.1|3946100_3946295_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025712912.1|3946375_3946762_+	helix-turn-helix domain-containing protein	NA	A5VW98	Enterobacteria_phage	57.8	3.4e-15
WP_024623105.1|3947703_3947937_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022644594.1|3947944_3948190_+	hypothetical protein	NA	A0A1B1W282	Salmonella_phage	59.5	3.7e-15
WP_022644593.1|3948219_3950349_+	hypothetical protein	NA	H9C157	Pectobacterium_phage	34.6	8.0e-98
WP_022644592.1|3950348_3950915_+	siphovirus Gp157 family protein	NA	H9C156	Pectobacterium_phage	61.5	2.5e-51
WP_004199480.1|3951311_3951536_+	DUF4224 domain-containing protein	NA	H9C153	Pectobacterium_phage	68.1	4.5e-20
WP_016197576.1|3951539_3952568_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	54.1	4.4e-94
3953652:3953666	attR	AACTGCGCAAACTGA	NA	NA	NA	NA
>prophage 9
NZ_CP008797	Klebsiella pneumoniae subsp. pneumoniae KPNIH24 chromosome, complete genome	5396164	4040217	4133168	5396164	head,lysis,integrase,plate,portal,terminase,tRNA,capsid,tail,protease	Salmonella_phage(58.62%)	94	4095743:4095761	4133243:4133261
WP_002898139.1|4040217_4041510_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	44.7	7.3e-94
WP_002898137.1|4041600_4042944_-	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	40.8	7.3e-81
WP_002898132.1|4042952_4043564_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_004150846.1|4043686_4047940_-	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	49.2	5.2e-88
WP_000228469.1|4048075_4048570_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_002898019.1|4049102_4050071_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.0	3.2e-62
WP_002898017.1|4050185_4051952_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	25.9	2.3e-21
WP_004150847.1|4051952_4053674_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
WP_002898014.1|4053718_4054420_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|4054773_4054992_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_002896522.1|4055112_4057392_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
WP_002896520.1|4057422_4057740_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896516.1|4058065_4058287_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_004150848.1|4058363_4060304_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
WP_002896440.1|4060300_4061416_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
WP_002896437.1|4061562_4063221_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_002896434.1|4063640_4064336_+	aquaporin Z	NA	NA	NA	NA	NA
WP_004147773.1|4064451_4065351_+	lysine exporter LysO family protein	NA	NA	NA	NA	NA
WP_002896412.1|4065494_4067147_+	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_002896410.1|4067157_4068126_+	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_002896408.1|4068337_4068772_-	DoxX family protein	NA	NA	NA	NA	NA
WP_002896406.1|4068923_4070642_+	ubiquinone-dependent pyruvate dehydrogenase	NA	NA	NA	NA	NA
WP_002896404.1|4070680_4071682_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_002896401.1|4071692_4073135_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_002896399.1|4073222_4074236_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_002896397.1|4074232_4075063_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	31.6	4.1e-05
WP_004150851.1|4075094_4076234_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_002896394.1|4077111_4077627_+	lipoprotein	NA	NA	NA	NA	NA
WP_002896392.1|4077853_4078582_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	37.1	1.2e-29
WP_002896390.1|4078602_4079334_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002896386.1|4079340_4080057_+	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_004150852.1|4080056_4080725_+	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_002896384.1|4080908_4081640_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002896382.1|4081682_4083155_-	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	31.8	7.9e-28
WP_002896380.1|4083151_4083868_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.9	2.1e-34
WP_002896378.1|4083946_4085074_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A2K5B251	Erysipelothrix_phage	25.6	1.3e-19
WP_002896376.1|4085115_4085604_-	DUF2593 family protein	NA	NA	NA	NA	NA
WP_002896372.1|4085661_4086507_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_002896371.1|4086503_4087457_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_002896370.1|4087467_4088601_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.9	2.2e-30
WP_002896368.1|4088764_4089877_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_002896365.1|4090225_4090705_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_002896363.1|4090793_4091696_-	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	35.3	2.0e-34
WP_002896354.1|4092517_4092805_-	YbjC family protein	NA	NA	NA	NA	NA
WP_002896352.1|4093007_4093271_+	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	73.1	1.6e-27
WP_002896351.1|4093277_4093661_-	inner membrane protein YbjM	NA	NA	NA	NA	NA
WP_004179131.1|4093927_4095613_+	aspartate:alanine antiporter	NA	NA	NA	NA	NA
4095743:4095761	attL	ATGGGTTTTTTGTTGCCTG	NA	NA	NA	NA
WP_000972391.1|4095832_4096051_-	ogr/Delta-like zinc finger family protein	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_002896225.1|4096142_4097243_-	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	87.4	4.9e-176
WP_002896224.1|4097239_4097725_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	75.6	7.2e-63
WP_002896222.1|4097721_4100349_-|tail	phage tail tape measure protein	tail	E5FFG5	Burkholderia_phage	42.0	5.6e-117
WP_002896220.1|4100341_4100461_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
WP_002896204.1|4100475_4100775_-|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	79.0	3.7e-33
WP_002896201.1|4100827_4101343_-|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	85.4	1.3e-81
WP_002896193.1|4101352_4102525_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	93.3	1.9e-210
WP_002896191.1|4102663_4103740_-|tail	phage tail protein	tail	Q37842	Escherichia_phage	44.8	1.2e-25
WP_002896188.1|4103769_4103973_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002896186.1|4103969_4104701_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019724930.1|4104704_4105439_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150856.1|4107657_4108257_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	60.5	1.3e-58
WP_002896182.1|4108249_4109158_-|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	66.9	7.6e-106
WP_002896179.1|4109144_4109507_-	GPW/gp25 family protein	NA	A0A1S6KZZ4	Salmonella_phage	84.7	5.8e-49
WP_002896177.1|4109503_4110076_-|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	72.3	4.7e-77
WP_004150857.1|4110170_4110863_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002896175.1|4110859_4111306_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	71.2	2.2e-50
WP_002896172.1|4111298_4111730_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	82.5	9.9e-64
WP_002896170.1|4111692_4111839_-	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	76.1	6.0e-13
WP_002896168.1|4111825_4112254_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	77.9	9.6e-51
WP_002896163.1|4112250_4112634_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	42.0	2.1e-17
WP_002896161.1|4112638_4113148_-	lysozyme	NA	E5G6N1	Salmonella_phage	83.4	2.1e-81
WP_002896158.1|4113128_4113344_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	90.1	3.6e-30
WP_002896155.1|4113347_4113551_-|tail	tail protein X	tail	A0A1S6KZY4	Salmonella_phage	88.1	1.3e-29
WP_002896151.1|4113550_4114015_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	8.4e-77
WP_000059191.1|4114110_4114761_-|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
WP_002895972.1|4114764_4115823_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.1	1.1e-180
WP_002895967.1|4115839_4116673_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	88.8	6.3e-123
WP_004150858.1|4116815_4118582_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.0	0.0e+00
WP_002895959.1|4118581_4119607_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	86.7	7.6e-171
WP_004199124.1|4119668_4121411_-	AIPR family protein	NA	NA	NA	NA	NA
WP_000700647.1|4121686_4122364_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001217575.1|4122478_4122712_-	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_001154434.1|4122722_4122911_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
WP_004150862.1|4123064_4125479_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	97.5	0.0e+00
WP_004150863.1|4125475_4126333_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	95.4	2.0e-156
WP_000752622.1|4126329_4126557_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	98.7	6.0e-36
WP_004150864.1|4126556_4126790_-	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	96.1	4.1e-32
WP_000963473.1|4126857_4127199_-	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	99.1	4.6e-56
WP_000956179.1|4127162_4127363_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	97.0	1.6e-32
WP_000460893.1|4127370_4127880_-	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
WP_000188448.1|4127912_4128134_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152885.1|4128279_4129158_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	39.9	1.7e-30
WP_004150866.1|4129169_4130114_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004178082.1|4130212_4131700_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_014342959.1|4132187_4133168_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.2	1.4e-97
4133243:4133261	attR	ATGGGTTTTTTGTTGCCTG	NA	NA	NA	NA
>prophage 10
NZ_CP008797	Klebsiella pneumoniae subsp. pneumoniae KPNIH24 chromosome, complete genome	5396164	4579584	4625960	5396164	head,lysis,holin,tRNA,transposase	Cronobacter_phage(24.53%)	66	NA	NA
WP_004151249.1|4579584_4582062_-	MoaD/ThiS family protein	NA	F1C5A7	Cronobacter_phage	45.6	2.7e-198
WP_004151250.1|4582048_4582444_-	C40 family peptidase	NA	F1C5F2	Cronobacter_phage	54.0	8.0e-36
WP_004199076.1|4582440_4582911_-	hypothetical protein	NA	R9TPR6	Aeromonas_phage	41.0	2.5e-28
WP_004151252.1|4582910_4583387_-	hypothetical protein	NA	A0A2P1MXB5	Escherichia_phage	49.7	3.0e-37
WP_004151253.1|4583429_4586876_-	tape measure protein	NA	Q5G8W8	Enterobacteria_phage	48.6	1.4e-163
WP_004151254.1|4586968_4587472_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151255.1|4587599_4588385_-	phage repressor protein	NA	A0A2L1IV39	Escherichia_phage	59.7	1.9e-84
WP_004151256.1|4588450_4589164_-	hypothetical protein	NA	H6WRU8	Salmonella_phage	50.2	3.9e-49
WP_004151257.1|4589153_4589324_-	Arc family DNA-binding protein	NA	I6R9A8	Salmonella_phage	87.0	6.1e-17
WP_004151258.1|4589423_4589783_+	Arc family DNA-binding protein	NA	A0A0P0ZBD1	Stx2-converting_phage	47.5	3.8e-16
WP_004151259.1|4589799_4590270_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151260.1|4590563_4590818_-	hypothetical protein	NA	K7PM89	Enterobacteria_phage	73.0	6.7e-20
WP_004151261.1|4590820_4591576_-	KilA-N domain-containing protein	NA	K7PGT4	Enterobacteria_phage	51.0	2.4e-60
WP_004151262.1|4591751_4592429_-	hypothetical protein	NA	F1C5E8	Cronobacter_phage	57.9	4.8e-73
WP_004151263.1|4592481_4593234_-	Ig domain-containing protein	NA	G0ZNE6	Cronobacter_phage	42.1	5.8e-43
WP_004151264.1|4593302_4593695_-	hypothetical protein	NA	G0ZNE4	Cronobacter_phage	52.7	5.1e-35
WP_004151265.1|4593691_4594117_-	hypothetical protein	NA	R9TPP7	Aeromonas_phage	47.9	5.1e-28
WP_004151266.1|4594119_4594482_-	hypothetical protein	NA	A0A173GCE0	Salmonella_phage	45.0	1.8e-18
WP_004151267.1|4594481_4594655_-	hypothetical protein	NA	I6R0P9	Salmonella_phage	56.1	1.4e-13
WP_004151268.1|4594654_4595035_-	hypothetical protein	NA	F1C5E2	Cronobacter_phage	55.3	5.3e-29
WP_004151269.1|4595037_4595277_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151270.1|4595287_4596382_-	hypothetical protein	NA	F1C5E1	Cronobacter_phage	62.8	1.7e-123
WP_004151271.1|4596393_4596822_-	hypothetical protein	NA	F1C5E0	Cronobacter_phage	60.8	1.6e-42
WP_004151272.1|4596825_4598211_-	DUF2213 domain-containing protein	NA	F1C5D9	Cronobacter_phage	60.0	2.3e-154
WP_004151273.1|4598283_4598760_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151274.1|4598801_4599806_-|head	phage head morphogenesis protein	head	F1C5D8	Cronobacter_phage	69.7	9.0e-116
WP_004151275.1|4599780_4601202_-	DUF1073 domain-containing protein	NA	F1C5D7	Cronobacter_phage	57.1	9.6e-148
WP_004151276.1|4601214_4602687_-	hypothetical protein	NA	A0A1W6JNY3	Morganella_phage	82.5	1.3e-248
WP_004151277.1|4602686_4603289_-	hypothetical protein	NA	G8C7P2	Escherichia_phage	80.9	5.4e-76
WP_004151279.1|4603659_4603989_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151280.1|4604094_4604559_-|lysis	lysis protein	lysis	Q76H63	Enterobacteria_phage	73.2	2.4e-55
WP_004151281.1|4604555_4605086_-	lysozyme	NA	G9L6J6	Escherichia_phage	78.5	6.0e-79
WP_004151282.1|4605088_4605337_-|holin	class II holin family protein	holin	NA	NA	NA	NA
WP_022644626.1|4606073_4607120_-|transposase	IS481-like element ISKpn28 family transposase	transposase	A0A0M3LR35	Mannheimia_phage	21.9	1.3e-05
WP_004151283.1|4607347_4608037_-	antitermination protein	NA	I6PDF8	Cronobacter_phage	54.5	1.4e-56
WP_004151284.1|4608033_4608564_-	HNH endonuclease	NA	A0A193GYW9	Enterobacter_phage	43.1	5.2e-30
WP_004151285.1|4608556_4608694_-	YlcG family protein	NA	NA	NA	NA	NA
WP_004151286.1|4608690_4609326_-	recombination protein NinG	NA	M9NYX8	Enterobacteria_phage	77.9	2.7e-81
WP_004151287.1|4609318_4609489_-	NinE family protein	NA	G8C7V4	Escherichia_phage	73.2	1.3e-14
WP_004151288.1|4609488_4609944_-	hypothetical protein	NA	K7P7B8	Enterobacteria_phage	69.5	8.0e-56
WP_004151291.1|4610444_4611092_-	DUF551 domain-containing protein	NA	A5LH60	Enterobacteria_phage	32.6	4.5e-12
WP_004151292.1|4611088_4611265_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151293.1|4611264_4612107_-	ead/Ea22-like family protein	NA	A0A2H4FRZ0	Salmonella_phage	60.8	1.8e-29
WP_004151294.1|4612213_4612720_-	hypothetical protein	NA	A0A0A6Z565	Enterobacter_phage	59.6	3.0e-27
WP_004151295.1|4612716_4613010_-	protein ren	NA	O48423	Enterobacteria_phage	65.6	3.3e-26
WP_004230547.1|4613009_4614425_-	AAA family ATPase	NA	Q9MCT4	Escherichia_phage	67.1	1.8e-183
WP_004230546.1|4614429_4615281_-	hypothetical protein	NA	F1C5C3	Cronobacter_phage	56.3	5.3e-85
WP_004151298.1|4615321_4615468_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001548453.1|4615553_4615775_-	hypothetical protein	NA	G8EYH8	Enterobacteria_phage	41.7	6.9e-05
WP_004151299.1|4615815_4616049_-	helix-turn-helix domain-containing protein	NA	G8C7U2	Escherichia_phage	50.7	4.3e-13
WP_004151300.1|4616176_4616866_+	helix-turn-helix transcriptional regulator	NA	G8C7U1	Escherichia_phage	52.2	4.3e-61
WP_004151301.1|4617216_4617432_+	hypothetical protein	NA	B5WZV1	Pseudomonas_phage	48.6	1.6e-09
WP_004151302.1|4617428_4617539_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151303.1|4617531_4617726_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151304.1|4617814_4618099_+	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	62.8	8.0e-30
WP_004151305.1|4618114_4618960_+	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	59.2	6.9e-69
WP_004151306.1|4618956_4619637_+	YqaJ viral recombinase family protein	NA	A0A0M3ULE0	Salmonella_phage	93.4	7.9e-124
WP_004151308.1|4619633_4619792_+	DUF1317 family protein	NA	A0A0N7CHV0	Escherichia_phage	60.8	3.0e-10
WP_004151310.1|4619788_4620445_+	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	87.5	2.7e-113
WP_004151312.1|4620441_4621209_+	hypothetical protein	NA	D5LH17	Escherichia_phage	53.4	1.7e-66
WP_004151314.1|4621205_4621424_+	hypothetical protein	NA	A0A1I9LJM7	Stx_converting_phage	47.2	1.2e-09
WP_004151316.1|4621425_4621641_+	TraR/DksA family transcriptional regulator	NA	A0A0K2FI84	Escherichia_phage	52.9	4.0e-13
WP_004151317.1|4621642_4621978_+	excisionase family DNA-binding protein	NA	NA	NA	NA	NA
WP_004143017.1|4623448_4624315_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	34.8	1.3e-30
WP_004143016.1|4624316_4624529_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_004143010.1|4624574_4625960_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.4	3.5e-46
>prophage 11
NZ_CP008797	Klebsiella pneumoniae subsp. pneumoniae KPNIH24 chromosome, complete genome	5396164	4835515	4847169	5396164	integrase	Enterobacteria_phage(70.0%)	13	4835965:4835979	4859022:4859036
WP_004144574.1|4835515_4836619_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.5	4.8e-62
4835965:4835979	attL	CAATCTCTCCGCGCT	NA	NA	NA	NA
WP_002889940.1|4836629_4837883_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	44.9	8.9e-89
WP_002889938.1|4838235_4839426_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	62.7	6.4e-145
WP_004152029.1|4839413_4840364_+	AAA family ATPase	NA	A0A1X9IGI7	Lactococcus_phage	27.1	1.2e-13
WP_004152979.1|4840363_4840789_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002889930.1|4841357_4841924_-	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	64.3	1.5e-59
WP_002889919.1|4841941_4842187_-	ogr/Delta-like zinc finger family protein	NA	Q7M294	Enterobacteria_phage	58.0	1.9e-19
WP_002889917.1|4842183_4842921_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	60.7	9.0e-73
WP_002889915.1|4843462_4843729_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	71.6	2.6e-30
WP_024940872.1|4843725_4844283_+	ash family protein	NA	Q7M2A7	Enterobacteria_phage	70.4	1.8e-33
WP_002889911.1|4844279_4844507_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002889897.1|4844503_4844824_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_002889890.1|4844835_4847169_+	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	82.2	0.0e+00
4859022:4859036	attR	CAATCTCTCCGCGCT	NA	NA	NA	NA
>prophage 1
NZ_CP008798	Klebsiella pneumoniae subsp. pneumoniae KPNIH24 plasmid pKPC-484, complete sequence	85473	2033	71903	85473	transposase,integrase	Escherichia_phage(41.94%)	61	43698:43757	62336:63155
WP_001389365.1|2033_2798_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_001137892.1|3290_3875_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000004159.1|3874_5113_-	MFS transporter	NA	NA	NA	NA	NA
WP_000219391.1|5109_6015_-	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_001067855.1|6136_6841_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_044117068.1|8144_8813_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	99.5	1.9e-130
WP_004153729.1|9668_10496_+	phosphonate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.6	2.6e-20
WP_004152695.1|10492_11356_+	phosphate/phosphite/phosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004152694.1|11364_12192_+	phosphonate ABC transporter, permease protein PhnE	NA	NA	NA	NA	NA
WP_004152693.1|12200_13211_+	phosphonate dehydrogenase PtxD	NA	A0A1V0SBV6	Catovirus	25.1	1.4e-15
WP_004152692.1|13204_14074_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000019473.1|15282_16263_-|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_000034420.1|16468_17260_-	sulfonamide-resistant dihydropteroate synthase Sul3	NA	A0A0B5J4J5	Pandoravirus	26.5	1.2e-14
WP_001354008.1|17728_17974_-	GrpB family protein	NA	NA	NA	NA	NA
WP_000612791.1|18011_18875_-	SDR family oxidoreductase	NA	W8CYX9	Bacillus_phage	31.0	2.5e-05
WP_011264039.1|19020_19260_-	macrolide transporter	NA	A0A2K5B2B5	Erysipelothrix_phage	46.2	9.5e-08
WP_001067858.1|19332_20037_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_001199192.1|20150_20927_+	aminoglycoside N-acetyltransferase AAC(3)-IVa	NA	NA	NA	NA	NA
WP_000742814.1|21155_22181_+	aminoglycoside O-phosphotransferase APH(4)-Ia	NA	NA	NA	NA	NA
WP_000602738.1|22602_23355_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	44.7	2.4e-41
WP_004152390.1|25412_25574_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001145103.1|25600_26593_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001404092.1|26641_26797_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152391.1|27091_28807_-	Tn3-like element Tn4401 family resolvase TnpR	NA	NA	NA	NA	NA
WP_004152392.1|28916_31946_+|transposase	Tn3-like element Tn4401 family transposase	transposase	NA	NA	NA	NA
WP_004199214.1|32052_33078_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	50.3	1.4e-87
WP_004152394.1|33074_33854_+	IS21-like element ISKpn7 family helper ATPase IstB	NA	A0A2L1IVB6	Escherichia_phage	61.8	2.5e-89
WP_004199234.1|34141_35023_+	carbapenem-hydrolyzing class A beta-lactamase KPC-2	NA	A0A1B0VBP7	Salmonella_phage	52.2	2.2e-73
WP_004152397.1|35272_36592_-|transposase	IS1182-like element ISKpn6 family transposase	transposase	Q9MBP7	Staphylococcus_prophage	24.2	1.9e-12
WP_004152398.1|36868_38053_-|transposase	ISAs1-like element ISKpn31 family transposase	transposase	NA	NA	NA	NA
WP_004152400.1|38556_38916_+	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	62.0	3.6e-19
WP_004152401.1|39572_39983_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152402.1|40081_40702_-	recombinase family protein	NA	A0A219Y912	Aeromonas_phage	31.5	2.0e-09
WP_022644675.1|40790_43688_-|transposase	Tn3-like element Tn5403 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.7	3.5e-181
43698:43757	attL	GGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCTG	NA	NA	NA	NA
WP_001067855.1|43760_44465_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000027057.1|46208_47069_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001300294.1|48979_49648_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_000993386.1|49683_49920_-	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_001277456.1|49916_50279_-	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_000105636.1|50296_51991_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	8.8e-39
WP_001340589.1|52042_52465_-	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_072093211.1|52500_52626_-	mercury transporter	NA	NA	NA	NA	NA
WP_004152334.1|53357_54068_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_001044770.1|54141_54558_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_001261282.1|54554_54785_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_072202616.1|54741_55203_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000493378.1|55346_55697_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000129823.1|55747_56491_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000015958.1|56487_57264_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	92.9	6.4e-53
WP_001143775.1|57535_60541_-|transposase	Tn3-like element Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	99.3	0.0e+00
WP_001217881.1|60702_61260_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	98.4	2.0e-93
WP_063840280.1|61493_62048_+	AAC(6')-Ib family aminoglycoside 6'-N-acetyltransferase	NA	NA	NA	NA	NA
WP_001067855.1|62398_63103_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_032409716.1|63685_63790_-	hypothetical protein	NA	NA	NA	NA	NA
62336:63155	attR	GGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCTGCACATGAACCCATTCAAAGGCCGGCATTTTCAGCGTGACATCATTCTGTGGGCCGTACGCTGGTACTGCAAATACGGCATCAGTTACCGTGAGCTGCAGGAGATGCTGGCTGAACGCGGAGTGAATGTCGATCACTCCACGATTTACCGCTGGGTTCAGCGTTATGCGCCTGAAATGGAAAAACGGCTGCGCTGGTACTGGCGTAACCCTTCCGATCTTTGCCCGTGGCACATGGATGAAACCTACGTGAAGGTCAATGGCCGCTGGGCGTATCTGTACCGGGCCGTCGACAGCCGGGGCCGCACTGTCGATTTTTATCTCTCCTCCCGTCGTAACAGCAAAGCTGCATACCGGTTTCTGGGTAAAATCCTCAACAACGTGAAGAAGTGGCAGATCCCGCGATTCATCAACACGGATAAAGCGCCCGCCTATGGTCGCGCGCTTGCTCTGCTCAAACGCGAAGGCCGGTGCCCGTCTGACGTTGAACACCGACAGATTAAGTACCGGAACAACGTGATTGAATGCGATCATGGCAAACTGAAACGGATAATCGGCGCCACGCTGGGATTTAAATCCATGAAGACGGCTTACGCCACCATCAAAGGTATTGAGGTGATGCGTGCACTACGCAAAGGCCAGGCCTCAGCATTTTATTATGGTGATCCCCTGGGCGAAATGCGCCTGGTAAGCAGAGTTTTTGAAATGTAAGGCCTTTGAATAAGACAAAAGGCTGCCTCATCGCTAACTTTGCAACAGTGCC	NA	NA	NA	NA
WP_004118283.1|64319_65186_+	replication initiation protein	NA	A0A222YYK1	Escherichia_phage	31.1	1.5e-23
WP_000339857.1|65362_65632_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000368714.1|66046_67252_+	AAA family ATPase	NA	A0A077SL49	Escherichia_phage	69.6	2.4e-163
WP_000064119.1|67251_68226_+	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	54.1	5.0e-87
WP_001754953.1|68307_69579_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.7	5.4e-150
WP_000776034.1|69578_70010_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	53.3	1.6e-29
WP_004178082.1|70415_71903_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
>prophage 1
NZ_CP008799	Klebsiella pneumoniae subsp. pneumoniae KPNIH24 plasmid pKPN-819, complete sequence	58050	23028	45571	58050	transposase,lysis	Escherichia_phage(66.67%)	19	NA	NA
WP_001067855.1|23028_23733_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_004152552.1|27061_27211_-|lysis	colicin release lysis protein	lysis	NA	NA	NA	NA
WP_004152553.1|27295_27553_-	cloacin	NA	NA	NA	NA	NA
WP_004199321.1|27562_28384_-	cytotoxic family protein	NA	NA	NA	NA	NA
WP_001067855.1|28724_29429_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_063840280.1|29779_30334_-	AAC(6')-Ib family aminoglycoside 6'-N-acetyltransferase	NA	NA	NA	NA	NA
WP_001217881.1|30567_31125_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	98.4	2.0e-93
WP_001143775.1|31286_34292_+|transposase	Tn3-like element Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	99.3	0.0e+00
WP_000072676.1|34922_35186_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001146176.1|35175_35475_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000312627.1|35536_35914_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000165971.1|35982_36162_+	Rop family plasmid primer RNA-binding protein	NA	NA	NA	NA	NA
WP_004153058.1|36189_36720_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152551.1|36726_37458_-	replication-relaxation family protein	NA	NA	NA	NA	NA
WP_001067855.1|37697_38402_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_002904004.1|38538_39399_+	class A extended-spectrum beta-lactamase SHV-12	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
WP_002210513.1|39419_40181_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_002903955.1|40442_41345_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
WP_004199413.1|42553_45571_-|transposase	Tn3-like element IS3000 family transposase	transposase	A0A125RQ78	Bacillus_phage	24.7	5.5e-52
>prophage 1
NZ_CP008800	Klebsiella pneumoniae subsp. pneumoniae KPNIH24 plasmid pKPN-e44, complete sequence	194877	26876	71067	194877	transposase,protease,integrase	Salmonella_phage(20.0%)	37	45002:45061	59972:61171
WP_004118231.1|26876_27044_+|integrase	integrase	integrase	NA	NA	NA	NA
WP_004118840.1|27328_28456_+	transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004118229.1|28452_29046_+	ANTAR domain-containing protein	NA	NA	NA	NA	NA
WP_004152279.1|29042_29891_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_004118227.1|29890_30811_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_004152278.1|30823_32428_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004118225.1|32472_33420_+	acetamidase/formamidase family protein	NA	A0A1V0S8X7	Catovirus	22.7	9.6e-11
WP_004118832.1|33427_35161_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.6	6.9e-15
WP_004152557.1|38983_39331_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	95.7	2.0e-59
WP_020956879.1|39327_39714_-|transposase	transposase	transposase	B6DZU5	Stx2-converting_phage	90.7	1.1e-58
WP_004118217.1|40261_40897_-	His-Xaa-Ser repeat protein HxsA	NA	NA	NA	NA	NA
WP_000005560.1|40893_42006_-	His-Xaa-Ser system radical SAM maturase HxsC	NA	S5WIP3	Leptospira_phage	33.8	1.5e-47
WP_004118216.1|41998_43387_-	His-Xaa-Ser system radical SAM maturase HxsB	NA	S5VT21	Leptospira_phage	29.0	6.3e-51
WP_176716597.1|43386_43626_-	His-Xaa-Ser system protein HxsD	NA	NA	NA	NA	NA
45002:45061	attL	GGAAGGTGCGAACAAGTTCCTGATATGAGATCATCATATTCATCCGGAGCGCATCCCAGA	NA	NA	NA	NA
WP_000019473.1|45069_46050_+|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_003886462.1|46217_46454_+	hypothetical protein	NA	A0A1I9LJQ7	Stx_converting_phage	100.0	1.7e-41
WP_000656305.1|46654_47032_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001138064.1|47098_50065_-|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.6	0.0e+00
WP_000147567.1|50067_50628_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
WP_000454193.1|50753_51104_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_000845048.1|51306_52320_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001456218.1|52486_53329_+	alpha/beta fold putative hydrolase EstX	NA	NA	NA	NA	NA
WP_000050382.1|53424_54033_+	HAD-IB family hydrolase	NA	NA	NA	NA	NA
WP_001261740.1|54090_54882_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_000095725.1|55143_56403_+	chloramphenicol efflux MFS transporter CmlA1	NA	S4TR35	Salmonella_phage	31.7	4.8e-26
WP_001206316.1|56495_57287_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_000800531.1|57456_57789_+	quaternary ammonium compound efflux SMR transporter QacL	NA	NA	NA	NA	NA
WP_000019473.1|58982_59963_-|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_004118209.1|61164_61428_-|transposase	transposase	transposase	NA	NA	NA	NA
59972:61171	attR	TCTGGGATGCGCTCCGGATGAATATGATGATCTCATATCAGGAACTTGTTCGCACCTTCCCTAAGTCAATCACTTTAAAGACTGAAGTCTGGCGCAGTAGCCCCTGAAAGTTGAATATCCAATTCCAATGAGTAGGGGGCTGAGCCATCCGGTAAGGGCTGAATTTGCCTGCGGGATTGGCTCAGCCCGCCAGACCCGTTTGGTGTTGCGCCGGACAATGTCCGGCGGCAAAGAAGGTAATGACTCCAACTTACTGATAGTGTTTTATGTTCAGATAATGCCCGATGACTTTGTCATGCAGCTCCACCGATTTTGAGAACGACAGTGACTTCCTGCCCAGCCTTGCCAGATGCTGCCTCAGATTCAGGTTATGCCGCTCAATGCGCTGCGTATATCGCTTGCTGATAACGTGCAGTTCTCCCTTCAGGCGTGATTCATAAAGCGGCCAGCCATCCGTCATCCATACCACGACCTCAAAGGCCGACAGCAGGCCCAGAAGACGCTCCAGCGTGGACAACGTGCGTTCACCGAATACGTGCGCCACAACCGTCCTCCGTATCCTGTCATACGCGTAAAACAACCAGCGCTGGCGTGATTTAGCACCGACGTAACCCCACTGTTCGTCCATTTCCGCGCAAACAATGACGTCACTGCCCGGTTGTATGCGTGAGGTTACCGACTGCGGTCTGAGTTTTTTAAGTGACGTAAAATCGTGTTGAGGCCAACGCCCATAATGCGGGCGGTTGCCCGGCATCCAACGCCATTCATGGCCATATCAATGATTTTCTGGTGCGTACCGGGCTGAGAGGCGGTGTAAGTGAACTGTAGTTGCCATGTTTTACGGCAGTGAGAGCAGAGATAGCGCTGATGTCCGGCAGTGCTTTTGCCGTTACGCACCACGCCTTCAGTAGCGGAGCAGGAAGGACATCTGATGGAAATGGAAGCCACCCGCACAGCGCGCTGGGATATCACTCCCCGAGGGAATACCGGCAGCGGACATCGTTAACTTAAGATACAAAAGCTGTTCGGAGATGGAGGGTCAAGATCAGGGTGACCTGCGCCATGATGTTATCCGAGCCCTGTTTCCTAATCACTACACCGGTATTTGATTACCCAGGTCAACTTCAGGCTGTTACAGGGACGGCAACCGTGTCAGCACATCCTTGAGATAGGCATACGGATCGTGCCCATTATTACGGG	NA	NA	NA	NA
WP_004118208.1|61442_61706_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152118.1|61949_62231_+	helix-turn-helix domain-containing protein	NA	A0A1B1IUF9	uncultured_Mediterranean_phage	38.2	5.2e-05
WP_004152117.1|62265_62835_+	small heat shock protein sHSP20	NA	NA	NA	NA	NA
WP_004152116.1|62949_65745_+	heat shock survival AAA family ATPase ClpK	NA	K4FB40	Cronobacter_phage	41.0	5.2e-129
WP_004152115.1|65744_65942_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009483782.1|66179_66929_+	phosphate-starvation-inducible PsiE family protein	NA	NA	NA	NA	NA
WP_004152113.1|66915_67878_+|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_020314316.1|69720_71067_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
