The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	0	9036	6152190		Bacillus_thuringiensis_phage(50.0%)	6	NA	NA
WP_004855823.1|3025_3658_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_014227367.1|4241_4748_+	Der GTPase-activating protein YihI	NA	NA	NA	NA	NA
WP_032693313.1|4936_6310_+	oxygen-independent coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
WP_004855828.1|6346_6457_-	YshB family small membrane protein	NA	NA	NA	NA	NA
WP_004107350.1|6568_7978_-	nitrogen regulation protein NR(I)	NA	Q56AR1	Bacillus_thuringiensis_phage	28.3	4.8e-06
WP_004127098.1|7986_9036_-	nitrogen regulation protein NR(II)	NA	Q8QKV7	Ectocarpus_siliculosus_virus	25.7	2.2e-08
>prophage 2
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	15860	16778	6152190		Pandoravirus(100.0%)	1	NA	NA
WP_014836999.1|15860_16778_-	alpha/beta hydrolase	NA	S4W4Z4	Pandoravirus	30.0	4.2e-19
>prophage 3
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	77659	79171	6152190		Staphylococcus_phage(100.0%)	1	NA	NA
WP_014227417.1|77659_79171_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.3	3.9e-14
>prophage 4
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	87475	162891	6152190	head,plate,portal,capsid,terminase,protease,tail,tRNA,integrase,transposase	Enterobacteria_phage(34.15%)	80	91680:91721	124559:124600
WP_004127220.1|87475_88096_+	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	58.9	2.4e-63
WP_014227423.1|88167_88842_+	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_004107505.1|88933_90307_-	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	23.3	4.5e-09
WP_004127228.1|90303_91002_-	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	4.0e-06
WP_004855993.1|91151_91655_+	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
91680:91721	attL	CACCATCCCTGTCTTCCCCCACATGATGTGGGGGTTTTTTTT	NA	NA	NA	NA
WP_042943998.1|91839_92820_-|integrase	tyrosine-type recombinase/integrase	integrase	U5N0A8	Enterobacteria_phage	81.8	2.0e-152
WP_042944001.1|92889_93183_-	helix-turn-helix transcriptional regulator	NA	Q1JS21	Enterobacteria_phage	76.3	5.9e-36
WP_103433597.1|93336_93633_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042944004.1|93816_94089_+	hypothetical protein	NA	Q1JS20	Enterobacteria_phage	86.7	5.7e-41
WP_042944006.1|94115_94334_+	DUF4761 family protein	NA	A0A0M5M1I3	Salmonella_phage	49.1	9.6e-07
WP_042944009.1|94350_94737_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042944011.1|94752_95025_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042944012.1|95094_95319_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042944014.1|95315_95894_+	3'-5' exoribonuclease	NA	A0A192Y6E0	Salmonella_phage	40.5	6.4e-34
WP_042944016.1|95904_96858_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A0M4QWR0	Salmonella_phage	56.6	3.4e-88
WP_042944017.1|96857_97127_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158413322.1|97126_97282_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103433596.1|97378_98275_+	hypothetical protein	NA	H2BDG1	Pseudomonas_virus	54.8	2.5e-24
WP_042944019.1|98267_100883_+	replication endonuclease	NA	A0A0M4RTM8	Salmonella_phage	51.1	8.1e-193
WP_142255201.1|100887_101247_-	biotin transporter BioY	NA	NA	NA	NA	NA
WP_042944023.1|101689_102742_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	68.0	2.7e-139
WP_042944024.1|102741_104463_-	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	65.6	1.3e-223
WP_042944025.1|104620_105454_+|capsid	phage capsid scaffolding protein	capsid	B9A7B4	Serratia_phage	74.7	6.9e-114
WP_042944028.1|105478_106528_+|capsid	phage major capsid protein, P2 family	capsid	A0A0M3ULA3	Salmonella_phage	54.8	1.8e-106
WP_042946152.1|106575_107472_+|terminase	terminase	terminase	B9A7B6	Serratia_phage	73.9	1.2e-90
WP_042946153.1|107574_108072_+|head	head completion/stabilization protein	head	B9A7B7	Serratia_phage	69.7	1.3e-59
WP_032737915.1|108071_108272_+|tail	tail protein	tail	A0A0A7NV57	Enterobacteria_phage	63.1	9.7e-14
WP_032737914.1|108262_108544_+	hypothetical protein	NA	B9A7B8	Serratia_phage	54.5	3.1e-18
WP_042944031.1|108540_109092_+	lysozyme	NA	Q1I0Z1	Pasteurella_virus	41.3	2.3e-28
WP_071889409.1|109332_109632_+	peptidase	NA	NA	NA	NA	NA
WP_042944035.1|109628_110087_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	46.4	9.0e-31
WP_042944037.1|110083_110725_+	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	47.8	3.2e-42
WP_042944038.1|110724_111309_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	61.9	3.0e-63
WP_042944040.1|111305_111674_+|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	59.1	3.6e-30
WP_042944042.1|111660_112560_+|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	59.5	2.9e-89
WP_042944045.1|112552_113149_+|tail	phage tail protein I	tail	E5G6N9	Salmonella_phage	44.0	7.3e-41
WP_142395362.1|113156_115250_+	hypothetical protein	NA	A0A0H3YEH5	Pectobacterium_phage	34.1	5.1e-81
WP_042944048.1|115259_115514_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042944050.1|115579_116746_+|tail	phage tail protein	tail	S4TP62	Salmonella_phage	49.0	7.4e-45
WP_042944051.1|116884_117373_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	62.3	1.8e-53
WP_042944052.1|117384_120165_-|tail	phage tail tape measure protein	tail	F1BUT7	Erwinia_phage	48.6	1.8e-126
WP_032415160.1|120154_120295_-|tail	GpE family phage tail protein	tail	O80316	Escherichia_phage	71.8	5.9e-10
WP_042944053.1|120327_120627_-	hypothetical protein	NA	B9A7B2	Serratia_phage	79.2	2.2e-33
WP_023328126.1|120681_121197_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	68.8	3.1e-64
WP_042944054.1|121196_122378_-|tail	tail protein	tail	A0A0A7NV69	Enterobacteria_phage	69.3	3.0e-155
WP_042946154.1|122531_123686_+	phage late control D family protein	NA	B9A7A9	Serratia_phage	80.9	6.5e-179
WP_071889411.1|123730_123979_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042946155.1|124070_124454_+	hypothetical protein	NA	A0A0M4QWT0	Salmonella_phage	55.9	2.9e-38
WP_014227425.1|124683_125580_+	CDF family cation-efflux transporter FieF	NA	NA	NA	NA	NA
124559:124600	attR	CACCATCCCTGTCTTCCCCCACATGATGTGGGGGTTTTTTTT	NA	NA	NA	NA
WP_004127238.1|125782_126745_+	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_004127241.1|126804_127290_-	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_032693284.1|127382_128309_-	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_004127247.1|128693_130028_-	HslU--HslV peptidase ATPase subunit	NA	W6AS21	Erwinia_phage	30.3	1.1e-44
WP_004107530.1|130037_130568_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_071889412.1|130658_131624_-	cell division protein FtsN	NA	NA	NA	NA	NA
WP_000019441.1|132529_133510_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	2.3e-185
WP_042944059.1|134094_136290_-	primosomal protein N'	NA	NA	NA	NA	NA
WP_004107543.1|136520_136736_+	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_004107547.1|136833_137151_-	met regulon transcriptional regulator MetJ	NA	NA	NA	NA	NA
WP_014227429.1|137417_138578_+	cystathionine gamma-synthase	NA	NA	NA	NA	NA
WP_014227430.1|138580_141013_+	bifunctional aspartate kinase/homoserine dehydrogenase II	NA	NA	NA	NA	NA
WP_004856015.1|141052_141424_-	4-carboxymuconolactone decarboxylase	NA	NA	NA	NA	NA
WP_042944060.1|141514_142420_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004856019.1|142586_143474_+	methylenetetrahydrofolate reductase	NA	NA	NA	NA	NA
WP_014227432.1|143596_144346_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	34.1	6.0e-24
WP_014227433.1|144474_145578_-	glycerol dehydrogenase	NA	NA	NA	NA	NA
WP_004107558.1|145633_146296_-	fructose-6-phosphate aldolase	NA	M4SLG0	Cyanophage	34.0	3.5e-28
WP_014227434.1|146501_147365_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_032693277.1|147516_148164_+	metal-binding protein ZinT	NA	NA	NA	NA	NA
WP_004856030.1|148257_150909_-	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
WP_014227436.1|151162_152314_-	acetylornithine deacetylase	NA	NA	NA	NA	NA
WP_014227437.1|152498_153503_+	N-acetyl-gamma-glutamyl-phosphate reductase	NA	NA	NA	NA	NA
WP_088941751.1|153509_154286_+	acetylglutamate kinase	NA	NA	NA	NA	NA
WP_014227439.1|154363_155737_+	argininosuccinate lyase	NA	NA	NA	NA	NA
WP_014227441.1|156004_156922_+	DNA-binding transcriptional regulator OxyR	NA	NA	NA	NA	NA
WP_004116922.1|156904_158305_-	Si-specific NAD(P)(+) transhydrogenase	NA	NA	NA	NA	NA
WP_004107582.1|158501_159137_+	HTH-type transcriptional repressor FabR	NA	NA	NA	NA	NA
WP_004856046.1|159152_159512_+	YijD family membrane protein	NA	NA	NA	NA	NA
WP_042944062.1|159557_160658_-|tRNA	tRNA (uridine(54)-C5)-methyltransferase TrmA	tRNA	NA	NA	NA	NA
WP_032693275.1|161022_162891_+	TonB-dependent vitamin B12 receptor BtuB	NA	A0A0P0I887	Acinetobacter_phage	27.7	2.8e-06
>prophage 5
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	173091	174738	6152190		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_014227445.1|173091_174738_+	acetolactate synthase 2 catalytic subunit	NA	E4WLQ6	Ostreococcus_tauri_virus	33.0	1.6e-66
>prophage 6
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	184429	195264	6152190		Vibrio_phage(20.0%)	9	NA	NA
WP_004097491.1|184429_185158_+	nicotinamide riboside transporter PnuC	NA	A0A126HGA3	Vibrio_phage	32.0	1.6e-21
WP_014227450.1|185260_187279_+	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.5	3.2e-112
WP_038423930.1|187282_188245_-	ribokinase	NA	NA	NA	NA	NA
WP_014837065.1|188228_189644_-	purine-cytosine permease	NA	NA	NA	NA	NA
WP_038423931.1|189662_190679_-	ADP-ribosylglycohydrolase family protein	NA	A0A172WZB4	Catopsilia_pomona_nucleopolyhedrovirus	25.8	7.4e-09
WP_004097500.1|190900_191641_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_160743202.1|191705_193202_-	guanosine-5'-triphosphate,3'-diphosphate diphosphatase	NA	NA	NA	NA	NA
WP_004127388.1|193327_194593_-	ATP-dependent RNA helicase RhlB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.8	8.3e-42
WP_004097507.1|194934_195264_+	thioredoxin TrxA	NA	A0A1V0SD63	Indivirus	38.5	2.5e-14
>prophage 7
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	199314	205454	6152190		Catovirus(20.0%)	6	NA	NA
WP_004097518.1|199314_200445_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	33.3	1.9e-26
WP_014837068.1|200441_201704_+	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1HNJ7	Paramecium_bursaria_Chlorella_virus	27.6	2.8e-26
WP_032720759.1|201700_202768_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.8	5.1e-101
WP_032720760.1|202785_203667_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	A0A291LA53	Escherichia_phage	66.0	1.1e-106
WP_038423932.1|203644_204319_+	dTDP-4-amino-4,6-dideoxy-D-galactose acyltransferase	NA	NA	NA	NA	NA
WP_032720774.1|204323_205454_+	dTDP-4-amino-4,6-dideoxygalactose transaminase	NA	A0A0F7LAY0	uncultured_marine_virus	42.5	5.1e-19
>prophage 8
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	228816	232675	6152190		uncultured_Mediterranean_phage(50.0%)	3	NA	NA
WP_009651718.1|228816_229719_+	tyrosine recombinase XerC	NA	A0A1B1IQT7	uncultured_Mediterranean_phage	28.9	2.3e-17
WP_014227468.1|229718_230435_+	5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB	NA	NA	NA	NA	NA
WP_014227469.1|230512_232675_+	DNA helicase II	NA	A7KV33	Bacillus_phage	37.2	1.3e-116
>prophage 9
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	236524	238351	6152190		Catovirus(100.0%)	1	NA	NA
WP_004097570.1|236524_238351_+	ATP-dependent DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	37.6	2.1e-83
>prophage 10
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	249155	255334	6152190		Alteromonas_phage(33.33%)	7	NA	NA
WP_038423936.1|249155_250604_+	DNA recombination protein RmuC	NA	R9RFD7	Alteromonas_phage	56.4	6.8e-08
WP_004097585.1|250674_251430_+	bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE	NA	NA	NA	NA	NA
WP_014227479.1|251443_252049_+	SCP2 domain-containing protein	NA	NA	NA	NA	NA
WP_009651715.1|252045_253686_+	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	M4R0M8	Ostreococcus_lucimarinus_virus	29.6	2.6e-40
WP_014227480.1|253763_254015_+	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_014227481.1|254018_254558_+	Sec-independent protein translocase subunit TatB	NA	NA	NA	NA	NA
WP_004097593.1|254560_255334_+	Sec-independent protein translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	30.0	1.5e-25
>prophage 11
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	264538	265153	6152190		Streptococcus_phage(100.0%)	1	NA	NA
WP_014227487.1|264538_265153_+	IMPACT family protein	NA	A0A1X9I5T8	Streptococcus_phage	32.1	1.4e-18
>prophage 12
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	275035	294740	6152190		uncultured_Mediterranean_phage(16.67%)	14	NA	NA
WP_014227490.1|275035_275986_-	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	31.6	3.0e-28
WP_004097636.1|276987_278172_+	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	27.2	8.9e-14
WP_004097638.1|278404_278788_+	preprotein translocase subunit SecE	NA	NA	NA	NA	NA
WP_002438628.1|278789_279335_+	transcription termination/antitermination protein NusG	NA	A0A291AUS6	Sinorhizobium_phage	29.1	3.1e-14
WP_004097640.1|279488_279917_+	50S ribosomal protein L11	NA	NA	NA	NA	NA
WP_004097642.1|279920_280625_+	50S ribosomal protein L1	NA	NA	NA	NA	NA
WP_004097644.1|281044_281542_+	50S ribosomal protein L10	NA	NA	NA	NA	NA
WP_004097645.1|281608_281974_+	50S ribosomal protein L7/L12	NA	NA	NA	NA	NA
WP_004097647.1|282299_286328_+	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	30.2	1.1e-23
WP_014227492.1|286404_290628_+	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	27.3	1.3e-67
WP_004097650.1|291024_292365_+	anaerobic C4-dicarboxylate transporter DcuB	NA	NA	NA	NA	NA
WP_004097651.1|292408_292726_-	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_004097653.1|292729_293035_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_014227493.1|293207_294740_-	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	29.7	3.8e-09
>prophage 13
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	303285	312058	6152190		Klosneuvirus(25.0%)	9	NA	NA
WP_014227502.1|303285_303957_+	deoxyribonuclease V	NA	A0A1V0SJW5	Klosneuvirus	31.2	1.9e-21
WP_014227503.1|303999_304590_+	YjaG family protein	NA	NA	NA	NA	NA
WP_004097675.1|304776_305049_+	DNA-binding protein HU-alpha	NA	A7KV42	Bacillus_phage	56.7	1.2e-19
WP_004097677.1|305061_305754_+	DUF1481 domain-containing protein	NA	NA	NA	NA	NA
WP_014227504.1|305757_306192_-	zinc resistance sensor/chaperone ZraP	NA	NA	NA	NA	NA
WP_014227505.1|306444_307833_+	two-component system sensor histidine kinase ZraS	NA	NA	NA	NA	NA
WP_032721071.1|307829_309164_+	sigma-54-dependent response regulator transcription factor ZraR	NA	Q6XM27	Feldmannia_irregularis_virus	29.9	2.4e-07
WP_014227507.1|309160_310453_-	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_014227508.1|310468_312058_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.7	1.1e-67
>prophage 14
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	325864	329548	6152190		Dickeya_phage(100.0%)	1	NA	NA
WP_025107717.1|325864_329548_+	methionine synthase	NA	A0A140XBC7	Dickeya_phage	90.2	4.9e-26
>prophage 15
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	345867	346656	6152190		Pseudomonas_phage(100.0%)	1	NA	NA
WP_042946159.1|345867_346656_+	nucleotidyltransferase domain-containing protein	NA	A0A2D1GQQ2	Pseudomonas_phage	45.9	1.4e-47
>prophage 16
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	359565	360675	6152190		Mycoplasma_phage(100.0%)	1	NA	NA
WP_004097762.1|359565_360675_+	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	47.2	6.2e-17
>prophage 17
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	367875	368484	6152190		Lactococcus_phage(100.0%)	1	NA	NA
WP_004097774.1|367875_368484_+	repressor LexA	NA	Q9G0C2	Lactococcus_phage	40.7	7.8e-14
>prophage 18
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	371594	418787	6152190	tRNA,integrase,transposase	Salmonella_phage(27.27%)	40	374952:374967	392555:392570
WP_014227542.1|371594_372593_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_014227543.1|372733_372976_+	envelope stress response protein PspG	NA	NA	NA	NA	NA
WP_014227544.1|373279_374263_-	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_004097788.1|374324_375740_+	replicative DNA helicase	NA	O80281	Escherichia_phage	78.3	2.8e-200
374952:374967	attL	GGCTATGACGATCTCA	NA	NA	NA	NA
WP_014837135.1|375885_376965_+	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	29.1	2.6e-28
WP_014227546.1|377203_378397_+	aromatic amino acid transaminase	NA	NA	NA	NA	NA
WP_004097791.1|378591_379305_+	acid phosphatase AphA	NA	NA	NA	NA	NA
WP_157214916.1|379318_379456_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014227547.1|379447_379864_+	YjbQ family protein	NA	NA	NA	NA	NA
WP_004097793.1|379867_380221_+	MmcQ/YjbR family DNA-binding protein	NA	NA	NA	NA	NA
WP_042944086.1|380223_380541_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032719343.1|380543_380954_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004097797.1|381086_383912_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	55.6	0.0e+00
WP_004097799.1|384158_384686_+	single-stranded DNA-binding protein SSB1	NA	A0A0A0P1Q9	Enterobacteria_phage	96.4	3.5e-55
WP_042944088.1|384845_386093_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_042944089.1|386079_387642_+	recombinase	NA	NA	NA	NA	NA
WP_042944091.1|387634_389668_+|integrase	integrase	integrase	NA	NA	NA	NA
WP_077255290.1|389819_390080_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077255263.1|390178_391147_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	97.2	1.5e-181
WP_042944097.1|391378_393412_+	alpha-amylase	NA	NA	NA	NA	NA
392555:392570	attR	GGCTATGACGATCTCA	NA	NA	NA	NA
WP_042944099.1|394450_394771_-	hypothetical protein	NA	J9Q750	Salmonella_phage	51.9	9.1e-30
WP_074181092.1|395048_396017_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	96.9	1.0e-180
WP_103433594.1|396553_397827_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.3	3.0e-169
WP_001548021.1|397931_398177_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042944104.1|398461_400039_-	lytic transglycosylase F	NA	K7RVN3	Vibrio_phage	31.7	2.4e-06
WP_014227550.1|400634_402896_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_014227551.1|403165_403516_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_025107695.1|403961_406385_+	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_071889416.1|406704_407094_+	anti-adapter protein IraM	NA	NA	NA	NA	NA
WP_004097808.1|407250_407532_-	membrane protein	NA	NA	NA	NA	NA
WP_042944108.1|408075_409680_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_004097813.1|409664_409994_-	superoxide response transcriptional regulator SoxS	NA	NA	NA	NA	NA
WP_004097815.1|410078_410537_+	redox-sensitive transcriptional activator SoxR	NA	NA	NA	NA	NA
WP_014227554.1|410794_411463_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_014227555.1|411851_413201_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	71.8	6.7e-159
WP_032695080.1|413348_414995_+	Na+/H+ antiporter	NA	NA	NA	NA	NA
WP_014227557.1|415043_415925_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004097823.1|416028_416439_+	CidA/LrgA family protein	NA	NA	NA	NA	NA
WP_014837142.1|416431_417121_+	LrgB family protein	NA	NA	NA	NA	NA
WP_016947617.1|417806_418787_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	6.8e-185
>prophage 19
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	428027	439139	6152190		Staphylococcus_phage(33.33%)	8	NA	NA
WP_042944116.1|428027_429986_-	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	41.5	3.5e-92
WP_004109428.1|430397_431711_+	glutamate/aspartate:proton symporter GltP	NA	NA	NA	NA	NA
WP_014837150.1|431747_432431_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_077598953.1|432637_434785_-	formate dehydrogenase subunit alpha	NA	A0A077SK27	Escherichia_phage	24.2	9.1e-33
WP_042944119.1|435046_435958_-	allose kinase	NA	NA	NA	NA	NA
WP_032695089.1|435941_436637_-	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_014837152.1|436647_437628_-	D-allose ABC transporter permease	NA	NA	NA	NA	NA
WP_042944120.1|437606_439139_-	D-allose ABC transporter ATP-binding protein AlsA	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.6	1.6e-10
>prophage 20
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	444806	446449	6152190		Organic_Lake_phycodnavirus(50.0%)	2	NA	NA
WP_032747532.1|444806_445493_-	phosphonate C-P lyase system protein PhnL	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.9	8.5e-09
WP_014227581.1|445690_446449_-	phosphonate C-P lyase system protein PhnK	NA	G3M9Y6	Bacillus_virus	25.8	2.2e-13
>prophage 21
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	451774	458709	6152190		Burkholderia_virus(25.0%)	8	NA	NA
WP_025107668.1|451774_453277_+	glycine betaine/L-proline transporter ProP	NA	Q6JIH2	Burkholderia_virus	32.0	7.0e-56
WP_014227586.1|453422_453728_-	chaperone modulator CbpM	NA	NA	NA	NA	NA
WP_042944127.1|453727_454648_-	curved DNA-binding protein	NA	A0A1V0SCV5	Indivirus	43.8	9.7e-08
WP_004097877.1|454798_455479_-	TerC family protein	NA	A0A0S4KZH7	Pseudomonas_phage	41.3	2.7e-31
WP_014837164.1|455702_456485_+	DsbA family protein	NA	NA	NA	NA	NA
WP_032747545.1|456518_457115_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_032719319.1|457230_457818_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_032695096.1|458274_458709_+	hypothetical protein	NA	E5AGC9	Erwinia_phage	38.3	5.7e-19
>prophage 22
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	472399	477929	6152190		Cronobacter_phage(33.33%)	5	NA	NA
WP_003855929.1|472399_472693_+	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	43.3	2.1e-12
WP_014227597.1|472736_474383_+	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	69.1	1.0e-188
WP_004097909.1|474516_474870_+	DUF4156 domain-containing protein	NA	NA	NA	NA	NA
WP_014837171.1|474916_475783_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042944129.1|475805_477929_-	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	26.9	5.5e-30
>prophage 23
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	483716	492811	6152190	transposase	Escherichia_phage(25.0%)	12	NA	NA
WP_016947617.1|483716_484697_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	6.8e-185
WP_032695144.1|484991_486020_-	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
WP_004097931.1|486062_486629_+	elongation factor P	NA	NA	NA	NA	NA
WP_004097932.1|486698_486830_+	entericidin A/B family lipoprotein	NA	NA	NA	NA	NA
WP_004097935.1|486992_487139_+	lipoprotein toxin entericidin B	NA	NA	NA	NA	NA
WP_014227609.1|487279_487597_+	quaternary ammonium compound efflux SMR transporter SugE	NA	NA	NA	NA	NA
WP_032747606.1|487593_488124_-	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	54.1	8.8e-46
WP_004097938.1|488264_488624_-	fumarate reductase subunit FrdD	NA	NA	NA	NA	NA
WP_004097939.1|488634_489030_-	fumarate reductase subunit FrdC	NA	NA	NA	NA	NA
WP_004109180.1|489040_489775_-	succinate dehydrogenase/fumarate reductase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_014227611.1|489767_491558_-	fumarate reductase (quinol) flavoprotein subunit	NA	A0A2P0ZL82	Lactobacillus_phage	26.8	2.2e-16
WP_014227612.1|491833_492811_+	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	29.1	1.2e-27
>prophage 24
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	500062	500608	6152190		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_004097954.1|500062_500608_+	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	41.6	7.7e-29
>prophage 25
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	505346	508578	6152190		Vibrio_phage(50.0%)	2	NA	NA
WP_014227620.1|505346_506678_+	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	29.6	4.3e-17
WP_042944134.1|506688_508578_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.3	1.7e-59
>prophage 26
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	514104	518466	6152190		Pithovirus(50.0%)	3	NA	NA
WP_004097979.1|514104_515403_+	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	1.7e-66
WP_004097980.1|515552_515978_+	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_004097981.1|516015_518466_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	31.9	3.2e-66
>prophage 27
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	558553	565105	6152190		uncultured_Caudovirales_phage(33.33%)	6	NA	NA
WP_004098041.1|558553_559081_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.3	7.1e-56
WP_032695162.1|559484_560441_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_014837206.1|560550_562053_+	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	29.5	2.2e-09
WP_014837207.1|562063_563089_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_004098052.1|563075_564062_+	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_004098053.1|564106_565105_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.7	5.7e-70
>prophage 28
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	585523	590299	6152190		Ralstonia_phage(33.33%)	3	NA	NA
WP_042944145.1|585523_587356_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	34.1	1.5e-20
WP_014227659.1|587373_587838_-	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	K4F9T1	Cronobacter_phage	57.7	8.5e-53
WP_032747666.1|588160_590299_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.6	9.1e-267
>prophage 29
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	598126	605908	6152190		Enterobacteria_phage(25.0%)	6	NA	NA
WP_014227667.1|598126_599074_-	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	23.0	1.3e-12
WP_042944153.1|599452_602161_+	magnesium-translocating P-type ATPase	NA	M1I547	Acanthocystis_turfacea_Chlorella_virus	27.0	4.8e-47
WP_009652347.1|602228_602615_-	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_038423978.1|602769_604239_-	N-acetylglucosamine-binding protein GbpA	NA	A0A0K1Y848	Apis_mellifera_filamentous_virus	38.5	1.4e-21
WP_004098115.1|604499_604961_-	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_014227670.1|604972_605908_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.5	7.7e-53
>prophage 30
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	611052	620102	6152190	tRNA	Klosneuvirus(33.33%)	6	NA	NA
WP_042944157.1|611052_613908_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.8	4.6e-141
WP_004098129.1|613907_614351_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_004098131.1|614473_615985_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.4	9.2e-48
WP_004098132.1|616378_617476_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_014227676.1|617475_618558_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_014227677.1|618599_620102_-	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.0	8.8e-83
>prophage 31
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	635818	645822	6152190	integrase,transposase	Bacillus_virus(25.0%)	10	637649:637663	650700:650714
WP_014227685.1|635818_636892_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.2	4.4e-28
WP_004117574.1|636897_637722_-	phosphodiesterase	NA	NA	NA	NA	NA
637649:637663	attL	TTGACGTCAATAAAG	NA	NA	NA	NA
WP_042944159.1|637732_638620_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_014227687.1|638609_639482_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_004128305.1|639672_640692_-	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L7I1	Tupanvirus	32.3	2.6e-46
WP_014227688.1|640821_641400_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_042944160.1|641399_642413_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_042944162.1|643005_644277_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	39.1	9.1e-81
WP_071830625.1|644408_644699_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016947617.1|644841_645822_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	6.8e-185
650700:650714	attR	CTTTATTGACGTCAA	NA	NA	NA	NA
>prophage 32
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	654357	659072	6152190	transposase	Staphylococcus_phage(50.0%)	4	NA	NA
WP_044352521.1|654357_654960_-	hypothetical protein	NA	A0A1Q1PW40	Staphylococcus_phage	28.1	1.3e-05
WP_049870902.1|655099_655414_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000227969.1|655945_657022_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_001189111.1|657563_659072_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.6e-44
>prophage 33
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	666028	669753	6152190	transposase	Staphylococcus_phage(66.67%)	3	NA	NA
WP_000019441.1|666028_667009_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	2.3e-185
WP_049870903.1|667054_668146_-	hypothetical protein	NA	A0A2H4PQP5	Staphylococcus_phage	32.6	9.3e-26
WP_042944181.1|668145_669753_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	55.0	8.3e-156
>prophage 34
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	676104	676347	6152190		Vibrio_phage(100.0%)	1	NA	NA
WP_071830629.1|676104_676347_-	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	41.7	2.1e-07
>prophage 35
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	680560	682162	6152190		Yersinia_phage(50.0%)	3	NA	NA
WP_042944188.1|680560_681385_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	36.5	2.4e-42
WP_049100007.1|681390_681639_+	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_042944189.1|681718_682162_+	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	27.3	6.1e-08
>prophage 36
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	698580	699945	6152190		Burkholderia_virus(100.0%)	1	NA	NA
WP_042944202.1|698580_699945_+	MHS family MFS transporter	NA	Q6JIH2	Burkholderia_virus	30.4	1.3e-45
>prophage 37
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	712622	718337	6152190		Staphylococcus_phage(50.0%)	3	NA	NA
WP_042944209.1|712622_715352_-	ribosome-associated ATPase/putative transporter RbbA	NA	A0A2H4PQG7	Staphylococcus_phage	30.1	1.7e-20
WP_032693056.1|715348_716416_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_042944212.1|716939_718337_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	38.9	1.5e-20
>prophage 38
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	726735	730122	6152190	holin	Serratia_phage(100.0%)	1	NA	NA
WP_014227749.1|726735_730122_-|holin	choline trimethylamine-lyase	holin	A0A1S6UAD4	Serratia_phage	45.0	9.7e-05
>prophage 39
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	736000	736585	6152190		Moraxella_phage(100.0%)	1	NA	NA
WP_004098242.1|736000_736585_-	TetR/AcrR family transcriptional regulator	NA	A0A0R6PIB6	Moraxella_phage	32.3	5.0e-10
>prophage 40
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	744940	748914	6152190		Acinetobacter_phage(50.0%)	2	NA	NA
WP_162763171.1|744940_746422_-	N-6 DNA methylase	NA	J7I0U9	Acinetobacter_phage	27.8	2.3e-35
WP_038424024.1|746484_748914_-	DEAD/DEAH box helicase family protein	NA	A0A0K1LLU7	Rhodobacter_phage	23.9	3.0e-08
>prophage 41
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	761301	763139	6152190		Streptococcus_phage(50.0%)	2	NA	NA
WP_032693014.1|761301_762513_+	DUF3440 domain-containing protein	NA	A0A220GKF8	Streptococcus_phage	32.5	7.9e-58
WP_014227775.1|762512_763139_+	ParB-like nuclease domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	52.3	3.2e-55
>prophage 42
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	797916	798939	6152190		Tupanvirus(100.0%)	1	NA	NA
WP_025106885.1|797916_798939_+	zinc-binding alcohol dehydrogenase family protein	NA	A0A2K9L7I1	Tupanvirus	28.4	3.6e-11
>prophage 43
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	805943	809111	6152190	transposase	Paramecium_bursaria_Chlorella_virus(50.0%)	3	NA	NA
WP_042944249.1|805943_807005_+	SIS domain-containing protein	NA	M1I2B0	Paramecium_bursaria_Chlorella_virus	23.7	1.6e-06
WP_042944251.1|807022_808033_+	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_032692991.1|808172_809111_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	52.9	8.5e-68
>prophage 44
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	812273	813553	6152190		Shigella_phage(50.0%)	2	NA	NA
WP_014227813.1|812273_813011_-	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	51.2	1.3e-63
WP_042944255.1|813013_813553_-	primosomal protein DnaT	NA	T1SA92	Salmonella_phage	60.6	7.1e-27
>prophage 45
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	826861	829566	6152190		Streptococcus_phage(50.0%)	3	NA	NA
WP_004098388.1|826861_828451_+	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	25.3	2.4e-30
WP_014227828.1|828668_829280_+	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_003856556.1|829404_829566_+	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	69.8	3.0e-13
>prophage 46
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	834234	835557	6152190		Geobacillus_virus(100.0%)	1	NA	NA
WP_032719268.1|834234_835557_+	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.4	3.4e-78
>prophage 47
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	841864	847084	6152190		Enterococcus_phage(33.33%)	3	NA	NA
WP_004098414.1|841864_843097_+	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	44.0	4.1e-86
WP_038424942.1|843205_844873_-	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.6	6.4e-42
WP_014227838.1|845146_847084_+	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	35.5	3.6e-12
>prophage 48
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	851048	852473	6152190		Bacillus_phage(100.0%)	1	NA	NA
WP_014227844.1|851048_852473_+	two-component system sensor histidine kinase CreC	NA	W8CYF6	Bacillus_phage	27.7	2.1e-17
>prophage 49
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	863555	864509	6152190		Cyanophage(100.0%)	1	NA	NA
WP_004098458.1|863555_864509_+	transaldolase	NA	A0A127KNC6	Cyanophage	31.5	2.8e-10
>prophage 50
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	868895	877179	6152190		Chrysochromulina_ericina_virus(25.0%)	7	NA	NA
WP_004128758.1|868895_870812_+	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	50.6	6.4e-147
WP_014837364.1|870899_872036_+	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	35.5	3.6e-28
WP_014227855.1|872203_873151_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014227856.1|873275_873623_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032719260.1|873700_874234_-	glycoside hydrolase family 108 protein	NA	A0A286N2Q6	Klebsiella_phage	55.5	3.3e-53
WP_014227858.1|874250_874694_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_042944266.1|875079_877179_+	chitinase	NA	A0A1L5JGH0	Plodia_interpunctella_granulovirus	28.5	4.0e-33
>prophage 51
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	881816	888504	6152190	tRNA	uncultured_Caudovirales_phage(50.0%)	5	NA	NA
WP_014227862.1|881816_882992_+	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	49.1	8.4e-89
WP_014227863.1|883044_883944_+	transcriptional activator NhaR	NA	NA	NA	NA	NA
WP_003018940.1|884110_884374_-	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_042944269.1|884704_885643_+	bifunctional riboflavin kinase/FAD synthetase	NA	NA	NA	NA	NA
WP_014227864.1|885687_888504_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L9X8	Tupanvirus	25.4	6.7e-76
>prophage 52
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	914826	915975	6152190		Halovirus(100.0%)	1	NA	NA
WP_032694438.1|914826_915975_+	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	31.9	3.1e-48
>prophage 53
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	922718	924087	6152190		Bacillus_phage(50.0%)	2	NA	NA
WP_004098524.1|922718_923198_+	type 3 dihydrofolate reductase	NA	A0A076GDN3	Bacillus_phage	40.9	6.7e-29
WP_014227890.1|923238_924087_-	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	S4TT53	Salmonella_phage	30.7	9.9e-07
>prophage 54
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	936628	942080	6152190		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_014227898.1|936628_939535_-	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	36.6	2.9e-21
WP_038424064.1|939722_942080_-	DNA polymerase II	NA	D0FZR7	Heterocapsa_circularisquama_DNA_virus	37.1	8.0e-06
>prophage 55
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	948294	948996	6152190		Bacillus_virus(100.0%)	1	NA	NA
WP_014227903.1|948294_948996_-	thiamine ABC transporter ATP-binding protein ThiQ	NA	G3M9Y6	Bacillus_virus	34.7	1.3e-20
>prophage 56
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	969763	971488	6152190		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_014227916.1|969763_971488_+	acetolactate synthase 3 large subunit	NA	E5ERI2	Ostreococcus_lucimarinus_virus	26.2	3.9e-34
>prophage 57
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	997605	998649	6152190		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_009654638.1|997605_998649_+	GMP reductase	NA	A0A0N9Q9A5	Chrysochromulina_ericina_virus	55.6	2.2e-101
>prophage 58
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	1002978	1003530	6152190		Thiobacimonas_phage(100.0%)	1	NA	NA
WP_042944299.1|1002978_1003530_+	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1B0T6G1	Thiobacimonas_phage	35.1	1.6e-13
>prophage 59
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	1014778	1016203	6152190		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_004098637.1|1014778_1016203_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.9	4.6e-41
>prophage 60
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	1025984	1026755	6152190		Escherichia_phage(100.0%)	1	NA	NA
WP_014227944.1|1025984_1026755_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	37.0	7.5e-30
>prophage 61
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	1031635	1038216	6152190		Mamastrovirus(33.33%)	5	NA	NA
WP_014227948.1|1031635_1033237_+	multicopper oxidase CueO	NA	A0A0C6DWA2	Mamastrovirus	48.3	1.1e-19
WP_014227949.1|1033337_1035728_-	glucose/quinate/shikimate family membrane-bound PQQ-dependent dehydrogenase	NA	NA	NA	NA	NA
WP_014227950.1|1035931_1036468_+	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.8	2.7e-18
WP_004098666.1|1036519_1037182_-	carbonate dehydratase	NA	NA	NA	NA	NA
WP_014227952.1|1037289_1038216_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.0	1.8e-22
>prophage 62
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	1050821	1057587	6152190	tRNA	unidentified_phage(50.0%)	6	NA	NA
WP_071881716.1|1050821_1052219_-	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	37.8	4.9e-27
WP_014227966.1|1052270_1053152_-|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_004098689.1|1053212_1053668_-	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
WP_014227967.1|1053832_1054549_-	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
WP_014227968.1|1054548_1055085_-	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
WP_014227969.1|1055157_1057587_+	ATP-dependent helicase HrpB	NA	A0A0U2UIE6	Niemeyer_virus	32.2	6.7e-40
>prophage 63
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	1079627	1080425	6152190		Planktothrix_phage(100.0%)	1	NA	NA
WP_004098728.1|1079627_1080425_+	Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC	NA	G9BWD6	Planktothrix_phage	27.4	1.2e-14
>prophage 64
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	1087449	1087794	6152190		Lake_Baikal_phage(100.0%)	1	NA	NA
WP_004098733.1|1087449_1087794_+	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	53.2	1.6e-27
>prophage 65
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	1091925	1097729	6152190	protease	uncultured_Mediterranean_phage(50.0%)	3	NA	NA
WP_004098740.1|1091925_1093365_+|protease	serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	29.5	1.8e-24
WP_161505896.1|1093502_1094714_+	DNA-binding transcriptional regulator CdaR	NA	NA	NA	NA	NA
WP_014227995.1|1094750_1097729_-	viral enhancin protein	NA	A9YMZ4	Helicoverpa_armigera_granulovirus	24.0	1.1e-41
>prophage 66
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	1108163	1108940	6152190		Flavobacterium_phage(100.0%)	1	NA	NA
WP_025107386.1|1108163_1108940_+	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	40.7	2.1e-24
>prophage 67
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	1117774	1121892	6152190		Emiliania_huxleyi_virus(50.0%)	2	NA	NA
WP_014228005.1|1117774_1118371_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	38.9	4.6e-27
WP_009654544.1|1118409_1121892_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.4	2.5e-205
>prophage 68
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	1136663	1137695	6152190		Planktothrix_phage(100.0%)	1	NA	NA
WP_004098793.1|1136663_1137695_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	39.7	1.9e-36
>prophage 69
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	1144288	1145092	6152190		Staphylococcus_phage(100.0%)	1	NA	NA
WP_014228019.1|1144288_1145092_+	2,5-didehydrogluconate reductase DkgB	NA	A0A2H4PQR8	Staphylococcus_phage	36.0	1.2e-38
>prophage 70
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	1149136	1153347	6152190		Lactobacillus_phage(33.33%)	5	NA	NA
WP_014228024.1|1149136_1150504_-	murein transglycosylase D	NA	A0A0A7NU10	Lactobacillus_phage	30.6	4.3e-12
WP_014228025.1|1150575_1151331_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_014837464.1|1151417_1152086_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_014228027.1|1152082_1152550_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	60.4	1.7e-53
WP_014228028.1|1152615_1153347_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	38.0	4.6e-37
>prophage 71
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	1157447	1158029	6152190		Caulobacter_phage(100.0%)	1	NA	NA
WP_004099149.1|1157447_1158029_+	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	29.6	1.1e-12
>prophage 72
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	1193082	1194558	6152190		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_014228053.1|1193082_1194558_-	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	30.8	1.7e-46
>prophage 73
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	1199829	1200303	6152190		Burkholderia_phage(100.0%)	1	NA	NA
WP_032693194.1|1199829_1200303_-	hypothetical protein	NA	K4NX96	Burkholderia_phage	34.4	2.8e-19
>prophage 74
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	1216973	1221844	6152190		Catovirus(50.0%)	5	NA	NA
WP_042946170.1|1216973_1218506_-	aromatic amino acid lyase	NA	A0A1V0S940	Catovirus	34.8	3.1e-67
WP_042944349.1|1218516_1219392_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_014228066.1|1219422_1220103_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_004848024.1|1220105_1220750_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_042944351.1|1220746_1221844_-	ATP-binding cassette domain-containing protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	23.7	1.8e-08
>prophage 75
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	1233684	1235085	6152190	integrase	Ralstonia_phage(100.0%)	1	1218743:1218757	1237334:1237348
1218743:1218757	attL	TCTTTTTTGATTGCT	NA	NA	NA	NA
WP_001407714.1|1233684_1235085_+|integrase	integrase family protein	integrase	A0A221SAN4	Ralstonia_phage	28.4	9.5e-07
WP_001407714.1|1233684_1235085_+|integrase	integrase family protein	integrase	A0A221SAN4	Ralstonia_phage	28.4	9.5e-07
1237334:1237348	attR	TCTTTTTTGATTGCT	NA	NA	NA	NA
>prophage 76
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	1243855	1245010	6152190		Tupanvirus(100.0%)	1	NA	NA
WP_042944378.1|1243855_1245010_+	cyclopropane fatty acyl phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	44.1	4.4e-82
>prophage 77
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	1257873	1258677	6152190		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_042944381.1|1257873_1258677_+	aquaporin	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	27.6	4.8e-11
>prophage 78
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	1263992	1266752	6152190		Yersinia_phage(33.33%)	5	NA	NA
WP_042944391.1|1263992_1264814_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	34.3	2.8e-38
WP_023567995.1|1264894_1265365_+	antirestriction protein	NA	A9J566	Pseudomonas_phage	32.8	7.1e-15
WP_042944395.1|1265376_1265856_+	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_042944397.1|1265870_1266092_+	DUF987 domain-containing protein	NA	NA	NA	NA	NA
WP_042944399.1|1266107_1266752_+	hypothetical protein	NA	K4JU95	Caulobacter_phage	28.6	1.5e-15
>prophage 79
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	1269994	1273705	6152190		Streptococcus_phage(66.67%)	3	NA	NA
WP_014228088.1|1269994_1271248_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	46.3	2.2e-95
WP_004848066.1|1271258_1272362_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.2	2.4e-61
WP_042944410.1|1272652_1273705_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	58.2	9.7e-113
>prophage 80
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	1278456	1279200	6152190		Bacillus_virus(100.0%)	1	NA	NA
WP_042944415.1|1278456_1279200_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.8	4.5e-32
>prophage 81
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	1286384	1287227	6152190		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_014228100.1|1286384_1287227_-	phosphonate ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	26.6	1.2e-12
>prophage 82
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	1296472	1300597	6152190		Brazilian_cedratvirus(66.67%)	5	NA	NA
WP_014837542.1|1296472_1297291_-	amino acid ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	30.9	2.3e-16
WP_032693222.1|1297304_1298114_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004129481.1|1298836_1299019_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004848112.1|1299126_1299822_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	24.9	8.1e-07
WP_014228113.1|1299814_1300597_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	23.7	5.1e-10
>prophage 83
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	1311989	1313036	6152190		Bacillus_virus(100.0%)	1	NA	NA
WP_014228120.1|1311989_1313036_-	ferric ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.7	8.9e-34
>prophage 84
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	1321092	1321860	6152190		Planktothrix_phage(100.0%)	1	NA	NA
WP_004848135.1|1321092_1321860_+	taurine ABC transporter ATP-binding subunit	NA	G9BWD6	Planktothrix_phage	38.6	1.5e-25
>prophage 85
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	1346239	1355460	6152190		Bacillus_phage(60.0%)	7	NA	NA
WP_004099396.1|1346239_1347151_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	63.9	4.2e-104
WP_014228144.1|1347241_1348147_+	fructokinase	NA	NA	NA	NA	NA
WP_014228145.1|1348195_1348558_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_014228146.1|1348847_1351982_-	exonuclease subunit SbcC	NA	G3MAB6	Bacillus_virus	26.9	4.9e-11
WP_014228147.1|1351978_1353181_-	exonuclease subunit SbcD	NA	R4JGS2	Bacillus_phage	34.7	6.3e-07
WP_004099401.1|1353459_1354149_+	phosphate response regulator transcription factor PhoB	NA	W8CYM9	Bacillus_phage	38.0	3.3e-37
WP_004848171.1|1354170_1355460_+	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	27.9	1.0e-26
>prophage 86
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	1372216	1376556	6152190	tRNA	uncultured_Mediterranean_phage(100.0%)	4	NA	NA
WP_004129667.1|1372216_1373344_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.6	1.5e-90
WP_004099423.1|1373366_1373699_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	33.0	2.8e-10
WP_071846141.1|1373726_1375574_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_004848195.1|1375584_1376556_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	37.8	7.2e-46
>prophage 87
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	1381566	1383234	6152190		Indivirus(50.0%)	2	NA	NA
WP_014837576.1|1381566_1382670_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	34.3	4.2e-50
WP_004129690.1|1382763_1383234_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	46.7	1.7e-29
>prophage 88
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	1400231	1401935	6152190		Lactobacillus_phage(100.0%)	1	NA	NA
WP_042944448.1|1400231_1401935_-	FAD-dependent oxidoreductase	NA	A0A2P0ZL82	Lactobacillus_phage	27.1	3.7e-21
>prophage 89
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	1417092	1422141	6152190	protease	Agrobacterium_phage(25.0%)	4	NA	NA
WP_003021624.1|1417092_1417716_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	63.9	2.9e-64
WP_004099538.1|1417848_1419123_+|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.1	2.8e-130
WP_004099539.1|1419306_1421661_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.1	1.0e-223
WP_002444653.1|1421868_1422141_+	DNA-binding protein HU-beta	NA	A3E2K9	Sodalis_phage	61.8	8.5e-21
>prophage 90
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	1425480	1426176	6152190		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_014228183.1|1425480_1426176_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	68.0	1.4e-88
>prophage 91
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	1430603	1434147	6152190		Bacillus_phage(100.0%)	2	NA	NA
WP_032694151.1|1430603_1432376_+	SmdA family multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.0	5.7e-49
WP_032694152.1|1432368_1434147_+	SmdB family multidrug efflux ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.4	6.4e-40
>prophage 92
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	1445541	1446651	6152190		Planktothrix_phage(100.0%)	1	NA	NA
WP_004848307.1|1445541_1446651_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.1	1.0e-24
>prophage 93
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	1455803	1465191	6152190		Enterobacteria_phage(33.33%)	10	NA	NA
WP_014228202.1|1455803_1456877_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	41.1	4.1e-66
WP_004848323.1|1456989_1457253_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_003859006.1|1457252_1457393_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_014228203.1|1457389_1458088_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_042944459.1|1458189_1459644_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	24.5	6.9e-16
WP_014228205.1|1459618_1460089_-	membrane protein	NA	NA	NA	NA	NA
WP_042944461.1|1460215_1460782_-	maltose O-acetyltransferase	NA	NA	NA	NA	NA
WP_004099646.1|1460944_1461163_-	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
WP_004129911.1|1461189_1461564_-	Hha toxicity modulator TomB	NA	NA	NA	NA	NA
WP_014228207.1|1462044_1465191_-	multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	22.8	3.5e-49
>prophage 94
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	1470707	1478554	6152190	transposase	Sodalis_phage(25.0%)	9	NA	NA
WP_014837608.1|1470707_1471643_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	51.6	4.3e-64
WP_014228211.1|1471709_1471883_-	pleiotropic regulatory protein RsmS	NA	NA	NA	NA	NA
WP_004848351.1|1471897_1472425_-	primosomal replication protein N''	NA	NA	NA	NA	NA
WP_004848353.1|1472494_1472872_+	DUF454 family protein	NA	NA	NA	NA	NA
WP_004099669.1|1473022_1473574_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	45.2	2.3e-28
WP_042944464.1|1473665_1475573_+	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	38.2	1.3e-43
WP_004099673.1|1475630_1475963_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_004129946.1|1475962_1476568_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_009653565.1|1476679_1478554_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	36.3	5.6e-111
>prophage 95
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	1492972	1496853	6152190		Pteropox_virus(50.0%)	2	NA	NA
WP_014228221.1|1492972_1494223_+	phospholipase	NA	A0A1B1MR92	Pteropox_virus	22.4	9.1e-25
WP_162763172.1|1494297_1496853_-	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	38.2	5.1e-115
>prophage 96
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	1501694	1502375	6152190		Bacillus_virus(100.0%)	1	NA	NA
WP_004848402.1|1501694_1502375_+	iron ABC transporter ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	34.3	3.2e-24
>prophage 97
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	1505561	1506248	6152190		Planktothrix_phage(100.0%)	1	NA	NA
WP_004099723.1|1505561_1506248_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.5	7.6e-34
>prophage 98
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	1515101	1517862	6152190	tRNA	Moumouvirus(50.0%)	3	NA	NA
WP_038424171.1|1515101_1516487_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.1	1.0e-45
WP_004099787.1|1516781_1516994_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_004099791.1|1516995_1517862_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	34.8	6.5e-30
>prophage 99
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	1523285	1524161	6152190		Burkholderia_virus(100.0%)	1	NA	NA
WP_042944489.1|1523285_1524161_+	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	27.6	4.7e-20
>prophage 100
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	1530940	1536015	6152190	tRNA	Acinetobacter_phage(33.33%)	4	NA	NA
WP_042944493.1|1530940_1532416_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.3	8.4e-46
WP_042944495.1|1532788_1534306_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.1	1.9e-85
WP_014228246.1|1534458_1534872_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014228247.1|1535139_1536015_-	class A extended-spectrum beta-lactamase OXY-1-1	NA	A0A1B0VBP7	Salmonella_phage	74.6	3.1e-112
>prophage 101
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	1540781	1542266	6152190		Staphylococcus_phage(100.0%)	1	NA	NA
WP_042944503.1|1540781_1542266_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.8	5.0e-14
>prophage 102
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	1548735	1550136	6152190		Bacillus_phage(100.0%)	1	NA	NA
WP_042944507.1|1548735_1550136_-	sucrose-6-phosphate hydrolase	NA	F8WPR5	Bacillus_phage	25.1	1.7e-16
>prophage 103
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	1554530	1555322	6152190		Bacillus_virus(100.0%)	1	NA	NA
WP_042944511.1|1554530_1555322_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.3	5.9e-14
>prophage 104
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	1558359	1558794	6152190	transposase	Clostridium_botulinum_C_phage(100.0%)	1	NA	NA
WP_014228411.1|1558359_1558794_+|transposase	IS200/IS605 family transposase	transposase	Q331U4	Clostridium_botulinum_C_phage	39.2	6.8e-20
>prophage 105
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	1571505	1572255	6152190		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_042944523.1|1571505_1572255_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	33.6	1.5e-19
>prophage 106
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	1594221	1596909	6152190		Bacillus_phage(100.0%)	1	NA	NA
WP_042944528.1|1594221_1596909_+	glycoside hydrolase family 32 protein	NA	F8WPR5	Bacillus_phage	36.0	4.3e-40
>prophage 107
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	1617200	1619924	6152190		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_042944551.1|1617200_1619924_+	cation-transporting P-type ATPase	NA	M1HX51	Paramecium_bursaria_Chlorella_virus	27.0	3.6e-66
>prophage 108
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	1630570	1632614	6152190		Bacillus_virus(50.0%)	2	NA	NA
WP_004848592.1|1630570_1631614_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.3	6.0e-14
WP_032695061.1|1631603_1632614_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.9	1.3e-16
>prophage 109
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	1637544	1646687	6152190		Planktothrix_phage(50.0%)	9	NA	NA
WP_014228326.1|1637544_1639011_-	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	22.0	1.8e-16
WP_042944569.1|1639245_1640097_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_004100025.1|1640145_1640787_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_014228327.1|1640801_1641467_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_014228328.1|1641459_1642221_+	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.7	1.6e-19
WP_042944572.1|1642766_1643531_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_042944574.1|1643713_1645051_+	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_014228331.1|1645159_1645864_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.4	4.0e-22
WP_042944576.1|1645850_1646687_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.3	1.1e-13
>prophage 110
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	1651251	1657169	6152190	holin	Catovirus(50.0%)	4	NA	NA
WP_014837759.1|1651251_1652916_-|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.1	2.3e-60
WP_042944581.1|1652930_1654403_-	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_014228339.1|1654413_1655007_-	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_025107047.1|1655135_1657169_+|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	28.1	5.8e-21
>prophage 111
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	1660634	1662179	6152190		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_014228343.1|1660634_1662179_-	sugar ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.6	3.1e-14
>prophage 112
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	1673725	1678500	6152190		Tupanvirus(50.0%)	2	NA	NA
WP_042944590.1|1673725_1677607_+	enterobactin non-ribosomal peptide synthetase EntF	NA	A0A2K9KZV5	Tupanvirus	26.9	9.0e-55
WP_014837773.1|1677705_1678500_-	iron-enterobactin ABC transporter ATP-binding protein	NA	M1HRF1	Paramecium_bursaria_Chlorella_virus	25.6	9.9e-09
>prophage 113
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	1682472	1684590	6152190		Plodia_interpunctella_granulovirus(100.0%)	1	NA	NA
WP_042944594.1|1682472_1684590_-	chitinase	NA	A0A1L5JGH0	Plodia_interpunctella_granulovirus	28.5	2.4e-33
>prophage 114
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	1693448	1697065	6152190		Burkholderia_phage(50.0%)	4	NA	NA
WP_004100084.1|1693448_1693853_-	helix-turn-helix domain-containing protein	NA	A0A1S5NNJ5	Burkholderia_phage	33.3	6.1e-07
WP_071889425.1|1693833_1694127_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_032694347.1|1694313_1695402_-	oxidoreductase	NA	NA	NA	NA	NA
WP_014228366.1|1695562_1697065_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.5	1.3e-14
>prophage 115
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	1714633	1733289	6152190		Cedratvirus(14.29%)	16	NA	NA
WP_004848726.1|1714633_1715662_+	2-hydroxyacid dehydrogenase	NA	A0A2R8FCS0	Cedratvirus	34.1	1.7e-29
WP_042944609.1|1715700_1716645_-	sugar kinase	NA	NA	NA	NA	NA
WP_042944610.1|1716656_1717658_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_032694338.1|1717657_1718644_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_047725149.1|1718640_1720146_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.2	6.6e-14
WP_004848735.1|1720190_1721171_-	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_042944612.1|1721709_1724019_+	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	33.1	6.7e-82
WP_014228384.1|1724202_1724745_-	acireductone dioxygenase	NA	NA	NA	NA	NA
WP_014228385.1|1724741_1725431_-	acireductone synthase	NA	NA	NA	NA	NA
WP_160742792.1|1725625_1726771_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_014228387.1|1726771_1727401_-	ParB-like nuclease domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	50.3	2.0e-52
WP_014228388.1|1727385_1728609_-	phosphoadenosine phosphosulfate reductase	NA	A0A220GKF8	Streptococcus_phage	33.1	2.6e-61
WP_014228389.1|1728713_1729625_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002894394.1|1730485_1731049_+	alkyl hydroperoxide reductase subunit C	NA	NA	NA	NA	NA
WP_004848755.1|1731218_1732784_+	alkyl hydroperoxide reductase subunit F	NA	G3MA85	Bacillus_virus	34.6	6.4e-44
WP_004100140.1|1732860_1733289_-	universal stress protein UspG	NA	A0A1W6JNV4	Morganella_phage	40.7	2.5e-19
>prophage 116
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	1737376	1738034	6152190		Morganella_phage(50.0%)	2	NA	NA
WP_004100146.1|1737376_1737586_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	80.6	4.5e-22
WP_004848768.1|1737650_1738034_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	50.0	5.2e-24
>prophage 117
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	1742830	1745274	6152190		Stx2-converting_phage(50.0%)	2	NA	NA
WP_014228398.1|1742830_1744030_-	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	48.7	1.4e-104
WP_042944620.1|1744173_1745274_-	endolytic peptidoglycan transglycosylase RlpA	NA	F5B3X9	Synechococcus_phage	51.6	1.0e-08
>prophage 118
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	1752290	1760390	6152190	tRNA	Staphylococcus_phage(33.33%)	5	NA	NA
WP_014228403.1|1752290_1754873_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	43.1	1.2e-188
WP_014228404.1|1755099_1755582_+	zinc ribbon-containing protein	NA	NA	NA	NA	NA
WP_014228405.1|1755782_1757570_-	filamentous hemagglutinin N-terminal domain-containing protein	NA	A0A0R6PJK4	Moraxella_phage	34.2	6.2e-27
WP_032718721.1|1757625_1759293_-	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_004100186.1|1759664_1760390_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.7	1.7e-28
>prophage 119
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	1766238	1767303	6152190		Pseudomonas_phage(100.0%)	1	NA	NA
WP_085954924.1|1766238_1767303_-	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	45.6	6.5e-48
>prophage 120
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	1771352	1773014	6152190		Ostreococcus_mediterraneus_virus(100.0%)	1	NA	NA
WP_014228410.1|1771352_1773014_-	asparagine synthase B	NA	A0A0P0C0R1	Ostreococcus_mediterraneus_virus	39.7	7.9e-85
>prophage 121
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	1777641	1787599	6152190	tRNA	Vibrio_phage(25.0%)	7	NA	NA
WP_014228414.1|1777641_1779594_+	PTS N-acetyl glucosamine transporter subunit IIABC	NA	A0A2I7SAJ6	Vibrio_phage	47.3	3.2e-08
WP_014228415.1|1779772_1781440_+|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	92.4	1.3e-310
WP_042944627.1|1781878_1783288_+	chitoporin	NA	NA	NA	NA	NA
WP_004848843.1|1783334_1783667_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014228416.1|1783719_1785015_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	34.5	1.8e-60
WP_042944629.1|1785069_1786209_-	tricarballylate utilization 4Fe-4S protein TcuB	NA	NA	NA	NA	NA
WP_032718717.1|1786195_1787599_-	FAD-dependent tricarballylate dehydrogenase TcuA	NA	A0A2P0ZL82	Lactobacillus_phage	26.4	1.7e-08
>prophage 122
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	1790603	1791377	6152190		Mycobacterium_phage(100.0%)	1	NA	NA
WP_038424219.1|1790603_1791377_-	esterase	NA	W0LK50	Mycobacterium_phage	38.0	5.3e-07
>prophage 123
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	1797820	1799305	6152190		Staphylococcus_phage(100.0%)	1	NA	NA
WP_004848870.1|1797820_1799305_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.8	2.5e-21
>prophage 124
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	1807572	1815064	6152190		Paramecium_bursaria_Chlorella_virus(33.33%)	6	NA	NA
WP_042944639.1|1807572_1809621_-	potassium-transporting ATPase subunit KdpB	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	23.9	4.2e-27
WP_038424222.1|1809642_1811322_-	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
WP_009651669.1|1811321_1811411_-	K(+)-transporting ATPase subunit F	NA	NA	NA	NA	NA
WP_161506338.1|1811717_1811927_+	DUF2517 family protein	NA	NA	NA	NA	NA
WP_042944643.1|1812171_1813620_+	deoxyribodipyrimidine photo-lyase	NA	F2Y1K1	Organic_Lake_phycodnavirus	31.8	2.7e-57
WP_032694307.1|1813582_1815064_-	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.0	2.9e-46
>prophage 125
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	1820861	1821653	6152190		Kaumoebavirus(100.0%)	1	NA	NA
WP_025106369.1|1820861_1821653_+	endonuclease VIII	NA	A0A1V0CNR6	Kaumoebavirus	26.4	9.8e-09
>prophage 126
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	1847926	1848907	6152190	transposase	Escherichia_phage(100.0%)	1	NA	NA
WP_016947617.1|1847926_1848907_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	6.8e-185
>prophage 127
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	1861656	1865173	6152190		Vibriophage(33.33%)	4	NA	NA
WP_014228459.1|1861656_1862376_+	nicotinamide riboside transporter PnuC	NA	I6W764	Vibriophage	33.0	2.9e-23
WP_042944660.1|1862372_1863317_-	CDF family zinc transporter ZitB	NA	A0A1V0SED0	Indivirus	27.8	6.8e-25
WP_014228461.1|1863434_1863806_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014228462.1|1864120_1865173_+	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A0B6VT43	Edwardsiella_phage	48.6	1.8e-82
>prophage 128
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	1869493	1876018	6152190		Tupanvirus(33.33%)	7	NA	NA
WP_004130603.1|1869493_1870510_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	45.4	7.5e-78
WP_042944666.1|1870721_1872191_-	molybdate ABC transporter ATP-binding protein ModF	NA	W5SAS9	Pithovirus	30.7	7.4e-10
WP_042946177.1|1872258_1873047_-	molybdenum-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_004848993.1|1873200_1873350_+	multidrug efflux pump-associated protein, AcrZ family	NA	NA	NA	NA	NA
WP_014228467.1|1873494_1874268_+	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004848997.1|1874267_1874957_+	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_038424230.1|1874959_1876018_+	molybdenum ABC transporter ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	35.8	3.1e-18
>prophage 129
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	1883191	1883923	6152190		Enterobacteria_phage(100.0%)	1	NA	NA
WP_014228475.1|1883191_1883923_+	MerR family transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	51.8	1.7e-52
>prophage 130
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	1890688	1895630	6152190		Catovirus(50.0%)	4	NA	NA
WP_042944671.1|1890688_1892212_+	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	39.8	2.4e-80
WP_004849033.1|1892312_1893695_+	amino acid permease	NA	NA	NA	NA	NA
WP_042944673.1|1893794_1894271_-	kinase inhibitor	NA	NA	NA	NA	NA
WP_042946178.1|1894340_1895630_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	30.5	4.6e-16
>prophage 131
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	1899305	1900028	6152190		Staphylococcus_phage(100.0%)	1	NA	NA
WP_014228488.1|1899305_1900028_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.5	8.1e-10
>prophage 132
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	1906593	1907499	6152190		Streptococcus_phage(100.0%)	1	NA	NA
WP_042944674.1|1906593_1907499_-	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	27.7	4.1e-27
>prophage 133
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	1917282	1919022	6152190		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_042944679.1|1917282_1919022_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	32.0	1.5e-17
>prophage 134
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	1924164	1932701	6152190		Micromonas_pusilla_virus(20.0%)	8	NA	NA
WP_014228507.1|1924164_1925010_+	transketolase	NA	G9E5U1	Micromonas_pusilla_virus	31.6	6.4e-06
WP_042944684.1|1925009_1926002_+	transketolase family protein	NA	NA	NA	NA	NA
WP_004849082.1|1926302_1927652_+	ATP-dependent RNA helicase RhlE	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	30.5	1.0e-45
WP_042944686.1|1927852_1929997_+	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	26.3	2.0e-43
WP_014228510.1|1930039_1931008_+	DNA-binding protein YbiB	NA	NA	NA	NA	NA
WP_004130722.1|1931143_1931404_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_004130731.1|1931688_1931955_-	DksA/TraR family C4-type zinc finger protein	NA	A0A0A0PZH0	Pectobacterium_bacteriophage	57.3	9.5e-17
WP_014228511.1|1932023_1932701_-	PKHD-type hydroxylase YbiX	NA	Q5GQB0	Synechococcus_phage	31.0	7.6e-18
>prophage 135
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	1943998	1949102	6152190		Planktothrix_phage(33.33%)	6	NA	NA
WP_004849106.1|1943998_1944721_-	glutamine ABC transporter ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	41.8	1.5e-35
WP_004100490.1|1944717_1945377_-	glutamine ABC transporter permease GlnP	NA	NA	NA	NA	NA
WP_004849110.1|1945510_1946257_-	glutamine ABC transporter substrate-binding protein GlnH	NA	NA	NA	NA	NA
WP_004130751.1|1946628_1947132_-	DNA starvation/stationary phase protection protein Dps	NA	A0A222YYG6	Streptomyces_phage	24.6	1.9e-05
WP_004100495.1|1947350_1948238_-	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
WP_004130755.1|1948589_1949102_+	outer membrane protein OmpX	NA	H6WZM8	Escherichia_phage	31.3	2.3e-14
>prophage 136
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	1953013	1955582	6152190		Klosneuvirus(50.0%)	2	NA	NA
WP_025108092.1|1953013_1954054_+	aldo/keto reductase	NA	A0A1V0SKP9	Klosneuvirus	35.0	1.0e-05
WP_025108091.1|1954205_1955582_+	glycoside hydrolase family 1 protein	NA	A0A0B5JD41	Pandoravirus	24.0	5.0e-24
>prophage 137
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	1958633	1966070	6152190		Moraxella_phage(25.0%)	8	NA	NA
WP_071889427.1|1958633_1959311_-	hypothetical protein	NA	A0A0R6PJY5	Moraxella_phage	29.3	1.3e-14
WP_129542828.1|1959609_1960011_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042944697.1|1960144_1960786_+	recombinase family protein	NA	A0A222YWP5	Escherichia_phage	31.7	8.0e-09
WP_042946179.1|1961172_1961637_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071889428.1|1961852_1962137_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_071889429.1|1962224_1962629_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042944700.1|1962946_1964443_-	recombinase family protein	NA	A0A288WFZ3	Bacillus_phage	24.7	6.6e-14
WP_042944703.1|1964477_1966070_+	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.8	5.0e-60
>prophage 138
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	1974190	1976623	6152190		Citrobacter_phage(100.0%)	1	NA	NA
WP_042944705.1|1974190_1976623_-	formate C-acetyltransferase/glycerol dehydratase family glycyl radical enzyme	NA	A0A076YHZ7	Citrobacter_phage	42.0	8.0e-09
>prophage 139
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	1980801	1982655	6152190		Planktothrix_phage(100.0%)	1	NA	NA
WP_014228532.1|1980801_1982655_+	glutathione ABC transporter ATP-binding protein GsiA	NA	G9BWD6	Planktothrix_phage	29.2	4.1e-13
>prophage 140
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	1992329	2049234	6152190	portal,protease,terminase,tail,transposase	Escherichia_phage(17.5%)	65	NA	NA
WP_042944710.1|1992329_1993616_-	DUF3596 domain-containing protein	NA	A0A0U2JGI6	Escherichia_phage	54.5	1.7e-122
WP_004111685.1|1993615_1993831_-	DUF1233 family excisionase	NA	NA	NA	NA	NA
WP_042944712.1|1993923_1994628_-	hypothetical protein	NA	A0A1W6JP46	Morganella_phage	32.6	3.0e-25
WP_042944714.1|1994624_1995320_-	hypothetical protein	NA	R9VWB9	Serratia_phage	59.5	4.2e-72
WP_042944716.1|1995316_1995541_-	hypothetical protein	NA	A0A286S2B3	Klebsiella_phage	59.5	1.4e-16
WP_123828190.1|1995583_1995817_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042944723.1|1995882_1996176_-	host cell division inhibitory peptide Kil	NA	NA	NA	NA	NA
WP_142395356.1|1996493_1996943_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042944725.1|1996913_1997237_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042944726.1|1997575_1998172_-	helix-turn-helix transcriptional regulator	NA	K7P850	Enterobacteria_phage	27.1	3.7e-08
WP_042944728.1|1998280_1998493_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_042944730.1|1998551_1998965_+	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	69.8	3.2e-43
WP_042944732.1|1999230_2000307_+	hypothetical protein	NA	U5P0A0	Shigella_phage	36.2	9.5e-23
WP_042944734.1|2000319_2000613_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042944735.1|2000609_2000822_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042944737.1|2000814_2001600_+	hypothetical protein	NA	C7BGF1	Burkholderia_phage	52.9	1.2e-62
WP_004849240.1|2001596_2002058_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004849243.1|2002051_2002255_+	hypothetical protein	NA	A0A2P1JU43	Erwinia_phage	50.0	3.6e-08
WP_004849245.1|2002251_2002461_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042944739.1|2002919_2003300_+	HNH endonuclease	NA	K7P7B7	Enterobacteria_phage	92.6	3.7e-62
WP_048257891.1|2003296_2003911_+	hypothetical protein	NA	Q8HAA6	Salmonella_phage	66.0	3.4e-09
WP_042944742.1|2003907_2004393_+	hypothetical protein	NA	C6ZR26	Salmonella_phage	51.1	1.9e-10
WP_042944744.1|2004385_2004583_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042944747.1|2004763_2005081_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042944750.1|2005602_2005908_+	DUF968 domain-containing protein	NA	A0A2I7R8F9	Vibrio_phage	56.5	2.1e-23
WP_042944755.1|2006182_2006824_+	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	76.1	1.8e-85
WP_042944756.1|2006820_2006961_+	YlcG family protein	NA	NA	NA	NA	NA
WP_032694881.1|2006957_2007566_+	hypothetical protein	NA	H9C175	Pectobacterium_phage	60.2	9.0e-71
WP_016947617.1|2008571_2009552_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	6.8e-185
WP_077255292.1|2010294_2010555_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_042944760.1|2010912_2011404_+	DUF1441 family protein	NA	K7PJY2	Enterobacterial_phage	85.3	7.6e-68
WP_042944762.1|2011403_2013512_+|terminase	phage terminase large subunit family protein	terminase	K7PH52	Enterobacterial_phage	82.8	0.0e+00
WP_042944764.1|2013508_2013724_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	78.6	4.5e-25
WP_042944766.1|2013720_2015220_+|portal	phage portal protein	portal	K7PHM5	Enterobacterial_phage	83.6	1.1e-247
WP_042944767.1|2015164_2017180_+|protease	Clp protease ClpP	protease	K7PKX4	Enterobacterial_phage	83.9	0.0e+00
WP_042944768.1|2017261_2017588_+	DUF2190 family protein	NA	K7PJY3	Enterobacterial_phage	66.4	1.8e-33
WP_042944770.1|2017580_2017874_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_042944772.1|2017863_2018415_+|tail	phage tail protein	tail	K7P7A8	Enterobacteria_phage	66.0	4.5e-53
WP_042944774.1|2018411_2018810_+|tail	phage tail protein	tail	K7PHM6	Enterobacterial_phage	60.2	8.3e-41
WP_074187854.1|2018817_2019300_+|tail	phage tail protein	tail	O64327	Escherichia_phage	68.2	1.8e-58
WP_042944775.1|2019342_2019741_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_042944776.1|2019761_2020079_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	51.5	5.5e-19
WP_042944778.1|2020059_2022756_+|tail	phage tail tape measure protein	tail	K7PKR0	Enterobacteria_phage	59.0	8.9e-195
WP_071889430.1|2022755_2023229_+	hypothetical protein	NA	A0A286S298	Klebsiella_phage	57.8	7.6e-49
WP_014228581.1|2023215_2023698_+	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	65.2	3.6e-54
WP_042944781.1|2023705_2024086_+	hypothetical protein	NA	A0A286S2A6	Klebsiella_phage	50.8	1.1e-34
WP_042944783.1|2024082_2027148_+	kinase	NA	A0A286S259	Klebsiella_phage	69.5	0.0e+00
WP_042944786.1|2027225_2029238_+	hypothetical protein	NA	A0A286S1P0	Klebsiella_phage	71.6	3.7e-52
WP_158650804.1|2029234_2029405_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042944787.1|2029407_2030841_+	hypothetical protein	NA	A0A1D8KLY0	Synechococcus_phage	30.3	9.4e-18
WP_042944789.1|2031205_2032411_+	O-antigen ligase family protein	NA	NA	NA	NA	NA
WP_042944791.1|2032411_2033665_-|tail	phage tail fiber protein	tail	A0A1J0MHZ5	Klebsiella_phage	44.4	1.9e-86
WP_038423245.1|2034522_2035725_+	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	46.7	2.7e-95
WP_004849345.1|2035756_2036515_-	DNA-binding transcriptional repressor DeoR	NA	A0A077SK06	Escherichia_phage	27.2	2.0e-11
WP_004849347.1|2036640_2037234_-	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_042944794.1|2037552_2038788_+	MFS transporter	NA	NA	NA	NA	NA
WP_042944796.1|2038835_2039651_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_014228591.1|2039650_2040853_-	MFS transporter	NA	NA	NA	NA	NA
WP_014228592.1|2041035_2041578_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_025108030.1|2041747_2042329_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016947617.1|2043748_2044729_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	6.8e-185
WP_077255293.1|2044769_2045189_-	helix-turn-helix domain containing protein	NA	A0A1S6KZZ7	Salmonella_phage	46.9	6.1e-26
WP_038424952.1|2045753_2046680_+	AAA family ATPase	NA	E9LUK9	Lactobacillus_phage	28.5	7.9e-18
WP_025108027.1|2046682_2047078_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038424262.1|2048748_2049234_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.1	2.3e-61
>prophage 141
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	2053194	2064720	6152190		Bacillus_phage(33.33%)	13	NA	NA
WP_004100567.1|2053194_2053458_-	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	71.8	1.6e-27
WP_009653259.1|2053662_2053953_+	YbjC family protein	NA	NA	NA	NA	NA
WP_025108025.1|2053936_2054659_+	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_009653278.1|2054762_2055665_+	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	34.5	2.0e-34
WP_004849367.1|2055754_2056234_+	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_014228600.1|2056582_2057695_+	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_004100581.1|2057752_2058931_+	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.9	6.1e-31
WP_014228601.1|2058941_2059895_+	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_004130847.1|2059891_2060737_+	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_004100588.1|2060794_2061283_+	YbjO family protein	NA	NA	NA	NA	NA
WP_042944803.1|2061325_2062456_+	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	25.2	3.7e-25
WP_004849381.1|2062534_2063251_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.9	1.1e-35
WP_014228604.1|2063247_2064720_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	32.4	4.3e-26
>prophage 142
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	2068473	2071213	6152190		Planktothrix_phage(50.0%)	4	NA	NA
WP_004111834.1|2068473_2069202_-	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	37.1	2.7e-29
WP_038423244.1|2069429_2069945_-	lipoprotein	NA	NA	NA	NA	NA
WP_004100606.1|2070062_2070386_+	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_014837943.1|2070382_2071213_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	28.9	8.2e-06
>prophage 143
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	2085089	2108757	6152190	tRNA,protease	uncultured_Mediterranean_phage(16.67%)	17	NA	NA
WP_025108294.1|2085089_2087036_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	39.2	9.4e-37
WP_004100627.1|2087103_2087334_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.4e-16
WP_004100628.1|2087658_2087976_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	3.4e-13
WP_004849425.1|2088006_2090289_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	2.8e-165
WP_002211347.1|2090857_2091076_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_038424265.1|2091355_2092060_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_038424266.1|2092098_2093820_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	30.9	4.8e-16
WP_014228628.1|2093820_2095587_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	25.3	7.0e-23
WP_004849433.1|2095701_2096670_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.0	3.6e-61
WP_160742176.1|2096807_2096918_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002439523.1|2097201_2097696_+	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_042944808.1|2097831_2102022_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	49.2	5.1e-88
WP_004130911.1|2102143_2102755_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_004849446.1|2102763_2104107_+	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	41.7	7.8e-83
WP_009653254.1|2104198_2105491_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	44.5	3.6e-93
WP_038424268.1|2105690_2108129_+	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.7	6.8e-218
WP_032694248.1|2108139_2108757_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	57.1	2.2e-72
>prophage 144
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	2115889	2119116	6152190		Tetraselmis_virus(100.0%)	2	NA	NA
WP_004871674.1|2115889_2116630_-	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	1.8e-20
WP_014228637.1|2116833_2119116_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.9	1.9e-161
>prophage 145
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	2123164	2124253	6152190		Streptococcus_phage(100.0%)	1	NA	NA
WP_004849472.1|2123164_2124253_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.8	1.0e-80
>prophage 146
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	2128547	2133100	6152190		Bacillus_phage(100.0%)	3	NA	NA
WP_004100704.1|2128547_2128835_+	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	5.5e-10
WP_038424270.1|2129050_2131306_+	ComEC family protein	NA	NA	NA	NA	NA
WP_004849478.1|2131351_2133100_+	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	30.5	5.1e-58
>prophage 147
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	2138242	2213154	6152190	tRNA,protease,transposase	Bacillus_phage(15.38%)	53	NA	NA
WP_004849490.1|2138242_2139022_+|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_004849491.1|2139025_2140348_+	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_004100725.1|2140328_2141033_+	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_014228649.1|2141032_2145481_+	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_004849493.1|2145664_2147458_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_004130967.1|2147758_2148310_+	YcbK family protein	NA	NA	NA	NA	NA
WP_014837967.1|2148323_2148971_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_014228411.1|2149134_2149569_+|transposase	IS200/IS605 family transposase	transposase	Q331U4	Clostridium_botulinum_C_phage	39.2	6.8e-20
WP_042944811.1|2149764_2150199_+|transposase	IS200/IS605 family transposase	transposase	W0UUZ0	Sulfolobus_monocaudavirus	37.8	1.2e-19
WP_014228652.1|2150290_2151481_-	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_042944813.1|2151668_2152754_-	porin	NA	Q1MVN1	Enterobacteria_phage	53.0	1.5e-100
WP_004849497.1|2153345_2154746_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	37.0	5.0e-80
WP_025107499.1|2155049_2156252_-	nicotinate phosphoribosyltransferase	NA	A0A2L0UZQ6	Agrobacterium_phage	31.1	6.4e-44
WP_014228655.1|2156579_2159195_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	6.3e-20
WP_032695054.1|2159260_2160034_-	aliphatic sulfonates ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	39.0	8.1e-32
WP_004849501.1|2160030_2160822_-	aliphatic sulfonate ABC transporter permease SsuC	NA	NA	NA	NA	NA
WP_009653287.1|2160878_2161454_-	NADPH-dependent FMN reductase	NA	NA	NA	NA	NA
WP_004130996.1|2161702_2162713_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_014837972.1|2162881_2163424_+	cell division protein ZapC	NA	NA	NA	NA	NA
WP_038424273.1|2163420_2164530_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_014228658.1|2164628_2166734_+	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_038424274.1|2166746_2168654_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.3	5.6e-50
WP_032720968.1|2168668_2169937_+	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_014228660.1|2169926_2171564_+	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_004849513.1|2171563_2172127_+	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_004100764.1|2172382_2172550_+	ribosome modulation factor	NA	NA	NA	NA	NA
WP_004849514.1|2172614_2173133_-	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_042944815.1|2173202_2174960_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_014228663.1|2175145_2175598_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_004849520.1|2175700_2176771_-	porin OmpA	NA	NA	NA	NA	NA
WP_014228664.1|2177124_2177634_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_031942297.1|2177888_2178857_+|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	99.1	1.5e-184
WP_014228665.1|2179162_2179786_+	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_042944816.1|2179773_2181909_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_004849527.1|2181926_2182373_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_042944818.1|2182495_2184550_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	26.9	2.3e-17
WP_014228668.1|2184578_2185037_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_014228669.1|2185191_2185605_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_049870912.1|2186207_2196971_+	BapA prefix-like domain-containing protein	NA	NA	NA	NA	NA
WP_042944820.1|2197138_2198575_+	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_004849540.1|2198571_2200719_+	type I secretion system permease/ATPase	NA	W8CYL7	Bacillus_phage	25.1	1.6e-24
WP_014228672.1|2200715_2201921_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_016947617.1|2202043_2203024_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	6.8e-185
WP_042944822.1|2203318_2206462_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_042944824.1|2206504_2207443_+	peptidase	NA	NA	NA	NA	NA
WP_042944826.1|2207456_2208158_-	cyclic nucleotide-binding protein	NA	NA	NA	NA	NA
WP_009651933.1|2208616_2208934_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_161506331.1|2208994_2210170_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_014228676.1|2210388_2210943_+	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_014837988.1|2210959_2211748_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004849561.1|2211798_2212080_+	acylphosphatase	NA	NA	NA	NA	NA
WP_004849563.1|2212076_2212406_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_004100829.1|2212494_2213154_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	53.9	3.8e-46
>prophage 148
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	2231592	2232333	6152190		Planktothrix_phage(100.0%)	1	NA	NA
WP_004849580.1|2231592_2232333_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.2	4.7e-29
>prophage 149
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	2253480	2254260	6152190		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_014228719.1|2253480_2254260_-	amino acid ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	32.2	1.9e-17
>prophage 150
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	2258527	2259623	6152190		Morganella_phage(100.0%)	2	NA	NA
WP_071889432.1|2258527_2258740_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	77.1	1.4e-23
WP_004849645.1|2259401_2259623_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	56.5	6.7e-16
>prophage 151
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	2277069	2278098	6152190		Bacillus_phage(100.0%)	1	NA	NA
WP_042944859.1|2277069_2278098_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	36.4	5.2e-18
>prophage 152
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	2284119	2285502	6152190		Enterobacteria_phage(100.0%)	1	NA	NA
WP_042944863.1|2284119_2285502_+	purine permease	NA	Q9KX94	Enterobacteria_phage	27.0	2.0e-20
>prophage 153
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	2298992	2299733	6152190		Planktothrix_phage(100.0%)	1	NA	NA
WP_014228772.1|2298992_2299733_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	42.4	6.7e-36
>prophage 154
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	2307181	2308084	6152190		Bacillus_phage(100.0%)	1	NA	NA
WP_014228780.1|2307181_2308084_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	32.1	4.7e-15
>prophage 155
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	2311612	2318190	6152190		Serratia_phage(50.0%)	4	NA	NA
WP_042944869.1|2311612_2313910_-	formate C-acetyltransferase	NA	A0A1S6UAD4	Serratia_phage	44.2	5.0e-05
WP_004100938.1|2313961_2314282_-	PTS fructose-like transporter subunit IIB	NA	NA	NA	NA	NA
WP_004131253.1|2314302_2315379_-	PTS fructose transporter subunit EIIC	NA	NA	NA	NA	NA
WP_014838052.1|2315688_2318190_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	25.9	6.1e-12
>prophage 156
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	2332171	2334419	6152190		Enterobacteria_phage(100.0%)	3	NA	NA
WP_004131287.1|2332171_2332345_+	general stress protein	NA	Q9KX95	Enterobacteria_phage	88.9	3.2e-05
WP_009653397.1|2332580_2333903_-	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	87.6	1.2e-200
WP_014228795.1|2333924_2334419_-	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	78.1	3.3e-39
>prophage 157
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	2351043	2354174	6152190		Cronobacter_phage(50.0%)	4	NA	NA
WP_071881726.1|2351043_2352108_+	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	77.6	2.5e-92
WP_014838068.1|2352158_2352452_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014838069.1|2352567_2353356_-	MipA/OmpV family protein	NA	NA	NA	NA	NA
WP_014228810.1|2353478_2354174_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	32.8	1.2e-26
>prophage 158
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	2367114	2367669	6152190		Infectious_spleen_and_kidney_necrosis_virus(100.0%)	1	NA	NA
WP_014228822.1|2367114_2367669_+	O-acetyl-ADP-ribose deacetylase	NA	A0A140G0J9	Infectious_spleen_and_kidney_necrosis_virus	45.6	5.1e-28
>prophage 159
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	2376038	2376959	6152190		Morganella_phage(100.0%)	1	NA	NA
WP_004849864.1|2376038_2376959_-	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferasee	NA	A0A1W6JP29	Morganella_phage	42.4	1.3e-57
>prophage 160
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	2401667	2402849	6152190		Trichoplusia_ni_ascovirus(50.0%)	2	NA	NA
WP_004131399.1|2401667_2402402_+	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	34.1	2.9e-15
WP_000103754.1|2402612_2402849_+	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	45.2	1.5e-10
>prophage 161
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	2406149	2406791	6152190		Pseudomonas_phage(100.0%)	1	NA	NA
WP_042944894.1|2406149_2406791_+	dTMP kinase	NA	Q2Z0N0	Pseudomonas_phage	36.1	4.5e-28
>prophage 162
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	2422563	2422821	6152190		Erwinia_phage(100.0%)	1	NA	NA
WP_004131427.1|2422563_2422821_+	DUF1471 domain-containing protein	NA	A0A1B2IFR9	Erwinia_phage	38.6	3.6e-05
>prophage 163
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	2429112	2432863	6152190		Planktothrix_phage(50.0%)	4	NA	NA
WP_014228855.1|2429112_2429814_+	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	41.3	5.4e-35
WP_038424319.1|2429813_2431058_+	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
WP_014228857.1|2431106_2432018_+	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
WP_032749587.1|2432032_2432863_+	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	33.5	2.8e-22
>prophage 164
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	2439968	2440919	6152190		Cyanophage(100.0%)	1	NA	NA
WP_014228865.1|2439968_2440919_+	transaldolase	NA	A0A127KMN5	Cyanophage	35.1	1.6e-13
>prophage 165
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	2446199	2447336	6152190		Bacillus_virus(100.0%)	1	NA	NA
WP_014228869.1|2446199_2447336_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	G3M9Y6	Bacillus_virus	34.6	1.3e-30
>prophage 166
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	2454119	2455490	6152190		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_014228873.1|2454119_2455490_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	1.6e-107
>prophage 167
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	2458723	2471225	6152190		Phage_21(20.0%)	12	NA	NA
WP_004131480.1|2458723_2459974_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	90.7	4.4e-19
WP_042944902.1|2461043_2461601_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071889435.1|2461629_2461998_+	DUF882 domain-containing protein	NA	I6R9L6	Nonlabens_phage	38.3	2.5e-15
WP_042944905.1|2462341_2462731_-	tautomerase family protein	NA	NA	NA	NA	NA
WP_042944906.1|2462736_2463039_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_042944909.1|2463139_2464024_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_042944910.1|2464096_2465881_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	37.2	5.6e-20
WP_042944911.1|2465958_2467149_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_009653379.1|2467428_2468472_+	type II asparaginase	NA	NA	NA	NA	NA
WP_042944913.1|2468508_2469276_-	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	26.2	2.6e-14
WP_042944915.1|2469276_2470230_-	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	NA	NA	NA	NA
WP_025106937.1|2470226_2471225_-	iron-dicitrate ABC transporter permease FecC	NA	A0A2H4IY97	uncultured_Caudovirales_phage	24.1	5.4e-12
>prophage 168
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	2477674	2478589	6152190		Morganella_phage(100.0%)	1	NA	NA
WP_009653416.1|2477674_2478589_+	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	51.2	4.5e-74
>prophage 169
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	2486739	2491086	6152190		Bacillus_phage(100.0%)	3	NA	NA
WP_014228946.1|2486739_2488236_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	30.6	4.1e-08
WP_014228948.1|2488597_2489755_+	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_004138302.1|2489802_2491086_-	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	28.6	2.2e-10
>prophage 170
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	2494418	2495273	6152190		Indivirus(100.0%)	1	NA	NA
WP_014228950.1|2494418_2495273_+	aldo/keto reductase	NA	A0A1V0SDE7	Indivirus	25.3	3.2e-13
>prophage 171
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	2498901	2500155	6152190		Tupanvirus(100.0%)	1	NA	NA
WP_038424330.1|2498901_2500155_-	glycoside hydrolase family 18 protein	NA	A0A2K9L3D4	Tupanvirus	28.3	9.1e-25
>prophage 172
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	2505846	2509900	6152190		Staphylococcus_phage(50.0%)	4	NA	NA
WP_014228958.1|2505846_2506830_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	23.9	5.7e-06
WP_014228959.1|2506963_2507722_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_042944926.1|2507862_2509221_+	MFS transporter	NA	NA	NA	NA	NA
WP_014228961.1|2509258_2509900_-	bifunctional nicotinamidase/pyrazinamidase	NA	A0A2K9L6K4	Tupanvirus	39.1	2.6e-20
>prophage 173
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	2516884	2517802	6152190		Streptococcus_phage(100.0%)	1	NA	NA
WP_160741955.1|2516884_2517802_+	hypothetical protein	NA	A0A1X9I6W8	Streptococcus_phage	31.7	5.6e-32
>prophage 174
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	2522035	2522668	6152190		Bacillus_phage(100.0%)	1	NA	NA
WP_014838191.1|2522035_2522668_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	31.4	6.9e-13
>prophage 175
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	2528678	2529899	6152190		Klosneuvirus(100.0%)	1	NA	NA
WP_042944932.1|2528678_2529899_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	26.7	7.2e-27
>prophage 176
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	2539317	2540145	6152190		Bacillus_virus(100.0%)	1	NA	NA
WP_004850083.1|2539317_2540145_-	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	53.1	1.2e-70
>prophage 177
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	2546360	2552099	6152190		Tupanvirus(50.0%)	5	NA	NA
WP_014228985.1|2546360_2548619_-	catalase HPII	NA	A0A2K9L572	Tupanvirus	49.9	2.1e-144
WP_072351776.1|2548707_2549055_+	cell division activator CedA	NA	NA	NA	NA	NA
WP_014228987.1|2549129_2550521_-	L-cystine transporter	NA	NA	NA	NA	NA
WP_014228988.1|2550655_2551246_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_014228989.1|2551337_2552099_-	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	29.0	1.8e-15
>prophage 178
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	2556474	2557791	6152190		Streptococcus_phage(100.0%)	1	NA	NA
WP_038424344.1|2556474_2557791_-	voltage-gated chloride channel family protein	NA	A0A1X9I5Z9	Streptococcus_phage	32.8	1.1e-41
>prophage 179
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	2568522	2571480	6152190		Acinetobacter_phage(100.0%)	2	NA	NA
WP_014229005.1|2568522_2569881_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	39.8	4.7e-35
WP_004850135.1|2569884_2571480_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	36.7	1.1e-46
>prophage 180
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	2584433	2587031	6152190		Tupanvirus(100.0%)	1	NA	NA
WP_042944939.1|2584433_2587031_+	type I DNA topoisomerase	NA	A0A2K9L5F8	Tupanvirus	35.0	2.2e-89
>prophage 181
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	2591875	2592466	6152190		Staphylococcus_phage(100.0%)	1	NA	NA
WP_004121245.1|2591875_2592466_-	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.9	3.5e-43
>prophage 182
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	2598043	2604233	6152190		Bodo_saltans_virus(33.33%)	5	NA	NA
WP_042944942.1|2598043_2599978_-	exoribonuclease II	NA	A0A2H4UVB7	Bodo_saltans_virus	24.9	3.1e-08
WP_042944944.1|2600059_2601217_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_004121225.1|2601399_2602188_-	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_004850180.1|2602429_2603239_-	peptide ABC transporter ATP-binding protein SapF	NA	A0A2H4PQG7	Staphylococcus_phage	26.3	1.6e-14
WP_014229021.1|2603240_2604233_-	peptide ABC transporter ATP-binding protein SapD	NA	G9BWD6	Planktothrix_phage	26.7	2.1e-08
>prophage 183
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	2627327	2628347	6152190		Bacillus_phage(100.0%)	1	NA	NA
WP_014229034.1|2627327_2628347_+	methionine ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	34.6	6.9e-15
>prophage 184
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	2637213	2638008	6152190		Bacillus_virus(100.0%)	1	NA	NA
WP_025107016.1|2637213_2638008_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.4	1.8e-31
>prophage 185
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	2645143	2652309	6152190		Streptococcus_phage(25.0%)	8	NA	NA
WP_014229052.1|2645143_2646049_+	PLP-dependent cysteine synthase family protein	NA	A0A1X9I5K7	Streptococcus_phage	38.0	5.2e-46
WP_014229053.1|2646041_2646470_+	M67 family metallopeptidase	NA	NA	NA	NA	NA
WP_014229054.1|2646529_2646820_+	MoaD/ThiS family protein	NA	NA	NA	NA	NA
WP_042944950.1|2646816_2647992_+	molybdopterin-synthase adenylyltransferase MoeB	NA	A0A291ATS8	Pandoravirus	33.6	2.3e-09
WP_014229056.1|2648029_2648974_+	membrane protein	NA	NA	NA	NA	NA
WP_042944952.1|2648960_2650439_+	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	42.1	1.8e-88
WP_014229058.1|2650628_2651495_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_014838260.1|2651466_2652309_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	41.1	7.2e-34
>prophage 186
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	2658385	2725903	6152190	head,plate,portal,capsid,terminase,tail,holin,integrase	Klebsiella_phage(27.03%)	75	2658721:2658736	2709518:2709533
WP_014229066.1|2658385_2659162_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.4	3.9e-34
2658721:2658736	attL	CGCCCGTGCGATGGAA	NA	NA	NA	NA
WP_042944954.1|2659440_2659992_-	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
WP_025714665.1|2660181_2661363_+|integrase	site-specific integrase	integrase	A0A0M4QX09	Salmonella_phage	84.4	2.0e-199
WP_025714666.1|2661343_2661535_-	hypothetical protein	NA	A0A0M4RTZ2	Salmonella_phage	78.7	2.3e-20
WP_162763176.1|2661545_2661692_-	hypothetical protein	NA	A0A1B5FPC2	Escherichia_phage	75.0	2.0e-16
WP_025714667.1|2661688_2661913_-	hypothetical protein	NA	A0A286S2B3	Klebsiella_phage	55.4	2.8e-17
WP_077255270.1|2661896_2662334_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025714669.1|2662323_2663031_-	DNA-binding protein	NA	A0A286S260	Klebsiella_phage	86.3	3.8e-105
WP_042946195.1|2663036_2663564_-	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	83.6	1.6e-76
WP_042944955.1|2663607_2664039_-	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	92.1	4.6e-69
WP_162680280.1|2664035_2664158_-	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	95.0	6.3e-16
WP_049077787.1|2664430_2664718_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049077790.1|2664758_2664968_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032692699.1|2665147_2665561_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077253337.1|2665723_2666398_-	LexA family transcriptional regulator	NA	A0A1B5FPF4	Escherichia_phage	79.5	3.9e-99
WP_071889436.1|2666543_2666777_+	Cro/Cl family transcriptional regulator	NA	A0A1B5FPK9	Escherichia_phage	63.9	9.9e-18
WP_042946196.1|2666778_2666976_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_042944962.1|2666972_2667890_+	helix-turn-helix domain-containing protein	NA	Q8W642	Enterobacteria_phage	47.1	1.9e-35
WP_042944963.1|2667993_2669865_+	AAA family ATPase	NA	I6S1U6	Salmonella_phage	59.7	1.3e-224
WP_042944964.1|2669866_2670175_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042944965.1|2670171_2670987_+	molecular chaperone	NA	A0A286N2Q2	Klebsiella_phage	75.3	2.3e-109
WP_042944967.1|2671275_2671773_-	hypothetical protein	NA	A0A077K9U2	Edwardsiella_phage	50.3	4.7e-33
WP_158414542.1|2671771_2671948_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142395353.1|2672392_2672692_+|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	98.0	3.2e-45
WP_042944969.1|2672688_2673231_+	hypothetical protein	NA	A0A286N2Q6	Klebsiella_phage	77.0	1.7e-76
WP_042944971.1|2673227_2673572_+	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	84.2	2.9e-42
WP_014837906.1|2673568_2673844_+	hypothetical protein	NA	G8C7W1	Escherichia_phage	35.6	3.0e-05
WP_042944973.1|2675046_2675685_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047934963.1|2675716_2676223_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042944975.1|2676539_2677103_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042944976.1|2677044_2679168_+|terminase	terminase	terminase	A0A0C5ABH4	Bacteriophage	34.4	4.4e-96
WP_032735077.1|2679176_2679440_+|head,tail	phage head-tail adapter protein	head,tail	NA	NA	NA	NA
WP_042944979.1|2679439_2681077_+|portal	phage portal protein	portal	A0A291AUL8	Sinorhizobium_phage	35.8	1.4e-89
WP_042944980.1|2681073_2681943_+	S49 family peptidase	NA	K4I1N3	Providencia_phage	39.4	4.6e-52
WP_042944982.1|2681944_2682523_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042944983.1|2682522_2682927_+|head	head decoration protein	head	NA	NA	NA	NA
WP_042944984.1|2683024_2684074_+|capsid	major capsid protein	capsid	V5Q8G6	Xylella_phage	33.7	2.1e-51
WP_042944986.1|2684075_2684444_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042944987.1|2684449_2684809_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042944989.1|2684805_2685351_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042944991.1|2685354_2685534_+	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
WP_042944993.1|2685534_2687052_+|tail	tail protein	tail	B5TK67	Pseudomonas_phage	43.8	1.7e-105
WP_042944995.1|2687055_2687424_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_042944996.1|2687427_2687706_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_042944998.1|2687850_2689620_+	transglycosylase SLT domain-containing protein	NA	I6ZXX9	Escherichia_phage	48.5	2.5e-28
WP_042945000.1|2689692_2690082_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042945002.1|2690150_2691551_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042945004.1|2691547_2692624_+|tail	tail protein	tail	Q8SBG7	Shigella_phage	31.3	1.4e-37
WP_103433618.1|2692659_2693199_+|plate	baseplate assembly protein	plate	A0A077KAY0	Edwardsiella_phage	37.8	1.4e-11
WP_042945008.1|2693195_2693645_+	hypothetical protein	NA	A0A0C4UR04	Shigella_phage	45.1	1.7e-18
WP_042945010.1|2693634_2694783_+|plate	baseplate J/gp47 family protein	plate	R9TN81	Rhizobium_phage	25.5	1.4e-19
WP_071889437.1|2694779_2695448_+	DUF2313 domain-containing protein	NA	NA	NA	NA	NA
WP_049870915.1|2695487_2696159_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042945012.1|2696292_2698449_+	right-handed parallel beta-helix repeat-containing protein	NA	A0A248XD04	Klebsiella_phage	63.8	6.4e-10
WP_042945014.1|2698451_2699852_+	hypothetical protein	NA	W6E8G0	Rhizobium_phage	30.5	4.0e-13
WP_042945016.1|2699958_2700198_+	hypothetical protein	NA	I6PD82	Cronobacter_phage	55.7	7.5e-21
WP_042945018.1|2700199_2700517_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	62.5	4.0e-30
WP_042945021.1|2700714_2701137_+	hypothetical protein	NA	K7P834	Enterobacteria_phage	45.3	1.9e-27
WP_019705237.1|2701531_2701780_-	DinI-like family protein	NA	S5MQI1	Escherichia_phage	70.4	1.0e-25
WP_014838265.1|2702051_2702207_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042945023.1|2702818_2703310_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_025108179.1|2703350_2704886_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_038424382.1|2704899_2706243_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_014229072.1|2706239_2706905_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_038424383.1|2706901_2708590_+	OmpA family protein	NA	NA	NA	NA	NA
WP_014229074.1|2708734_2709226_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_042945025.1|2709473_2712116_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	32.5	1.1e-96
2709518:2709533	attR	CGCCCGTGCGATGGAA	NA	NA	NA	NA
WP_038424390.1|2714861_2716829_+	membrane protein	NA	A0A077K801	Ralstonia_phage	32.4	5.0e-62
WP_014229081.1|2716830_2717091_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_032694505.1|2717090_2718524_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065365967.1|2718665_2721899_+	type VI secretion protein VasK	NA	NA	NA	NA	NA
WP_042945026.1|2722119_2723880_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_032694508.1|2723843_2724929_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_042945027.1|2724906_2725446_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_014838282.1|2725447_2725903_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
>prophage 187
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	2739035	2739761	6152190		Enterobacteria_phage(100.0%)	1	NA	NA
WP_032693666.1|2739035_2739761_-	MerR family transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	46.4	3.5e-45
>prophage 188
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	2752926	2756514	6152190		Morganella_phage(33.33%)	4	NA	NA
WP_042945047.1|2752926_2753349_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	50.4	4.4e-32
WP_014229114.1|2753348_2754614_+	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	66.4	1.0e-156
WP_032693679.1|2754686_2755754_-	oxidoreductase	NA	NA	NA	NA	NA
WP_014229116.1|2755770_2756514_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	27.6	1.1e-14
>prophage 189
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	2759560	2788348	6152190	tRNA,protease,tail,holin	Enterobacteria_phage(19.05%)	26	NA	NA
WP_014229118.1|2759560_2760934_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	31.8	6.8e-50
WP_014838310.1|2760978_2761914_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	93.4	7.0e-139
WP_042934342.1|2762725_2763664_+|protease	omptin family outer membrane protease	protease	NA	NA	NA	NA
WP_014229121.1|2764067_2764358_-	hypothetical protein	NA	C6ZCX3	Enterobacteria_phage	66.0	9.7e-31
WP_004101601.1|2764546_2764981_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	51.4	7.2e-30
WP_004850325.1|2765063_2765276_-	KTSC domain-containing protein	NA	NA	NA	NA	NA
WP_042945049.1|2765429_2766536_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	57.1	4.2e-106
WP_025107972.1|2766893_2770421_-	pyruvate:ferredoxin (flavodoxin) oxidoreductase	NA	NA	NA	NA	NA
WP_009653037.1|2771055_2771592_+	helix-turn-helix transcriptional regulator	NA	K7PKK1	Enterobacteria_phage	49.7	5.2e-30
WP_032693411.1|2772053_2772416_+	hypothetical protein	NA	C6ZR44	Salmonella_phage	58.3	5.4e-31
WP_009653048.1|2772492_2772885_+	membrane protein	NA	K7PHB9	Enterobacterial_phage	66.2	1.3e-38
WP_071889438.1|2772874_2773147_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	54.2	7.0e-15
WP_032720807.1|2773154_2773697_+	glycoside hydrolase family 108 protein	NA	A0A0U2I1S0	Escherichia_phage	66.7	6.8e-70
WP_004850340.1|2773752_2774172_+	hypothetical protein	NA	Q6UAS0	Klebsiella_phage	51.5	9.4e-35
WP_014229127.1|2774291_2774954_+|tail	phage tail protein	tail	I6PBN6	Cronobacter_phage	65.0	7.0e-77
WP_014229128.1|2775026_2775338_+	hypothetical protein	NA	I6PDG2	Cronobacter_phage	62.1	1.5e-32
WP_071881731.1|2775400_2775646_+	hypothetical protein	NA	A0A2H4J4F7	uncultured_Caudovirales_phage	41.2	6.1e-10
WP_014229129.1|2775730_2776840_+|tail	phage tail tape measure protein	tail	I6PCW3	Cronobacter_phage	48.5	5.9e-52
WP_014229130.1|2776862_2777210_+|tail	phage tail protein	tail	I6PBN7	Cronobacter_phage	60.9	5.4e-36
WP_014229131.1|2777206_2777959_+|tail	phage minor tail protein L	tail	K7PKU0	Enterobacteria_phage	76.7	2.5e-115
WP_038423189.1|2777960_2778695_+	peptidase P60	NA	Q6UAW4	Klebsiella_phage	83.6	5.3e-126
WP_038424422.1|2778862_2779477_+|tail	tail assembly protein	tail	K7PM97	Enterobacterial_phage	70.1	5.5e-68
WP_042946201.1|2779539_2786238_+	DUF1983 domain-containing protein	NA	Q6UAW1	Klebsiella_phage	84.0	2.0e-142
WP_004101621.1|2786523_2786796_+	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_014229134.1|2786792_2787233_-	heat shock protein HslJ	NA	NA	NA	NA	NA
WP_004112629.1|2787358_2788348_-	2-hydroxyacid dehydrogenase	NA	M1HKI4	Acanthocystis_turfacea_Chlorella_virus	45.7	1.9e-70
>prophage 190
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	2797636	2799157	6152190		Indivirus(100.0%)	1	NA	NA
WP_014838321.1|2797636_2799157_-	amino acid ABC transporter permease/ATP-binding protein	NA	A0A1V0SE00	Indivirus	26.3	6.9e-11
>prophage 191
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	2821775	2823282	6152190		Streptococcus_phage(50.0%)	2	NA	NA
WP_038424437.1|2821775_2822465_+	YafY family transcriptional regulator	NA	A0A1B0RXM1	Streptococcus_phage	29.1	5.7e-13
WP_025107943.1|2822535_2823282_+	SDR family oxidoreductase	NA	W8CYX9	Bacillus_phage	30.8	2.5e-06
>prophage 192
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	2843914	2844985	6152190		Synechococcus_phage(100.0%)	1	NA	NA
WP_014838352.1|2843914_2844985_+	phenylacetate-CoA oxygenase/reductase subunit PaaK	NA	V5UTY8	Synechococcus_phage	39.3	2.4e-10
>prophage 193
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	2854518	2859129	6152190		Klosneuvirus(50.0%)	2	NA	NA
WP_014838357.1|2854518_2858421_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.7	7.6e-54
WP_014229195.1|2858469_2859129_-	O-methyltransferase	NA	W8CYT3	Bacillus_phage	50.4	1.4e-29
>prophage 194
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	2871138	2875757	6152190		Bacillus_phage(20.0%)	7	NA	NA
WP_014229205.1|2871138_2872110_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	30.7	2.1e-13
WP_004850536.1|2872175_2872379_-	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	53.7	6.0e-11
WP_014838364.1|2872671_2872869_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004101739.1|2873175_2873418_-	DinI family protein	NA	Q6UAW0	Klebsiella_phage	82.3	1.6e-31
WP_025107908.1|2873643_2874171_+	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	46.7	2.4e-19
WP_004101746.1|2874340_2874616_+	metal/formaldehyde-sensitive transcriptional repressor	NA	NA	NA	NA	NA
WP_042945090.1|2874638_2875757_+	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	29.5	8.1e-33
>prophage 195
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	2882993	2884502	6152190		Mollivirus(100.0%)	1	NA	NA
WP_014229212.1|2882993_2884502_+	carboxylesterase/lipase family protein	NA	A0A0M4JT58	Mollivirus	29.5	1.7e-30
>prophage 196
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	2893149	2894130	6152190	transposase	Escherichia_phage(100.0%)	1	NA	NA
WP_000019441.1|2893149_2894130_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	2.3e-185
>prophage 197
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	2899047	2901012	6152190		Phage_TP(100.0%)	1	NA	NA
WP_032693487.1|2899047_2901012_+	U32 family peptidase	NA	Q6DW11	Phage_TP	28.0	3.0e-22
>prophage 198
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	2907761	2908772	6152190		Mycoplasma_phage(100.0%)	1	NA	NA
WP_042945095.1|2907761_2908772_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	35.8	4.7e-24
>prophage 199
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	2925787	2927899	6152190		Salmonella_phage(100.0%)	1	NA	NA
WP_014229248.1|2925787_2927899_-	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	68.2	4.2e-139
>prophage 200
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	2938309	2939089	6152190		Bacillus_virus(100.0%)	1	NA	NA
WP_014838408.1|2938309_2939089_+	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.5	1.9e-20
>prophage 201
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	2952890	2953595	6152190		Bacillus_virus(100.0%)	1	NA	NA
WP_160740895.1|2952890_2953595_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	32.7	1.1e-30
>prophage 202
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	2958979	2960524	6152190		Escherichia_phage(100.0%)	1	NA	NA
WP_004101903.1|2958979_2960524_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	44.6	1.9e-19
>prophage 203
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	2966627	2968118	6152190		Mycobacterium_phage(100.0%)	1	NA	NA
WP_004850706.1|2966627_2968118_+	MFS transporter	NA	A0A0M3UL24	Mycobacterium_phage	29.3	1.1e-32
>prophage 204
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	2978098	2979703	6152190		Planktothrix_phage(100.0%)	1	NA	NA
WP_042945127.1|2978098_2979703_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.9	1.1e-19
>prophage 205
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	2986576	2991688	6152190		uncultured_Mediterranean_phage(33.33%)	6	NA	NA
WP_014229291.1|2986576_2987176_+	inorganic diphosphatase	NA	A0A1B1ISK6	uncultured_Mediterranean_phage	40.6	5.3e-23
WP_014838435.1|2987436_2987898_+	recombinase family protein	NA	A0JC18	Ralstonia_phage	34.3	1.7e-13
WP_042945136.1|2987936_2988629_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042934095.1|2988874_2989354_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_076752232.1|2989410_2989938_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_042945137.1|2989975_2991688_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A1B0RXA0	Streptococcus_phage	25.2	8.0e-32
>prophage 206
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	3010249	3013833	6152190		Bacillus_virus(50.0%)	2	NA	NA
WP_025108277.1|3010249_3010945_+	MgtC family protein	NA	G3MA03	Bacillus_virus	43.1	6.2e-15
WP_042945147.1|3011100_3013833_+	magnesium-translocating P-type ATPase	NA	M1IAU8	Acanthocystis_turfacea_Chlorella_virus	25.6	2.5e-35
>prophage 207
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	3022104	3023693	6152190		Bacillus_virus(50.0%)	2	NA	NA
WP_038424494.1|3022104_3022920_+	ABC transporter permease	NA	G3M9Y4	Bacillus_virus	21.3	5.6e-07
WP_042945148.1|3022916_3023693_+	ABC transporter ATP-binding protein	NA	A0A140XAK6	Dickeya_phage	48.4	1.1e-17
>prophage 208
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	3036879	3040998	6152190		Klosneuvirus(50.0%)	4	NA	NA
WP_042945153.1|3036879_3038265_-	diaminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	26.8	4.4e-28
WP_014838463.1|3038572_3039508_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004850829.1|3039532_3040273_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_042945155.1|3040269_3040998_-	ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	30.5	8.2e-18
>prophage 209
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	3054560	3055445	6152190		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_004850866.1|3054560_3055445_-	SDR family oxidoreductase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	56.7	3.7e-81
>prophage 210
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	3062680	3064078	6152190		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_042945166.1|3062680_3064078_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	28.7	7.0e-42
>prophage 211
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	3079111	3079927	6152190		Autographa_californica_nuclear_polyhedrosis_virus(100.0%)	1	NA	NA
WP_042946206.1|3079111_3079927_+	APH(3')-I family aminoglycoside O-phosphotransferase	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	96.3	1.9e-156
>prophage 212
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	3093326	3113889	6152190		Bacillus_phage(50.0%)	5	NA	NA
WP_032719113.1|3093326_3095129_-	yersiniabactin ABC transporter ATP-binding/permease protein YbtQ	NA	W8CYL7	Bacillus_phage	23.5	4.4e-20
WP_042945183.1|3095115_3096828_-	yersiniabactin ABC transporter ATP-binding/permease protein YbtP	NA	W8CYL7	Bacillus_phage	26.9	3.1e-31
WP_014229382.1|3097084_3098044_+	yersiniabactin transcriptional regulator YbtA	NA	NA	NA	NA	NA
WP_042945184.1|3098227_3104326_+	non-ribosomal peptide synthetase	NA	A0A2K9L3I8	Tupanvirus	26.9	4.0e-33
WP_042945187.1|3104412_3113889_+	yersiniabactin polyketide synthase HMWP1	NA	D0R7J2	Paenibacillus_phage	36.8	8.1e-49
>prophage 213
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	3126125	3126872	6152190		Staphylococcus_phage(100.0%)	1	NA	NA
WP_162097199.1|3126125_3126872_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.0	1.3e-15
>prophage 214
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	3131479	3133477	6152190		Acinetobacter_phage(100.0%)	1	NA	NA
WP_088941761.1|3131479_3133477_-	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	27.3	4.2e-08
>prophage 215
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	3137227	3137956	6152190		Escherichia_phage(100.0%)	1	NA	NA
WP_014229408.1|3137227_3137956_+	tetrathionate reductase subunit TtrB	NA	A0A077SL61	Escherichia_phage	38.4	8.4e-23
>prophage 216
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	3158014	3158851	6152190		Mycobacterium_phage(100.0%)	1	NA	NA
WP_042945211.1|3158014_3158851_-	alpha/beta hydrolase	NA	A0A1I9SAY0	Mycobacterium_phage	37.7	2.4e-13
>prophage 217
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	3168125	3169658	6152190		Staphylococcus_phage(100.0%)	1	NA	NA
WP_038424537.1|3168125_3169658_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.0	5.0e-17
>prophage 218
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	3177430	3180994	6152190		Paramecium_bursaria_Chlorella_virus(50.0%)	3	NA	NA
WP_014838545.1|3177430_3178426_+	2-hydroxyacid dehydrogenase	NA	M1HST2	Paramecium_bursaria_Chlorella_virus	30.5	4.4e-22
WP_004851075.1|3178515_3179778_+	PTS galactitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_042945224.1|3179908_3180994_-	porin	NA	Q1MVN1	Enterobacteria_phage	67.1	1.0e-141
>prophage 219
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	3185421	3186231	6152190		Phaeocystis_globosa_virus(100.0%)	1	NA	NA
WP_014229450.1|3185421_3186231_-	ABC transporter ATP-binding protein	NA	R4TX06	Phaeocystis_globosa_virus	29.4	2.8e-11
>prophage 220
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	3190217	3191675	6152190		Mycoplasma_phage(100.0%)	1	NA	NA
WP_042945232.1|3190217_3191675_+	leucyl aminopeptidase family protein	NA	Q6GYZ8	Mycoplasma_phage	35.3	9.8e-39
>prophage 221
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	3199076	3199817	6152190		Indivirus(100.0%)	1	NA	NA
WP_042946208.1|3199076_3199817_-	amino acid ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	31.1	5.6e-14
>prophage 222
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	3203318	3204110	6152190		Bacillus_virus(100.0%)	1	NA	NA
WP_014229467.1|3203318_3204110_+	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	29.5	1.6e-19
>prophage 223
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	3223804	3225217	6152190		Bacillus_phage(100.0%)	1	NA	NA
WP_014229484.1|3223804_3225217_-	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	31.4	3.5e-17
>prophage 224
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	3235298	3235679	6152190		Streptococcus_phage(100.0%)	1	NA	NA
WP_004102351.1|3235298_3235679_+	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	1.4e-08
>prophage 225
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	3239331	3240837	6152190		Staphylococcus_phage(50.0%)	2	NA	NA
WP_014229495.1|3239331_3240030_-	urea ABC transporter ATP-binding subunit UrtE	NA	A0A2H4PQG7	Staphylococcus_phage	25.3	6.2e-15
WP_014229496.1|3240039_3240837_-	urea ABC transporter ATP-binding protein UrtD	NA	A0A1M7XV31	Cedratvirus	26.9	1.2e-11
>prophage 226
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	3245017	3246121	6152190		uncultured_virus(100.0%)	1	NA	NA
WP_014838597.1|3245017_3246121_-	cobalamin-independent methionine synthase II family protein	NA	A0A218MNE0	uncultured_virus	48.9	3.6e-102
>prophage 227
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	3253997	3261217	6152190		Escherichia_phage(50.0%)	5	NA	NA
WP_038423158.1|3253997_3255068_-	substrate-binding domain-containing protein	NA	C6ZCU4	Enterobacteria_phage	44.6	1.0e-64
WP_162763179.1|3256748_3258383_+	DUF4981 domain-containing protein	NA	L0N6M2	Herpes_simplex_virus	55.5	6.4e-180
WP_014229511.1|3258438_3259689_+	MFS transporter	NA	NA	NA	NA	NA
WP_014838607.1|3259762_3260851_-	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	82.5	3.7e-176
WP_004851229.1|3260953_3261217_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	82.4	3.8e-34
>prophage 228
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	3267438	3284708	6152190		Escherichia_phage(37.5%)	17	NA	NA
WP_042945259.1|3267438_3269481_-	peptidyl-dipeptidase Dcp	NA	A0A1V0SIU1	Klosneuvirus	22.2	3.1e-14
WP_004851244.1|3269652_3270402_+	bifunctional NADP-dependent 3-hydroxy acid dehydrogenase/3-hydroxypropionate dehydrogenase YdfG	NA	NA	NA	NA	NA
WP_014229523.1|3270492_3271179_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004851249.1|3271222_3271654_-	universal stress protein	NA	A0A1W6JNV4	Morganella_phage	39.3	1.5e-19
WP_004851251.1|3271931_3273395_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	31.2	3.2e-45
WP_042945262.1|3273630_3275007_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_042945264.1|3275050_3276070_-	Zn-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_004851257.1|3276084_3277299_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.5	9.7e-48
WP_004851258.1|3277505_3277832_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	53.9	7.6e-24
WP_004851259.1|3277968_3278310_+	DUF1283 family protein	NA	NA	NA	NA	NA
WP_004102449.1|3278372_3278933_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_014229527.1|3278926_3279637_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_014838619.1|3279739_3279991_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_042945266.1|3280139_3282575_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.7	1.2e-219
WP_014229529.1|3282585_3283203_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	57.6	4.4e-73
WP_014229530.1|3283204_3284062_+	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_042945267.1|3284102_3284708_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	38.3	3.1e-23
>prophage 229
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	3295082	3297239	6152190		Bacillus_virus(100.0%)	1	NA	NA
WP_042945269.1|3295082_3297239_-	bifunctional diguanylate cyclase/phosphodiesterase	NA	G3MA91	Bacillus_virus	34.0	7.8e-16
>prophage 230
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	3304586	3305546	6152190		Salmonella_phage(100.0%)	1	NA	NA
WP_004851304.1|3304586_3305546_+	AEC family transporter	NA	A0A0U2C0Y4	Salmonella_phage	90.3	1.3e-52
>prophage 231
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	3316472	3319250	6152190		Lactobacillus_phage(100.0%)	1	NA	NA
WP_025105802.1|3316472_3319250_-	flavocytochrome c	NA	A0A2P0ZL82	Lactobacillus_phage	30.8	4.7e-66
>prophage 232
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	3335773	3336289	6152190		Streptococcus_phage(100.0%)	1	NA	NA
WP_004851361.1|3335773_3336289_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	53.8	4.1e-24
>prophage 233
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	3350456	3353425	6152190		Molluscum_contagiosum_virus(50.0%)	3	NA	NA
WP_032692799.1|3350456_3350939_+	glutathione peroxidase	NA	A0A1S7DMQ0	Molluscum_contagiosum_virus	40.2	3.0e-16
WP_009654787.1|3351115_3351805_-	VIT family protein	NA	NA	NA	NA	NA
WP_014229576.1|3352123_3353425_+	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	24.0	2.5e-17
>prophage 234
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	3364873	3365077	6152190		Salmonella_phage(100.0%)	1	NA	NA
WP_004851411.1|3364873_3365077_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	67.2	3.5e-19
>prophage 235
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	3370436	3371807	6152190		Pandoravirus(100.0%)	1	NA	NA
WP_014229586.1|3370436_3371807_+	beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	33.7	8.0e-67
>prophage 236
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	3382987	3384262	6152190	tRNA	Cronobacter_phage(100.0%)	1	NA	NA
WP_004851444.1|3382987_3384262_-|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	41.8	9.4e-86
>prophage 237
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	3392902	3394380	6152190		Salmonella_phage(50.0%)	2	NA	NA
WP_004119475.1|3392902_3393424_-	superoxide dismutase [Cu-Zn] SodC2	NA	Q9MC02	Salmonella_phage	56.3	2.1e-47
WP_042945298.1|3393483_3394380_-	aldo/keto reductase family oxidoreductase	NA	A0A1V0SDE7	Indivirus	29.7	2.7e-07
>prophage 238
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	3398539	3407237	6152190		Bacillus_phage(20.0%)	9	NA	NA
WP_014229604.1|3398539_3399394_+	C40 family peptidase	NA	A0A217EQL1	Bacillus_phage	38.7	4.7e-17
WP_004851476.1|3399518_3400100_+	superoxide dismutase [Fe]	NA	Q56AR7	Bacillus_thuringiensis_phage	45.3	9.0e-44
WP_004851479.1|3400156_3401323_-	MFS transporter	NA	NA	NA	NA	NA
WP_049082851.1|3401487_3401577_-	YnhF family membrane protein	NA	NA	NA	NA	NA
WP_004851481.1|3401872_3402898_+	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	31.6	1.8e-31
WP_014229606.1|3402916_3403828_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_042945300.1|3403940_3405125_+	Bcr/CflA family multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_014229608.1|3405423_3406572_+	cyclopropane fatty acyl phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	45.7	6.5e-86
WP_014229609.1|3406601_3407237_-	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	36.3	2.1e-22
>prophage 239
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	3421740	3425834	6152190		Trichoplusia_ni_ascovirus(50.0%)	5	NA	NA
WP_014229621.1|3421740_3422625_+	SDR family oxidoreductase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	55.8	2.8e-81
WP_014229622.1|3422647_3423454_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_004119381.1|3423560_3424196_-	carbonic anhydrase	NA	NA	NA	NA	NA
WP_014229623.1|3424420_3425050_+	LysE family transporter	NA	NA	NA	NA	NA
WP_004851588.1|3425063_3425834_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	28.7	3.6e-16
>prophage 240
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	3430899	3436295	6152190	integrase	Planktothrix_phage(66.67%)	4	3431931:3431944	3439845:3439858
WP_014838682.1|3430899_3431880_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.4	1.2e-11
WP_025105867.1|3431876_3432842_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	29.0	9.2e-17
3431931:3431944	attL	CGCGATGGGCTGTT	NA	NA	NA	NA
WP_014229629.1|3432916_3435322_-	membrane-bound PQQ-dependent dehydrogenase, glucose/quinate/shikimate family	NA	NA	NA	NA	NA
WP_032719368.1|3435746_3436295_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	52.4	4.2e-51
3439845:3439858	attR	CGCGATGGGCTGTT	NA	NA	NA	NA
>prophage 241
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	3442317	3442869	6152190	integrase	Escherichia_phage(100.0%)	1	3439560:3439574	3449794:3449808
3439560:3439574	attL	GATATGCAGGACGTT	NA	NA	NA	NA
WP_014838689.1|3442317_3442869_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	55.1	2.6e-53
WP_014838689.1|3442317_3442869_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	55.1	2.6e-53
3449794:3449808	attR	AACGTCCTGCATATC	NA	NA	NA	NA
>prophage 242
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	3446629	3447502	6152190		Lactobacillus_phage(100.0%)	1	NA	NA
WP_014229640.1|3446629_3447502_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	27.3	4.3e-05
>prophage 243
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	3450928	3451999	6152190		Bacillus_virus(100.0%)	1	NA	NA
WP_032692928.1|3450928_3451999_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	32.4	9.8e-28
>prophage 244
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	3472602	3474945	6152190		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_042945322.1|3472602_3474945_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	27.1	3.9e-05
>prophage 245
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	3495698	3500025	6152190		Planktothrix_phage(50.0%)	3	NA	NA
WP_042945333.1|3495698_3496520_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.5	2.5e-15
WP_088168676.1|3497026_3499099_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_014838728.1|3499236_3500025_-	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	33.8	8.5e-29
>prophage 246
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	3513090	3515054	6152190		Micromonas_sp._RCC1109_virus(100.0%)	2	NA	NA
WP_014229695.1|3513090_3514107_-	4-hydroxy-2-oxovalerate aldolase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	31.7	6.0e-43
WP_025108198.1|3514103_3515054_-	acetaldehyde dehydrogenase (acetylating)	NA	E5EQ71	Micromonas_sp._RCC1109_virus	36.9	4.8e-34
>prophage 247
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	3533215	3534436	6152190		environmental_halophage(100.0%)	1	NA	NA
WP_014229709.1|3533215_3534436_-	cysteine desulfurase SufS	NA	Q2XUY6	environmental_halophage	42.9	4.0e-94
>prophage 248
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	3546736	3547717	6152190	transposase	Escherichia_phage(100.0%)	1	NA	NA
WP_016947617.1|3546736_3547717_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	6.8e-185
>prophage 249
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	3553343	3571330	6152190	tRNA	Tupanvirus(25.0%)	18	NA	NA
WP_014229722.1|3553343_3555722_-	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	37.0	2.9e-173
WP_004851771.1|3556064_3556898_+	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_014229723.1|3557051_3558098_+	3-deoxy-7-phosphoheptulonate synthase AroH	NA	A0A0B5IW14	Pandoravirus	47.4	2.3e-82
WP_160741222.1|3558263_3558443_+	hemin uptake protein HemP	NA	NA	NA	NA	NA
WP_032694067.1|3558477_3559920_-	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	34.4	7.4e-55
WP_038424642.1|3560081_3560546_-	endopeptidase	NA	NA	NA	NA	NA
WP_014229727.1|3560627_3561377_-	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	30.9	4.2e-09
WP_014229728.1|3561376_3561928_-	glutathione peroxidase	NA	NA	NA	NA	NA
WP_014229729.1|3562152_3562953_+	MetQ/NlpA family lipoprotein	NA	NA	NA	NA	NA
WP_042946215.1|3562979_3563966_-	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_004851790.1|3564066_3564366_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	38.9	9.4e-13
WP_042945355.1|3564370_3566758_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_004851795.1|3566773_3567757_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	2.9e-34
WP_001386830.1|3567986_3568031_-	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_004102963.1|3568154_3568511_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001124225.1|3568561_3568759_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_052746887.1|3568855_3569398_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.3	5.3e-14
WP_004102966.1|3569401_3571330_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.1	6.7e-128
>prophage 250
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	3580693	3583590	6152190		Lactobacillus_phage(33.33%)	3	NA	NA
WP_014229737.1|3580693_3581530_-	ion transporter	NA	A0A1B0Y2S3	Lactobacillus_phage	41.2	3.9e-08
WP_042945361.1|3581575_3582580_-	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G3M9Y6	Bacillus_virus	28.6	6.8e-15
WP_004851823.1|3582576_3583590_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.7	1.7e-13
>prophage 251
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	3591892	3602142	6152190		Erwinia_phage(20.0%)	10	NA	NA
WP_014229739.1|3591892_3592510_-	thymidine kinase	NA	A0A191ZC13	Erwinia_phage	52.6	3.3e-52
WP_004121719.1|3593066_3593474_+	DNA-binding transcriptional regulator H-NS	NA	NA	NA	NA	NA
WP_004851836.1|3593608_3594511_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	47.6	1.5e-58
WP_004851838.1|3594708_3595722_-	two-component system response regulator RssB	NA	Q6XM27	Feldmannia_irregularis_virus	27.7	3.4e-06
WP_014229740.1|3595802_3596711_-	patatin-like phospholipase RssA	NA	NA	NA	NA	NA
WP_042945363.1|3596823_3597282_+	YchJ family protein	NA	NA	NA	NA	NA
WP_004121732.1|3597324_3598167_+	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	46.3	1.6e-12
WP_004103123.1|3599222_3599900_-	respiratory nitrate reductase subunit gamma	NA	NA	NA	NA	NA
WP_042945364.1|3599899_3600610_-	nitrate reductase molybdenum cofactor assembly chaperone	NA	NA	NA	NA	NA
WP_014838755.1|3600606_3602142_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	41.4	3.7e-20
>prophage 252
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	3618576	3619365	6152190		Bacillus_virus(100.0%)	1	NA	NA
WP_014838761.1|3618576_3619365_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	36.4	1.0e-29
>prophage 253
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	3624725	3630430	6152190		Mythimna_unipuncta_granulovirus(33.33%)	7	NA	NA
WP_009651994.1|3624725_3624956_-	putative cation transport regulator ChaB	NA	A0A1S5YE01	Mythimna_unipuncta_granulovirus	46.7	9.1e-08
WP_004121802.1|3625221_3626322_+	sodium-potassium/proton antiporter ChaA	NA	NA	NA	NA	NA
WP_004851877.1|3626409_3627264_-	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	39.8	8.9e-48
WP_004851879.1|3627303_3628116_-	tetratricopeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_004851880.1|3628119_3628512_-	SirB family protein	NA	NA	NA	NA	NA
WP_032694081.1|3628508_3629348_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_004851884.1|3629347_3630430_-	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	40.0	1.1e-07
>prophage 254
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	3633644	3757396	6152190	head,plate,portal,capsid,protease,terminase,tail,tRNA,integrase	Enterobacteria_phage(34.04%)	119	3656874:3656896	3762115:3762137
WP_004103157.1|3633644_3634592_+	ribose-phosphate diphosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.5	3.0e-44
WP_071889441.1|3634841_3636521_+	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	24.0	3.9e-23
WP_042945376.1|3636521_3637568_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004103160.1|3637777_3638053_-	stress-induced protein YchH	NA	NA	NA	NA	NA
WP_032718850.1|3638325_3638910_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_032694087.1|3639027_3640122_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_077255276.1|3640197_3641205_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4J5F8	uncultured_Caudovirales_phage	33.4	3.6e-48
WP_014229759.1|3641372_3641990_+	cell division protein Fic	NA	NA	NA	NA	NA
WP_038424654.1|3642496_3644281_-	sigma 54-interacting transcriptional regulator	NA	NA	NA	NA	NA
WP_042945378.1|3644771_3645959_+	knotted carbamoyltransferase YgeW	NA	NA	NA	NA	NA
WP_042945380.1|3646023_3647223_+	diaminopropionate ammonia-lyase	NA	NA	NA	NA	NA
WP_004851906.1|3647286_3648498_+	YgeY family selenium metabolism-linked hydrolase	NA	NA	NA	NA	NA
WP_014229763.1|3648548_3649955_+	dihydropyrimidinase	NA	NA	NA	NA	NA
WP_042945385.1|3649967_3650900_+	carbamate kinase	NA	NA	NA	NA	NA
WP_014229765.1|3650954_3651788_-	XdhC family protein	NA	NA	NA	NA	NA
WP_004851914.1|3652318_3655423_+	putative selenate reductase subunit YgfK	NA	NA	NA	NA	NA
WP_014229767.1|3655419_3656757_+	putative aminohydrolase SsnA	NA	NA	NA	NA	NA
WP_014229768.1|3656859_3657336_-	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
3656874:3656896	attL	GCGCGGCGGTGGCGATATTGCGC	NA	NA	NA	NA
WP_042945388.1|3657332_3659273_-	formate-dependent uric acid utilization protein YgfT	NA	NA	NA	NA	NA
WP_032718844.1|3659785_3661258_+	purine permease	NA	Q9KX94	Enterobacteria_phage	27.7	2.8e-25
WP_077598954.1|3661394_3663542_+	formate dehydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_014838779.1|3663608_3664214_-	CTP--molybdopterin cytidylyltransferase	NA	NA	NA	NA	NA
WP_009651983.1|3664280_3664739_-	(2Fe-2S)-binding protein	NA	A0A0P0IVM8	Acinetobacter_phage	35.9	2.1e-19
WP_042945392.1|3664751_3667964_-	molybdopterin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_014229776.1|3668956_3670396_+	sugar porter family MFS transporter	NA	NA	NA	NA	NA
WP_004851939.1|3670392_3670827_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_014229777.1|3670907_3671318_-	hydroxyisourate hydrolase	NA	NA	NA	NA	NA
WP_014229778.1|3671556_3672084_+	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	58.2	8.4e-49
WP_014229779.1|3672162_3672657_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014229780.1|3672890_3674531_-	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	50.2	1.0e-132
WP_042945394.1|3674846_3675740_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_162763182.1|3675745_3676486_+	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	30.1	7.3e-06
WP_042946218.1|3676664_3677753_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.2	6.7e-24
WP_014229783.1|3677745_3678375_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_014229784.1|3678374_3679043_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_014838787.1|3679084_3679984_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_014229786.1|3680045_3681383_+	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_042945396.1|3681866_3682667_-	PhnD/SsuA/transferrin family substrate-binding protein	NA	NA	NA	NA	NA
WP_014229788.1|3682659_3683643_-	fatty acid desaturase	NA	NA	NA	NA	NA
WP_014838790.1|3683747_3684887_-	MFS transporter	NA	NA	NA	NA	NA
WP_042945397.1|3684981_3685749_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_014229791.1|3685733_3686486_-|protease	proteasome-type protease	protease	NA	NA	NA	NA
WP_014229792.1|3686504_3687320_-	transglutaminase family protein	NA	NA	NA	NA	NA
WP_004103215.1|3687316_3688246_-	alpha-E domain-containing protein	NA	NA	NA	NA	NA
WP_014229793.1|3688239_3689679_-	circularly permuted type 2 ATP-grasp protein	NA	NA	NA	NA	NA
WP_042945399.1|3689886_3690777_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_042945400.1|3690798_3693579_-	beta-glucosidase	NA	NA	NA	NA	NA
WP_014229796.1|3693662_3695054_-	glycoporin	NA	NA	NA	NA	NA
WP_042945401.1|3695156_3696515_-	MFS transporter	NA	NA	NA	NA	NA
WP_042945402.1|3697033_3698782_+	alpha,alpha-trehalase	NA	NA	NA	NA	NA
WP_009651970.1|3698886_3699498_-	membrane-bound lytic murein transglycosylase EmtA	NA	A0A0H3V0Q1	Geobacillus_virus	40.7	3.0e-05
WP_014229799.1|3699593_3700508_+	muramoyltetrapeptide carboxypeptidase	NA	NA	NA	NA	NA
WP_004851981.1|3700600_3702334_+	potassium/proton antiporter	NA	NA	NA	NA	NA
WP_042945404.1|3702458_3702845_+	hypothetical protein	NA	B9A7A8	Serratia_phage	54.1	3.6e-33
WP_042945406.1|3702891_3703140_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042945408.1|3703184_3704339_-	phage late control D family protein	NA	B9A7A9	Serratia_phage	82.2	9.1e-181
WP_042945409.1|3704492_3705674_+|tail	tail protein	tail	A0A0A7NV69	Enterobacteria_phage	69.3	5.2e-155
WP_042945411.1|3705673_3706189_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	68.2	6.9e-64
WP_042945412.1|3706243_3706543_+	hypothetical protein	NA	B9A7B2	Serratia_phage	76.8	1.6e-33
WP_071814200.1|3706539_3706716_+|tail	GpE family phage tail protein	tail	O80316	Escherichia_phage	66.7	5.2e-11
WP_042945414.1|3706696_3709642_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	44.2	1.9e-206
WP_042945416.1|3709656_3710145_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	61.7	1.8e-53
WP_042945418.1|3710242_3711403_-|tail	phage tail protein	tail	S4TP62	Salmonella_phage	47.7	1.3e-41
WP_042945420.1|3711468_3711723_-	hypothetical protein	NA	K4MPX1	Escherichia_phage	36.1	1.5e-06
WP_042945423.1|3711734_3713858_-	hypothetical protein	NA	A0A0H3YEH5	Pectobacterium_phage	34.4	9.8e-80
WP_042945425.1|3713835_3714432_-|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	50.9	5.1e-42
WP_042945426.1|3714424_3715324_-|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	59.2	8.4e-89
WP_042945427.1|3715310_3715676_-|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	59.1	6.1e-30
WP_042945429.1|3715672_3716257_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	62.4	1.9e-62
WP_042945431.1|3716256_3716898_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	48.3	7.6e-44
WP_042945432.1|3716894_3717356_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	47.7	1.5e-33
WP_071889442.1|3717352_3717652_-	peptidase	NA	NA	NA	NA	NA
WP_042945435.1|3717892_3718444_-	lysozyme	NA	A0A0H4TH14	Yersinia_phage	43.8	4.9e-31
WP_019724763.1|3718440_3718722_-	hypothetical protein	NA	B9A7B8	Serratia_phage	58.4	7.5e-20
WP_042945437.1|3718712_3718913_-|tail	tail protein	tail	A0A0A7NV57	Enterobacteria_phage	66.2	1.8e-15
WP_042945438.1|3718912_3719410_-|head	head completion/stabilization protein	head	B9A7B7	Serratia_phage	70.9	3.4e-60
WP_042945440.1|3719512_3720433_-|terminase	terminase	terminase	B9A7B6	Serratia_phage	74.7	2.7e-87
WP_042945442.1|3720480_3721530_-|capsid	phage major capsid protein, P2 family	capsid	A0A0M3ULA3	Salmonella_phage	54.5	5.1e-106
WP_042945443.1|3721554_3722388_-|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	64.1	5.5e-95
WP_042945445.1|3722547_3724269_+	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	66.0	6.2e-226
WP_042945446.1|3724268_3725321_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	68.1	5.5e-140
WP_042945448.1|3725720_3726074_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042945449.1|3726192_3726888_-	DNA methylase	NA	A0A0M4S5U3	Salmonella_phage	71.1	1.0e-89
WP_042946219.1|3726989_3727196_-	hypothetical protein	NA	I7LEF4	Yersinia_phage	56.9	1.9e-12
WP_042945453.1|3727522_3730132_-	replication endonuclease	NA	A0A0M4RTM8	Salmonella_phage	52.2	4.3e-194
WP_042945455.1|3730124_3731141_-	DNA cytosine methyltransferase	NA	Q6J1P4	Burkholderia_virus	54.9	7.2e-97
WP_158413321.1|3731116_3731272_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042945456.1|3731271_3731541_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042945458.1|3731540_3732494_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A0M4QWR0	Salmonella_phage	56.6	3.7e-87
WP_042945459.1|3732504_3733083_-	3'-5' exoribonuclease	NA	A0A192Y6E0	Salmonella_phage	40.0	1.9e-33
WP_042946221.1|3733377_3733650_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042945461.1|3733652_3733892_-	DUF4754 family protein	NA	NA	NA	NA	NA
WP_049870930.1|3733904_3734117_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032737939.1|3734146_3734413_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042945462.1|3734494_3734794_+	helix-turn-helix transcriptional regulator	NA	Q1JS37	Enterobacteria_phage	56.2	1.0e-22
WP_071889443.1|3734858_3735854_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LBR0	Escherichia_phage	47.1	1.6e-80
WP_042946224.1|3735870_3736245_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042946225.1|3736345_3736537_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014229800.1|3736672_3737743_-	catabolic alanine racemase DadX	NA	NA	NA	NA	NA
WP_014229801.1|3737755_3739054_-	D-amino acid dehydrogenase	NA	NA	NA	NA	NA
WP_004138526.1|3739376_3740909_+	SpoVR family protein	NA	NA	NA	NA	NA
WP_014229802.1|3740969_3741689_-	fatty acid metabolism transcriptional regulator FadR	NA	NA	NA	NA	NA
WP_014838798.1|3741934_3743488_+	sodium/proton antiporter NhaB	NA	NA	NA	NA	NA
WP_014229804.1|3743616_3744147_+	disulfide bond formation protein DsbB	NA	NA	NA	NA	NA
WP_004103255.1|3744263_3744608_+	DUF1971 domain-containing protein	NA	NA	NA	NA	NA
WP_004851995.1|3744616_3745063_-	YcgN family cysteine cluster protein	NA	NA	NA	NA	NA
WP_004851997.1|3745157_3745817_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_004138522.1|3745834_3746116_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004852000.1|3746242_3746941_+	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_004103267.1|3746964_3747777_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_002910902.1|3747780_3748050_+	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_004852003.1|3748114_3749230_-	ribonuclease D	NA	NA	NA	NA	NA
WP_014229806.1|3749311_3750997_-	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	26.0	4.2e-33
WP_004852007.1|3751205_3751790_-	Slp family lipoprotein	NA	NA	NA	NA	NA
WP_004852009.1|3751833_3752529_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_014229807.1|3752596_3754507_-	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	32.9	4.2e-90
WP_004113724.1|3754639_3754984_+	RidA family protein	NA	NA	NA	NA	NA
WP_014229808.1|3755154_3756294_-	alginate lyase family protein	NA	NA	NA	NA	NA
WP_014229809.1|3756301_3757396_-	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G3M9Y6	Bacillus_virus	32.5	3.9e-24
3762115:3762137	attR	GCGCAATATCGCCACCGCCGCGC	NA	NA	NA	NA
>prophage 255
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	3764558	3765914	6152190		Pandoravirus(100.0%)	1	NA	NA
WP_032694111.1|3764558_3765914_+	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	41.3	2.7e-43
>prophage 256
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	3769758	3771318	6152190		Moraxella_phage(100.0%)	1	NA	NA
WP_004852040.1|3769758_3771318_-	CNNM family cation transport protein YoaE	NA	A0A0R6PEZ3	Moraxella_phage	44.0	6.6e-41
>prophage 257
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	3778754	3778964	6152190		Morganella_phage(100.0%)	1	NA	NA
WP_001062678.1|3778754_3778964_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
>prophage 258
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	3784216	3786265	6152190		Moraxella_phage(100.0%)	1	NA	NA
WP_014229824.1|3784216_3786265_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.1	4.4e-85
>prophage 259
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	3793733	3794387	6152190		Escherichia_phage(100.0%)	1	NA	NA
WP_014229829.1|3793733_3794387_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	52.1	1.7e-59
>prophage 260
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	3803636	3804605	6152190		Pectobacterium_phage(50.0%)	2	NA	NA
WP_004103351.1|3803636_3803867_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	58.8	1.3e-14
WP_014229839.1|3803945_3804605_+	exodeoxyribonuclease X	NA	A0A0H4IT92	Pseudoalteromonas_phage	32.8	2.6e-15
>prophage 261
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	3812059	3817733	6152190		Cyanophage(50.0%)	4	NA	NA
WP_004122041.1|3812059_3813535_-	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	36.8	3.7e-78
WP_161505349.1|3813860_3814766_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014229845.1|3814891_3816334_+	pyruvate kinase	NA	NA	NA	NA	NA
WP_014229846.1|3816398_3817733_-	2-hydroxycarboxylate transporter family protein	NA	A0A140XAH4	Dickeya_phage	62.9	1.2e-22
>prophage 262
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	3822755	3829096	6152190		Listeria_phage(25.0%)	7	NA	NA
WP_032750396.1|3822755_3824078_-	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	36.8	1.2e-14
WP_004852123.1|3824093_3825038_-	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_042945481.1|3825116_3825869_+	zinc ABC transporter ATP-binding protein ZnuC	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	32.0	2.3e-15
WP_042945483.1|3825868_3826654_+	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_004852130.1|3826862_3827873_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	26.6	8.1e-08
WP_004103390.1|3827881_3828493_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_014229855.1|3828574_3829096_-	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.6e-10
>prophage 263
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	3835466	3851579	6152190	tRNA,transposase	Erwinia_phage(16.67%)	17	NA	NA
WP_113706807.1|3835466_3837338_-	tape measure protein	NA	H1ZV07	Erwinia_phage	56.2	2.2e-184
WP_016947617.1|3837529_3838510_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	6.8e-185
WP_032667374.1|3838746_3839022_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158413320.1|3839021_3839165_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158413319.1|3839154_3839292_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042945489.1|3839293_3839845_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_154598168.1|3839902_3840052_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042945490.1|3840890_3841448_-	recombinase family protein	NA	M9Q1K0	Clostridium_phage	41.8	1.6e-26
WP_042945491.1|3841819_3842725_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042945494.1|3842756_3843659_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042945496.1|3843726_3845352_-	recombinase family protein	NA	Q9T193	Listeria_phage	24.1	1.2e-05
WP_004122068.1|3845805_3846201_+	membrane protein	NA	NA	NA	NA	NA
WP_009652021.1|3846240_3846984_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	29.1	1.5e-22
WP_004852151.1|3846980_3848003_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_014229858.1|3848226_3848970_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_014229859.1|3849046_3849616_-	VOC family protein	NA	NA	NA	NA	NA
WP_009652018.1|3849845_3851579_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.4	4.1e-84
>prophage 264
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	3858602	3860117	6152190		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_014229863.1|3858602_3860117_-	L-arabinose ABC transporter ATP-binding protein AraG	NA	A0A2R8FG22	Brazilian_cedratvirus	27.6	1.5e-10
>prophage 265
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	3872304	3875136	6152190		Klebsiella_phage(100.0%)	4	NA	NA
WP_042945506.1|3872304_3872853_-	recombinase family protein	NA	A0A286S1P7	Klebsiella_phage	90.0	7.3e-88
WP_042945509.1|3872928_3874701_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158650802.1|3874713_3874854_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042946229.1|3874878_3875136_-	hypothetical protein	NA	L0ARW5	Klebsiella_phage	49.4	3.2e-17
>prophage 266
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	3878493	3914743	6152190	integrase,head,tail	Pectobacterium_phage(25.93%)	46	3872072:3872131	3914863:3914930
3872072:3872131	attL	GCTTTATCCCAATGGTACCCGGAGCGGGACTTGAACCCGCACAGCGCGAACGCCGAGGGA	NA	NA	NA	NA
WP_042945513.1|3878493_3878835_-	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	56.6	2.9e-26
WP_042945515.1|3878831_3879299_-	lysozyme	NA	H9C148	Vibrio_phage	42.5	1.8e-26
WP_042945516.1|3879307_3879523_-	hypothetical protein	NA	A5LH82	Enterobacteria_phage	61.0	6.7e-13
WP_042945517.1|3879730_3880981_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042945518.1|3881176_3881389_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142395355.1|3881423_3882014_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042945521.1|3881970_3884895_-	hypothetical protein	NA	W6MWW8	Pseudomonas_phage	40.6	1.4e-193
WP_042945523.1|3884894_3886277_-	hypothetical protein	NA	W6MVE3	Pseudomonas_phage	29.1	2.3e-29
WP_042945527.1|3886581_3889296_-	lytic transglycosylase domain-containing protein	NA	K4NWI2	Pseudomonas_phage	26.3	1.6e-29
WP_042945529.1|3889305_3889800_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042946232.1|3889803_3890025_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071889445.1|3890234_3890516_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042945531.1|3890518_3890920_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042945532.1|3890912_3893189_-	hypothetical protein	NA	A0A221SAL7	Ralstonia_phage	27.6	9.9e-70
WP_042945535.1|3893188_3893794_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042945537.1|3893855_3894329_-	hypothetical protein	NA	A0A193GYT9	Enterobacter_phage	39.2	2.3e-13
WP_042945539.1|3894367_3895363_-	phage protein	NA	W6MW28	Pseudomonas_phage	59.9	1.0e-103
WP_042945540.1|3895373_3896126_-	hypothetical protein	NA	M1I7K2	Pelagibacter_phage	24.0	4.8e-05
WP_042945542.1|3896112_3896436_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042945543.1|3896438_3898103_-|head,tail	phage head-tail adapter protein	head,tail	A0A221SAN2	Ralstonia_phage	39.3	6.9e-105
WP_042945545.1|3898102_3899497_-	hypothetical protein	NA	A0A0H5ARR1	Pseudomonas_phage	46.4	6.1e-46
WP_042945547.1|3899581_3900034_-	phage packaging protein	NA	A3EYX3	Salmonella_phage	67.2	1.9e-49
WP_042945549.1|3900040_3900301_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042945551.1|3900284_3900518_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042945553.1|3900587_3900881_-	hypothetical protein	NA	G8C7W3	Escherichia_phage	72.2	7.5e-31
WP_042945555.1|3900877_3901234_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_071889446.1|3901221_3901545_-	DUF968 domain-containing protein	NA	A0A2H4FS95	Methylophilaceae_phage	52.9	3.7e-23
WP_042945557.1|3901534_3902131_-	DUF1367 family protein	NA	H9C173	Pectobacterium_phage	71.7	3.6e-80
WP_042945558.1|3902199_3902391_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042945561.1|3902573_3902912_-	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	81.1	1.5e-46
WP_042945563.1|3902913_3903687_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042945565.1|3903772_3904378_-	adenine methylase	NA	A0A2R9YJG0	Escherichia_phage	84.7	2.0e-94
WP_015365925.1|3904523_3904757_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042945568.1|3904760_3905429_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042946234.1|3905467_3906862_-	AAA family ATPase	NA	Q76H51	Enterobacteria_phage	46.7	2.4e-103
WP_049870931.1|3906870_3907815_-	helix-turn-helix domain-containing protein	NA	H9C164	Pectobacterium_phage	73.5	1.9e-35
WP_015365921.1|3907832_3907991_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015365920.1|3908074_3908521_-	hypothetical protein	NA	H9C162	Pectobacterium_phage	51.4	1.7e-26
WP_000364674.1|3908583_3908817_-	helix-turn-helix transcriptional regulator	NA	A0A0U2S629	Escherichia_phage	44.4	2.9e-09
WP_077255279.1|3908916_3909381_+	helix-turn-helix domain-containing protein	NA	A0A0U2QW76	Escherichia_phage	51.7	2.1e-35
WP_029602739.1|3910103_3910337_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042945578.1|3910381_3912535_+	hypothetical protein	NA	H9C157	Pectobacterium_phage	34.0	9.0e-97
WP_042945580.1|3912534_3913101_+	siphovirus Gp157 family protein	NA	H9C156	Pectobacterium_phage	63.0	3.6e-53
WP_015365915.1|3913102_3913288_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042945582.1|3913497_3913743_+	DUF4224 domain-containing protein	NA	H9C153	Pectobacterium_phage	40.0	8.2e-07
WP_015365913.1|3913726_3914743_+|integrase	tyrosine-type recombinase/integrase	integrase	H9C152	Pectobacterium_phage	64.2	3.7e-125
3914863:3914930	attR	GCTTTATCCCAATGGTACCCGGAGCGGGACTTGAACCCGCACAGCGCGAACGCCGAGGGATTTTAAAT	NA	NA	NA	NA
>prophage 267
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	3920182	3920935	6152190		Bacillus_virus(100.0%)	1	NA	NA
WP_032693583.1|3920182_3920935_-	L-cystine ABC transporter ATP-binding protein YecC	NA	G3M9Y6	Bacillus_virus	34.9	3.4e-27
>prophage 268
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	3927640	3939809	6152190		Burkholderia_phage(28.57%)	12	NA	NA
WP_042945586.1|3927640_3929308_-	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	36.1	2.7e-16
WP_025106102.1|3929415_3929595_-	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_004852222.1|3929670_3930582_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_042945588.1|3930765_3931677_+	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_014229886.1|3931651_3932146_-	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	50.0	1.4e-32
WP_032720332.1|3932126_3933560_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	53.0	4.6e-97
WP_014229888.1|3933616_3934312_-	phosphohydrolase	NA	S4W232	Pandoravirus	26.5	2.3e-06
WP_004852229.1|3934354_3934636_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025106098.1|3935263_3936334_+	porin	NA	Q1MVN1	Enterobacteria_phage	51.1	4.0e-90
WP_025106097.1|3936976_3937366_+	GtrA family protein	NA	NA	NA	NA	NA
WP_014229891.1|3937362_3938355_+	glycosyltransferase family 2 protein	NA	A8CG95	Salmonella_phage	39.5	1.3e-50
WP_042945591.1|3938351_3939809_+	glucosyl transferase GtrII family protein	NA	E5AGC8	Erwinia_phage	41.1	6.9e-101
>prophage 269
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	3946755	3954606	6152190		Acanthocystis_turfacea_Chlorella_virus(33.33%)	4	NA	NA
WP_014229900.1|3946755_3949443_-	cation-transporting P-type ATPase	NA	M1IAU8	Acanthocystis_turfacea_Chlorella_virus	27.8	1.1e-70
WP_014229901.1|3949493_3949925_-	universal stress protein	NA	A0A1W6JNV4	Morganella_phage	42.8	5.0e-23
WP_032750435.1|3950458_3951544_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_032750437.1|3951543_3954606_+	efflux RND transporter permease subunit	NA	S5VL66	Leptospira_phage	22.3	2.6e-25
>prophage 270
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	3965198	3966113	6152190		Lactobacillus_phage(100.0%)	1	NA	NA
WP_042945598.1|3965198_3966113_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	29.3	1.5e-08
>prophage 271
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	4010662	4015642	6152190		Stx2-converting_phage(50.0%)	3	NA	NA
WP_014230017.1|4010662_4011829_-	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	81.1	3.1e-184
WP_014230018.1|4012009_4013434_+	exodeoxyribonuclease I	NA	NA	NA	NA	NA
WP_042945634.1|4013539_4015642_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.5	3.1e-62
>prophage 272
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	4028698	4030756	6152190		uncultured_virus(50.0%)	2	NA	NA
WP_032719811.1|4028698_4029523_+	Fe-S cluster assembly protein NifU	NA	A0A218MKD1	uncultured_virus	45.1	9.5e-23
WP_042945641.1|4029553_4030756_+	cysteine desulfurase NifS	NA	Q2XUY6	environmental_halophage	28.8	2.6e-29
>prophage 273
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	4043279	4044179	6152190		Cellulophaga_phage(100.0%)	1	NA	NA
WP_014230042.1|4043279_4044179_+	ATP phosphoribosyltransferase	NA	A0A0F7Q4B0	Cellulophaga_phage	89.5	5.4e-11
>prophage 274
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	4049723	4071469	6152190		Tupanvirus(20.0%)	17	NA	NA
WP_004122447.1|4049723_4050323_+	bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE	NA	A0A1V0SIZ6	Klosneuvirus	34.2	1.5e-17
WP_042945655.1|4050406_4051726_-	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	36.0	9.6e-09
WP_162097176.1|4051857_4053003_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_042945658.1|4053003_4053897_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_042945659.1|4053893_4055048_-	UDP-galactopyranose mutase	NA	E4ZFQ1	Streptococcus_phage	40.9	4.0e-75
WP_014230052.1|4055066_4056959_-	DUF4422 domain-containing protein	NA	NA	NA	NA	NA
WP_014230053.1|4056972_4057713_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	24.8	1.5e-06
WP_004138730.1|4057712_4058480_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_042945661.1|4059785_4060790_+	NAD-dependent epimerase	NA	E3T4Y8	Cafeteria_roenbergensis_virus	29.2	2.3e-31
WP_004138729.1|4061262_4061385_+	small membrane protein	NA	NA	NA	NA	NA
WP_042945663.1|4061959_4063126_-	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.2	3.1e-112
WP_042946238.1|4063396_4064398_-	NAD-dependent epimerase	NA	A0A2K9L4U8	Tupanvirus	31.9	1.7e-34
WP_042945664.1|4064768_4066175_-	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.9	3.3e-39
WP_042945666.1|4066285_4067329_-	cellulase family glycosylhydrolase	NA	NA	NA	NA	NA
WP_042945668.1|4067437_4068580_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_042945670.1|4068657_4070034_-	phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	27.4	4.0e-34
WP_042945671.1|4070050_4071469_-	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	30.5	5.4e-50
>prophage 275
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	4086673	4093561	6152190		Bacillus_phage(25.0%)	5	NA	NA
WP_032719844.1|4086673_4087570_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	41.0	7.4e-45
WP_042945686.1|4088546_4090133_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	43.5	2.9e-36
WP_042945688.1|4090372_4092220_-	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
WP_004852489.1|4092247_4092829_-	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	42.6	1.3e-31
WP_004122537.1|4092919_4093561_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	38.3	1.7e-35
>prophage 276
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	4106452	4107427	6152190		Planktothrix_phage(100.0%)	1	NA	NA
WP_042945694.1|4106452_4107427_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.0	1.2e-19
>prophage 277
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	4125928	4134322	6152190	tRNA	Bacillus_phage(33.33%)	8	NA	NA
WP_042945701.1|4125928_4127464_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	27.6	2.8e-28
WP_014230101.1|4127460_4128183_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	32.7	2.4e-30
WP_014230102.1|4128500_4129862_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	91.8	4.7e-200
WP_162097204.1|4130103_4131000_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	28.9	8.8e-14
WP_014230103.1|4131000_4131471_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032693715.1|4131457_4132258_-	CadC family transcriptional regulator	NA	NA	NA	NA	NA
WP_014230105.1|4132674_4133448_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.7	7.8e-27
WP_014230106.1|4133458_4134322_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.5	3.9e-11
>prophage 278
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	4142956	4144324	6152190		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_032693709.1|4142956_4144324_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	28.3	1.2e-43
>prophage 279
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	4152399	4154376	6152190		Tetraselmis_virus(100.0%)	1	NA	NA
WP_042945705.1|4152399_4154376_+	MBL fold metallo-hydrolase	NA	A0A2P0VMX1	Tetraselmis_virus	45.5	3.1e-160
>prophage 280
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	4162839	4171855	6152190	tRNA	Enterobacteria_phage(60.0%)	9	NA	NA
WP_032693702.1|4162839_4164873_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.5	8.0e-55
WP_014230129.1|4165073_4165541_+	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_004852612.1|4165644_4166112_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	79.9	5.1e-66
WP_014230130.1|4166165_4166885_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_004852614.1|4166878_4168567_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	84.5	1.9e-259
WP_014839041.1|4168777_4169536_+	MerR family transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	69.8	4.7e-77
WP_004103838.1|4170098_4170212_+	protein YohO	NA	NA	NA	NA	NA
WP_014839042.1|4170186_4170924_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_014230133.1|4170907_4171855_-	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	6.2e-10
>prophage 281
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	4178428	4178983	6152190		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_004138576.1|4178428_4178983_+	N-acetyltransferase	NA	A0A2H4J136	uncultured_Caudovirales_phage	37.2	3.9e-20
>prophage 282
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	4183178	4183913	6152190		Streptococcus_phage(100.0%)	1	NA	NA
WP_038424721.1|4183178_4183913_+	class I SAM-dependent methyltransferase	NA	A0A1X9I6N4	Streptococcus_phage	41.6	3.7e-50
>prophage 283
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	4188399	4265249	6152190	plate,lysis,protease,tRNA,transposase	Salmonella_phage(13.33%)	68	NA	NA
WP_014230145.1|4188399_4189338_-|tRNA	tRNA dihydrouridine(16) synthase DusC	tRNA	NA	NA	NA	NA
WP_014839052.1|4189511_4190705_-	3-hydroxybenzoate 6-monooxygenase	NA	NA	NA	NA	NA
WP_032693695.1|4190713_4191358_-	maleylacetoacetate isomerase	NA	NA	NA	NA	NA
WP_014230148.1|4191366_4192065_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_014839053.1|4192088_4193126_-	gentisate 1,2-dioxygenase	NA	NA	NA	NA	NA
WP_032693694.1|4193137_4194496_-	aromatic acid/H+ symport family MFS transporter	NA	NA	NA	NA	NA
WP_004852655.1|4194622_4195540_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014230151.1|4195661_4196060_+	CidA/LrgA family protein	NA	NA	NA	NA	NA
WP_004122851.1|4196056_4196752_+|lysis	CidB/LrgB family autolysis modulator	lysis	NA	NA	NA	NA
WP_014839055.1|4196879_4197764_+	cytidine deaminase	NA	NA	NA	NA	NA
WP_004852661.1|4197888_4198605_+	outer membrane permeability protein SanA	NA	NA	NA	NA	NA
WP_004122861.1|4198796_4199807_-	galactose/methyl galactoside ABC transporter permease MglC	NA	NA	NA	NA	NA
WP_014230153.1|4199822_4201343_-	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	32.0	3.1e-11
WP_014230154.1|4201462_4202461_-	galactose/glucose ABC transporter substrate-binding protein MglB	NA	NA	NA	NA	NA
WP_014230155.1|4202750_4203773_-	HTH-type transcriptional regulator GalS	NA	NA	NA	NA	NA
WP_042945713.1|4203928_4205086_-	DUF418 family protein	NA	NA	NA	NA	NA
WP_004103895.1|4205101_4205770_-	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.8	6.9e-56
WP_042945714.1|4206138_4206975_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_032693692.1|4207094_4209068_-	catecholate siderophore receptor CirA	NA	A0A0P0I887	Acinetobacter_phage	35.8	8.1e-12
WP_004852681.1|4209371_4210841_-	amino acid permease	NA	NA	NA	NA	NA
WP_014839059.1|4211000_4211867_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014230161.1|4212040_4213090_+	YeiH family protein	NA	NA	NA	NA	NA
WP_032719905.1|4213186_4214044_+	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	30.4	1.5e-23
WP_014839060.1|4214045_4215137_+	sugar kinase	NA	NA	NA	NA	NA
WP_014230164.1|4215168_4216419_-	NupC/NupG family nucleoside CNT transporter	NA	NA	NA	NA	NA
WP_042945715.1|4216514_4217450_-	pseudouridine-5'-phosphate glycosidase	NA	NA	NA	NA	NA
WP_032719921.1|4217442_4218378_-	pseudouridine kinase	NA	NA	NA	NA	NA
WP_014230167.1|4218702_4220391_-	PTS fructose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_004103928.1|4220407_4221346_-	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_004852698.1|4221346_4222477_-	fused PTS fructose transporter subunit IIA/HPr protein	NA	NA	NA	NA	NA
WP_014230169.1|4222808_4223990_+	sugar efflux transporter SetB	NA	NA	NA	NA	NA
WP_014230170.1|4224014_4224266_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004122911.1|4224414_4224987_+	elongation factor P-like protein YeiP	NA	NA	NA	NA	NA
WP_042945717.1|4225270_4226737_+	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	30.1	6.6e-43
WP_014230172.1|4226855_4227833_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_025106743.1|4227868_4228582_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_004122922.1|4229008_4229578_+	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.9	5.2e-12
WP_014839070.1|4229768_4231331_+	cyclic di-GMP phosphodiesterase	NA	NA	NA	NA	NA
WP_032693731.1|4231401_4233207_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004122930.1|4233216_4234311_+	microcin C ABC transporter permease YejB	NA	NA	NA	NA	NA
WP_004852714.1|4234310_4235336_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_014230176.1|4235337_4236927_+	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	32.1	4.7e-18
WP_004122937.1|4236930_4237275_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014230177.1|4237605_4238802_-	Bcr/CflA family multidrug efflux MFS transporter	NA	S4TR35	Salmonella_phage	24.8	2.8e-23
WP_014230178.1|4238798_4239518_-	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_038424723.1|4239666_4241424_+	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	42.4	4.4e-102
WP_004114143.1|4241561_4241846_+	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_014230180.1|4241907_4242501_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_014230181.1|4242581_4243340_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_004122954.1|4243389_4244397_-	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	49.5	3.1e-84
WP_004133900.1|4244575_4244803_+	YejL family protein	NA	NA	NA	NA	NA
WP_014230182.1|4244822_4246583_+	DUF3413 domain-containing protein	NA	NA	NA	NA	NA
WP_014230183.1|4246855_4247050_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014230184.1|4247030_4247483_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_032693685.1|4247475_4248018_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_032693684.1|4247992_4249096_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_014839078.1|4249050_4250814_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_077255280.1|4251407_4252376_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	98.8	8.7e-185
WP_009653963.1|4252894_4254001_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_014230206.1|4254203_4254695_+|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
WP_014230207.1|4254739_4256374_-	malate dehydrogenase (quinone)	NA	NA	NA	NA	NA
WP_162763196.1|4256743_4257901_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	48.9	7.2e-77
WP_014230209.1|4257863_4259300_-	magnesium transporter	NA	NA	NA	NA	NA
WP_014230210.1|4259468_4261112_-	multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	22.6	1.2e-08
WP_014230211.1|4261188_4261839_-	DNA oxidative demethylase AlkB	NA	NA	NA	NA	NA
WP_014230212.1|4261838_4262903_-	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	L7Y5F8	Megavirus	47.2	1.4e-18
WP_014230213.1|4262975_4264028_-	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
WP_014230214.1|4264130_4265249_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	60.5	1.9e-119
>prophage 284
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	4269392	4283844	6152190	holin	Pseudomonas_phage(28.57%)	9	NA	NA
WP_014230216.1|4269392_4272239_-	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	26.3	3.4e-43
WP_014839094.1|4272369_4275003_-	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	30.7	6.2e-92
WP_014230217.1|4275188_4275917_+	bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG	NA	NA	NA	NA	NA
WP_014839096.1|4276261_4278547_+	ribonucleoside-diphosphate reductase subunit alpha	NA	I3UMG3	Colwellia_phage	63.9	3.5e-285
WP_042945722.1|4278650_4279781_+	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	78.6	4.8e-174
WP_004104002.1|4279780_4280035_+	2Fe-2S ferredoxin-like protein	NA	G9IAA2	Pseudomonas_phage	64.0	8.2e-26
WP_038424725.1|4280226_4281771_+|holin	glucose-methanol-choline oxidoreductase	holin	A0A1V0SI18	Klosneuvirus	28.2	6.8e-38
WP_042945723.1|4281815_4282772_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_042945725.1|4282776_4283844_-	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	42.9	3.9e-08
>prophage 285
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	4291700	4292906	6152190		Oenococcus_phage(100.0%)	1	NA	NA
WP_042945732.1|4291700_4292906_-	L-rhamnonate dehydratase	NA	Q6A202	Oenococcus_phage	28.0	6.7e-25
>prophage 286
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	4296011	4297460	6152190		Tupanvirus(100.0%)	1	NA	NA
WP_014230229.1|4296011_4297460_+	catalase	NA	A0A2K9L0T1	Tupanvirus	46.7	6.9e-101
>prophage 287
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	4320019	4320571	6152190	integrase	Escherichia_phage(100.0%)	1	4310074:4310087	4321609:4321622
4310074:4310087	attL	CGAGACCAGCCAGC	NA	NA	NA	NA
WP_014839116.1|4320019_4320571_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	51.6	2.1e-50
WP_014839116.1|4320019_4320571_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	51.6	2.1e-50
4321609:4321622	attR	CGAGACCAGCCAGC	NA	NA	NA	NA
>prophage 288
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	4339560	4340160	6152190		Salmonella_phage(100.0%)	1	NA	NA
WP_042945749.1|4339560_4340160_+	5'-deoxynucleotidase	NA	A0A2L0V156	Salmonella_phage	38.6	7.0e-07
>prophage 289
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	4351976	4352996	6152190		Enterobacteria_phage(100.0%)	1	NA	NA
WP_014230261.1|4351976_4352996_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	27.0	2.7e-19
>prophage 290
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	4357261	4359466	6152190		Salmonella_phage(66.67%)	4	NA	NA
WP_032720494.1|4357261_4357516_+	hypothetical protein	NA	J9Q735	Salmonella_phage	46.1	2.2e-10
WP_014230267.1|4357519_4358086_+	hypothetical protein	NA	J9Q7G7	Salmonella_phage	58.3	7.2e-46
WP_065365968.1|4358153_4358651_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_004852881.1|4358692_4359466_-	histidine ABC transporter ATP-binding protein HisP	NA	M1I0T9	Acanthocystis_turfacea_Chlorella_virus	29.7	3.9e-10
>prophage 291
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	4363759	4365277	6152190		Mollivirus(100.0%)	1	NA	NA
WP_004123211.1|4363759_4365277_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	44.0	5.4e-88
>prophage 292
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	4371696	4372833	6152190		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_009654654.1|4371696_4372833_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.1	1.5e-21
>prophage 293
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	4381246	4382335	6152190		Pandoravirus(100.0%)	1	NA	NA
WP_014230282.1|4381246_4382335_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	46.6	4.5e-89
>prophage 294
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	4391454	4396410	6152190		Enterobacteria_phage(33.33%)	5	NA	NA
WP_042945763.1|4391454_4392351_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	77.9	3.2e-125
WP_032720500.1|4392578_4392914_-	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_004852922.1|4393583_4393838_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042945765.1|4394433_4395297_+	hypothetical protein	NA	A0A1W6JPD1	Morganella_phage	24.8	3.4e-07
WP_014230296.1|4395477_4396410_-	transcriptional regulator CynR	NA	A0A2P0ZL89	Lactobacillus_phage	24.2	6.1e-10
>prophage 295
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	4401570	4402314	6152190		Clostridioides_phage(100.0%)	1	NA	NA
WP_042946242.1|4401570_4402314_+	response regulator transcription factor	NA	A0A2R2ZGH8	Clostridioides_phage	25.6	5.6e-14
>prophage 296
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	4420240	4430109	6152190		Lactobacillus_phage(25.0%)	9	NA	NA
WP_042945769.1|4420240_4421167_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	26.3	2.0e-08
WP_004852990.1|4421256_4422255_+	bile acid:sodium symporter	NA	NA	NA	NA	NA
WP_004123346.1|4422251_4422470_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032693084.1|4422462_4424487_-	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	42.1	6.8e-147
WP_032720511.1|4424561_4425575_-	cell division protein ZipA	NA	NA	NA	NA	NA
WP_042945771.1|4425805_4426567_+	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_004852997.1|4426726_4427698_+	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	51.0	4.3e-75
WP_002913505.1|4428079_4428337_+	phosphocarrier protein Hpr	NA	NA	NA	NA	NA
WP_032693091.1|4428381_4430109_+	phosphoenolpyruvate-protein phosphotransferase PtsI	NA	A0A1V0SGR7	Hokovirus	32.0	3.3e-17
>prophage 297
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	4434357	4442950	6152190		Streptococcus_phage(25.0%)	10	NA	NA
WP_014230319.1|4434357_4435269_-	cysteine synthase CysM	NA	A0A1X9I5F1	Streptococcus_phage	42.1	1.0e-57
WP_014230320.1|4435335_4436430_-	sulfate/thiosulfate ABC transporter ATP-binding protein CysA	NA	G9BWD6	Planktothrix_phage	38.5	1.4e-29
WP_014230321.1|4436419_4437295_-	sulfate/thiosulfate ABC transporter permease CysW	NA	NA	NA	NA	NA
WP_004123378.1|4437294_4438128_-	sulfate/thiosulfate ABC transporter permease CysT	NA	NA	NA	NA	NA
WP_014230322.1|4438127_4439144_-	thiosulfate/sulfate ABC transporter substrate-binding protein CysP	NA	NA	NA	NA	NA
WP_032693095.1|4439369_4440269_-	Dyp-type peroxidase	NA	S4VVJ7	Pandoravirus	32.6	1.9e-24
WP_014839169.1|4440362_4440938_-	RpoE-regulated lipoprotein	NA	NA	NA	NA	NA
WP_004853030.1|4441001_4441451_-	DUF2919 domain-containing protein	NA	NA	NA	NA	NA
WP_004853033.1|4441437_4441863_-	GNAT family acetyltransferase	NA	NA	NA	NA	NA
WP_004870750.1|4442074_4442950_+	N-acetylmuramoyl-L-alanine amidase AmiA	NA	A0A0N9SGH1	Paenibacillus_phage	32.4	7.5e-18
>prophage 298
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	4476798	4478499	6152190		Rhodococcus_phage(50.0%)	2	NA	NA
WP_014839185.1|4476798_4477665_-	neutral zinc metallopeptidase	NA	A0A1I9SA48	Rhodococcus_phage	34.5	9.7e-34
WP_004104417.1|4477785_4478499_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A127KMU1	Cyanophage	35.7	2.4e-38
>prophage 299
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	4485765	4487055	6152190		Enterobacteria_phage(100.0%)	1	NA	NA
WP_004853099.1|4485765_4487055_-	uracil permease	NA	Q9KX94	Enterobacteria_phage	37.1	9.2e-65
>prophage 300
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	4490558	4492234	6152190		Prochlorococcus_phage(100.0%)	2	NA	NA
WP_004853107.1|4490558_4491596_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	44.5	1.4e-71
WP_014230347.1|4491592_4492234_+	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	42.2	1.2e-28
>prophage 301
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	4504674	4504866	6152190		Escherichia_phage(100.0%)	1	NA	NA
WP_009654356.1|4504674_4504866_+	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	73.0	1.1e-17
>prophage 302
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	4508846	4511848	6152190		Klosneuvirus(50.0%)	2	NA	NA
WP_014230355.1|4508846_4510313_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.3	9.8e-87
WP_014230356.1|4510471_4511848_+	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	35.3	3.8e-40
>prophage 303
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	4523399	4523831	6152190		Powai_lake_megavirus(100.0%)	1	NA	NA
WP_004114414.1|4523399_4523831_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	38.6	1.7e-18
>prophage 304
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	4536002	4542361	6152190		Mycoplasma_phage(20.0%)	8	NA	NA
WP_014230371.1|4536002_4537289_-	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	38.6	3.4e-35
WP_004104502.1|4537396_4537597_-	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_004104503.1|4537598_4537934_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_014230372.1|4537935_4539786_-	Fe-S protein assembly chaperone HscA	NA	F2Y2E1	Organic_Lake_phycodnavirus	39.8	1.9e-103
WP_004104505.1|4539801_4540317_-	co-chaperone HscB	NA	NA	NA	NA	NA
WP_004104506.1|4540390_4540714_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	47.7	1.6e-21
WP_002913991.1|4540733_4541120_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	77.3	2.7e-52
WP_004134936.1|4541146_4542361_-	cysteine desulfurase	NA	A0A1X7C038	Faustovirus	32.6	1.6e-34
>prophage 305
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	4556683	4572317	6152190	tRNA	Bacillus_phage(33.33%)	12	NA	NA
WP_009654385.1|4556683_4557937_-	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	53.1	3.3e-99
WP_032693157.1|4558262_4559453_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_002914032.1|4559511_4559850_-	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_042945800.1|4559915_4561253_-	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	33.1	3.0e-10
WP_038424778.1|4561239_4561944_-	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_103433610.1|4561957_4563394_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	25.0	5.9e-12
WP_032720558.1|4563956_4567844_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	59.0	1.0e-130
WP_014839219.1|4568018_4569635_+	membrane-bound lytic murein transglycosylase MltF	NA	NA	NA	NA	NA
WP_071846082.1|4569631_4570177_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	S4VYT2	Pandoravirus	33.8	4.5e-05
WP_004853258.1|4570196_4570832_-	acid phosphatase AphA	NA	NA	NA	NA	NA
WP_014230398.1|4571041_4571890_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004114478.1|4572056_4572317_+	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	3.2e-17
>prophage 306
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	4575324	4579021	6152190		Micromonas_sp._RCC1109_virus(50.0%)	3	NA	NA
WP_004104573.1|4575324_4576005_-	ribonuclease III	NA	E5EQH1	Micromonas_sp._RCC1109_virus	33.5	2.8e-20
WP_014230401.1|4576231_4577206_-	signal peptidase I	NA	NA	NA	NA	NA
WP_004853275.1|4577221_4579021_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	26.3	6.5e-24
>prophage 307
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	4583925	4683463	6152190	head,plate,holin,lysis,portal,capsid,terminase,tail,tRNA,integrase,transposase	Escherichia_phage(27.59%)	103	4626510:4626525	4690971:4690986
WP_014839225.1|4583925_4584666_-|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_042945804.1|4584798_4586130_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	1.1e-44
WP_004104596.1|4586174_4586558_-	autonomous glycyl radical cofactor GrcA	NA	A0A193GZ98	Escherichia_phage	69.9	3.1e-32
WP_014230405.1|4586868_4587558_+	uracil-DNA glycosylase	NA	A0A077BCN4	Equid_alphaherpesvirus	51.2	4.6e-55
WP_038424783.1|4587673_4589002_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_004123719.1|4589052_4590126_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_004104599.1|4590329_4590755_+	thioredoxin TrxC	NA	A0A1J0GW78	Streptomyces_phage	40.2	4.6e-13
WP_014839228.1|4590824_4591523_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_038424785.1|4591558_4594237_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_014230410.1|4594330_4595686_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_038424787.1|4595725_4596052_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_038424788.1|4596054_4597353_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	31.5	1.8e-44
WP_032721880.1|4597626_4598082_-	DUF4385 domain-containing protein	NA	M4QHR1	Cyanophage	47.6	1.1e-31
WP_014226431.1|4603907_4606481_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.7	3.1e-128
WP_032720461.1|4606608_4607340_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_004853302.1|4607336_4608317_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_004853303.1|4608449_4609187_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_004104616.1|4609458_4609794_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_101706155.1|4609901_4609949_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004853306.1|4610055_4611216_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_014226433.1|4611212_4612085_-	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_014226434.1|4612153_4613275_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_014226435.1|4613284_4614355_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.8	4.8e-91
WP_004853313.1|4614699_4615209_+	YfiR family protein	NA	NA	NA	NA	NA
WP_014839238.1|4615201_4616425_+	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_014226437.1|4616436_4616919_+	OmpA family protein	NA	NA	NA	NA	NA
WP_032720460.1|4616923_4618294_-	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_014839240.1|4618348_4618786_-	DUF2946 domain-containing protein	NA	NA	NA	NA	NA
WP_040165600.1|4619002_4620052_-|integrase	site-specific integrase	integrase	A0A0M4S6G4	Salmonella_phage	92.8	3.1e-196
WP_042945807.1|4620079_4620484_-	hypothetical protein	NA	B9A7A8	Serratia_phage	40.2	1.3e-20
WP_042945809.1|4620491_4621337_-	phage repressor protein CI	NA	Q6K1G0	Salmonella_virus	65.2	1.4e-101
WP_042945810.1|4621458_4621833_+	regulatory phage cox family protein	NA	A0A0M4R4X7	Salmonella_phage	75.0	1.1e-45
WP_042945812.1|4621865_4622375_+	phage regulatory CII family protein	NA	Q6K1F8	Salmonella_virus	94.1	6.0e-84
WP_048335349.1|4622382_4622583_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	71.0	5.5e-17
WP_049870922.1|4622663_4622951_+	hypothetical protein	NA	F1BUS4	Erwinia_phage	57.0	2.3e-24
WP_023317536.1|4623016_4623241_+	DUF2732 domain-containing protein	NA	A0A218M4I9	Erwinia_phage	71.9	4.4e-15
WP_023317535.1|4623240_4623468_+	TraR/DksA family transcriptional regulator	NA	A0A0M4S5Q7	Salmonella_phage	77.8	8.1e-25
WP_042945815.1|4623464_4624046_+	3'-5' exonuclease	NA	A0A1S6L012	Salmonella_phage	77.7	2.6e-83
WP_014343385.1|4624042_4624315_+	DUF5405 family protein	NA	A0A218M4I8	Erwinia_phage	73.3	1.1e-31
WP_042945817.1|4624311_4624593_+	DUF3850 domain-containing protein	NA	A0A0P0I3U9	Klebsiella_phage	50.0	1.3e-11
WP_042945820.1|4624736_4626806_+	replication endonuclease	NA	A0A218M4H2	Erwinia_phage	93.0	0.0e+00
4626510:4626525	attL	ACGGCCCGACTCAGGG	NA	NA	NA	NA
WP_032419998.1|4626927_4627113_+	hypothetical protein	NA	A0A0M5M1G5	Salmonella_phage	77.0	6.0e-18
WP_019704250.1|4627116_4627347_+	DinI-like family protein	NA	A0A218M4I0	Erwinia_phage	77.6	2.7e-28
WP_042945821.1|4627786_4628821_-|portal	phage portal protein	portal	Q6K1J0	Salmonella_virus	81.5	2.0e-163
WP_042945823.1|4628820_4630590_-|terminase	terminase ATPase subunit family protein	terminase	A0A218M4M1	Erwinia_phage	80.8	5.5e-286
WP_042945825.1|4630754_4631618_+|capsid	GPO family capsid scaffolding protein	capsid	Q01088	Escherichia_phage	74.9	1.3e-118
WP_042945826.1|4631649_4632810_+|capsid	phage major capsid protein, P2 family	capsid	Q94MI3	Enterobacteria_phage	63.0	2.8e-129
WP_042945828.1|4632813_4633572_+|terminase	terminase endonuclease subunit	terminase	Q94MJ2	Enterobacteria_phage	64.9	2.1e-77
WP_042945830.1|4633667_4634174_+|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	84.6	2.9e-62
WP_042945832.1|4634173_4634377_+|tail	tail protein X	tail	A0A0F7LCN2	Escherichia_phage	79.1	2.8e-24
WP_009309693.1|4634381_4634672_+|holin	holin	holin	O80308	Escherichia_phage	84.7	9.1e-37
WP_042945833.1|4634658_4635156_+	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	87.3	7.9e-81
WP_019704240.1|4635152_4635584_+|lysis	LysB family phage lysis regulatory protein	lysis	O80310	Escherichia_phage	65.5	2.4e-41
WP_032427129.1|4635558_4635717_+	hypothetical protein	NA	A0A218M4L1	Erwinia_phage	74.0	3.8e-13
WP_042945835.1|4635679_4636147_+|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	73.5	1.0e-61
WP_042945836.1|4636139_4636589_+	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	68.7	1.4e-49
WP_042945838.1|4636657_4637293_+|plate	phage baseplate assembly protein V	plate	M1SV78	Escherichia_phage	84.4	4.5e-97
WP_042945839.1|4637289_4637637_+|plate	baseplate assembly protein	plate	Q7Y4D7	Escherichia_virus	76.5	5.4e-44
WP_042945841.1|4637641_4638550_+|plate	baseplate assembly protein	plate	F1BUP3	Erwinia_phage	72.2	8.9e-115
WP_042945842.1|4638542_4639139_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	51.3	3.9e-50
WP_049870923.1|4639144_4641250_+	hypothetical protein	NA	R9TMK5	Aeromonas_phage	40.2	5.9e-109
WP_042945845.1|4641252_4641507_+	hypothetical protein	NA	L0ARW5	Klebsiella_phage	50.6	1.0e-15
WP_042945847.1|4641560_4642721_+|tail	phage tail protein	tail	Q858V4	Yersinia_virus	49.3	6.0e-47
WP_042945849.1|4642830_4644012_+|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	86.1	3.9e-195
WP_014343412.1|4644025_4644541_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	75.6	3.2e-69
WP_004195711.1|4644600_4644876_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	77.3	2.4e-31
WP_014343413.1|4644908_4645028_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	92.3	2.0e-14
WP_042945852.1|4645020_4647459_+|tail	phage tail tape measure protein	tail	A0A0M3UL85	Salmonella_phage	83.1	8.4e-293
WP_019724795.1|4647470_4647950_+|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	77.7	1.4e-66
WP_042945854.1|4647949_4649107_+	phage late control D family protein	NA	Q7Y4C6	Escherichia_virus	80.9	2.9e-174
WP_019704610.1|4649183_4649402_+	DNA-binding transcriptional regulator	NA	Q37973	Salmonella_virus	84.7	1.0e-32
WP_004104634.1|4649552_4649900_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_004104636.1|4649939_4650707_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_014226441.1|4650752_4651301_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_004123777.1|4651319_4651568_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_004123779.1|4651804_4653172_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_004853326.1|4653336_4654128_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_014839241.1|4654146_4655436_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_004853330.1|4655500_4656091_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_004123797.1|4656216_4657095_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_014839242.1|4657181_4658843_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_160743520.1|4658868_4659009_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004123807.1|4658990_4659332_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_014226445.1|4659398_4659689_-	RnfH family protein	NA	NA	NA	NA	NA
WP_029946935.1|4659678_4660155_-	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_004104655.1|4660265_4660748_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	1.8e-29
WP_016157194.1|4661435_4662677_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	46.3	2.9e-100
WP_103433514.1|4663201_4664313_-|transposase	IS3 family transposase	transposase	A0A0N9SIX5	Staphylococcus_phage	29.7	5.4e-05
WP_103433604.1|4664804_4666184_+	SAVED domain-containing protein	NA	NA	NA	NA	NA
WP_103433603.1|4666290_4667472_+	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_077255295.1|4668135_4669176_+	ThiF family adenylyltransferase	NA	NA	NA	NA	NA
WP_103433602.1|4669241_4669742_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016157201.1|4669750_4670311_-	3'-5' exonuclease	NA	A0A2K9L1H6	Tupanvirus	28.0	1.0e-07
WP_071889451.1|4671131_4671569_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016157202.1|4671565_4672168_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087855188.1|4672720_4673871_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	41.5	5.4e-48
WP_016157204.1|4674983_4676702_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016157205.1|4676691_4677156_+	hypothetical protein	NA	NA	NA	NA	NA
WP_113706809.1|4677155_4678226_+	SAVED domain-containing protein	NA	NA	NA	NA	NA
WP_032931751.1|4678504_4679752_+|integrase	tyrosine-type recombinase/integrase	integrase	B7SYF8	Stenotrophomonas_phage	38.1	1.1e-67
WP_016157208.1|4680153_4680813_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_077255282.1|4680809_4682258_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_016947617.1|4682482_4683463_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	6.8e-185
4690971:4690986	attR	CCCTGAGTCGGGCCGT	NA	NA	NA	NA
>prophage 308
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	4690147	4690705	6152190		uncultured_Caudovirales_phage(100.0%)	2	NA	NA
WP_016157214.1|4690147_4690333_+	AlpA family transcriptional regulator	NA	A0A2H4J8C8	uncultured_Caudovirales_phage	52.0	9.6e-08
WP_016157214.1|4690519_4690705_+	AlpA family transcriptional regulator	NA	A0A2H4J8C8	uncultured_Caudovirales_phage	52.0	9.6e-08
>prophage 309
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	4702789	4704502	6152190	transposase	Escherichia_phage(50.0%)	2	NA	NA
WP_016947617.1|4702789_4703770_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	6.8e-185
WP_016157231.1|4704196_4704502_+	hypothetical protein	NA	A0A248SL90	Klebsiella_phage	37.8	4.6e-07
>prophage 310
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	4708648	4709593	6152190		Caulobacter_phage(100.0%)	1	NA	NA
WP_042945864.1|4708648_4709593_-	DUF1738 domain-containing protein	NA	A0A1V0EEV1	Caulobacter_phage	43.4	8.0e-58
>prophage 311
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	4725881	4729061	6152190		Feldmannia_irregularis_virus(100.0%)	1	NA	NA
WP_032694798.1|4725881_4729061_-	transporter substrate-binding domain-containing protein	NA	Q6XM27	Feldmannia_irregularis_virus	21.6	2.9e-19
>prophage 312
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	4737293	4738814	6152190		Planktothrix_phage(100.0%)	1	NA	NA
WP_042945875.1|4737293_4738814_+	amino acid ABC transporter permease/ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.3	2.9e-33
>prophage 313
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	4746184	4746826	6152190		Bacillus_virus(100.0%)	1	NA	NA
WP_042946246.1|4746184_4746826_-	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	G3M9Y6	Bacillus_virus	23.9	2.6e-12
>prophage 314
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	4749890	4750667	6152190		Mollivirus(100.0%)	1	NA	NA
WP_042945880.1|4749890_4750667_-	SDR family oxidoreductase	NA	A0A0M4JSW6	Mollivirus	26.2	3.2e-12
>prophage 315
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	4765935	4771226	6152190		Gordonia_phage(25.0%)	5	NA	NA
WP_004853449.1|4765935_4766181_+	glutaredoxin-like protein NrdH	NA	A0A0E3T8B5	Gordonia_phage	37.3	6.1e-10
WP_004104769.1|4766177_4766588_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	NA	NA	NA	NA
WP_042945896.1|4766560_4768705_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	48.0	2.0e-189
WP_014226498.1|4768715_4769678_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A0M4S3B4	Mycobacterium_phage	71.5	2.5e-131
WP_038424869.1|4770023_4771226_+	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	39.2	2.9e-28
>prophage 316
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	4786359	4794676	6152190	tRNA	Vibrio_phage(20.0%)	9	NA	NA
WP_000906486.1|4786359_4786545_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
WP_042945901.1|4786783_4789411_-|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	39.0	9.9e-82
WP_014226510.1|4789541_4790042_-	recombination regulator RecX	NA	NA	NA	NA	NA
WP_004104808.1|4790113_4791172_-	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	63.1	5.2e-114
WP_014226512.1|4791252_4791750_-	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	47.8	1.3e-27
WP_014226513.1|4791954_4792182_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014226514.1|4792218_4793097_-	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_014226515.1|4793105_4793969_-	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_162557671.1|4793965_4794676_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	23.1	6.3e-07
>prophage 317
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	4800253	4801219	6152190		Tetraselmis_virus(100.0%)	1	NA	NA
WP_014226519.1|4800253_4801219_+	arabinose-5-phosphate isomerase GutQ	NA	A0A2P0VNK5	Tetraselmis_virus	32.9	4.0e-36
>prophage 318
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	4841372	4842194	6152190		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_014226545.1|4841372_4842194_+	manganese/iron ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	27.4	2.6e-12
>prophage 319
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	4850163	4853496	6152190		Cedratvirus(33.33%)	3	NA	NA
WP_014839336.1|4850163_4850943_+	heme ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	27.8	1.3e-10
WP_014839337.1|4851134_4852388_-	2-dehydro-3-deoxy-6-phosphogalactonate aldolase	NA	Q6A202	Oenococcus_phage	30.9	1.0e-44
WP_042945945.1|4852728_4853496_+	SDR family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	28.3	8.3e-21
>prophage 320
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	4866326	4871538	6152190		Planktothrix_phage(66.67%)	3	NA	NA
WP_042945949.1|4866326_4868270_-	MacB family efflux pump subunit	NA	G9BWD6	Planktothrix_phage	39.9	1.7e-30
WP_042945951.1|4868269_4869430_-	efflux RND transporter periplasmic adaptor subunit	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
WP_014226570.1|4869426_4871538_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	30.2	6.9e-17
>prophage 321
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	4893681	4897872	6152190	integrase	Moraxella_phage(50.0%)	2	4886208:4886220	4896815:4896827
4886208:4886220	attL	AGCTCAGGAATAA	NA	NA	NA	NA
WP_024195068.1|4893681_4895145_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0R6PHE0	Moraxella_phage	27.6	1.9e-21
WP_032694732.1|4895304_4897872_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.5	3.9e-30
4896815:4896827	attR	TTATTCCTGAGCT	NA	NA	NA	NA
>prophage 322
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	4903981	4907759	6152190		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_004104962.1|4903981_4904974_-	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_042945975.1|4905133_4906255_-	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	34.6	6.5e-06
WP_009651549.1|4906377_4907004_-	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	51.2	2.4e-34
WP_042945976.1|4906997_4907759_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	52.0	7.6e-67
>prophage 323
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	4910832	4912865	6152190		Tupanvirus(50.0%)	2	NA	NA
WP_032720486.1|4910832_4911438_-	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	36.5	2.7e-27
WP_014226587.1|4911437_4912865_-	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	27.3	3.9e-32
>prophage 324
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	4921045	4922194	6152190		unidentified_phage(100.0%)	1	NA	NA
WP_038424896.1|4921045_4922194_-	cysteine desulfurase	NA	H7BUW1	unidentified_phage	38.3	2.3e-35
>prophage 325
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	4928865	4934190	6152190		Vibrio_phage(33.33%)	4	NA	NA
WP_004124321.1|4928865_4929537_-	7-carboxy-7-deazaguanine synthase QueE	NA	A0A2I7S8X1	Vibrio_phage	24.6	3.5e-15
WP_014839382.1|4929997_4931107_+	NAD-dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
WP_004105008.1|4931173_4932472_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	58.6	3.7e-130
WP_004105009.1|4932552_4934190_-	CTP synthase (glutamine hydrolyzing)	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	51.3	1.1e-155
>prophage 326
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	4937612	4943021	6152190		Erysipelothrix_phage(33.33%)	3	NA	NA
WP_014226597.1|4937612_4938956_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	26.6	1.4e-34
WP_042945982.1|4939078_4941832_+	two-component sensor histidine kinase BarA	NA	A0A1V0SGX0	Hokovirus	29.6	8.9e-49
WP_014226599.1|4941881_4943021_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	39.0	7.2e-45
>prophage 327
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	4950462	4951308	6152190		Vibrio_phage(100.0%)	1	NA	NA
WP_004853651.1|4950462_4951308_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	37.5	4.7e-41
>prophage 328
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	4963708	4964464	6152190		Bacillus_phage(100.0%)	1	NA	NA
WP_014226613.1|4963708_4964464_+	flap endonuclease Xni	NA	F8WQ40	Bacillus_phage	31.1	4.2e-09
>prophage 329
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	4975054	4976260	6152190		environmental_halophage(100.0%)	1	NA	NA
WP_032720169.1|4975054_4976260_+	cysteine desulfurase CsdA	NA	Q2XUY6	environmental_halophage	36.2	2.0e-69
>prophage 330
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	4984036	4984852	6152190		Amsacta_moorei_entomopoxvirus(100.0%)	1	NA	NA
WP_042945994.1|4984036_4984852_-	energy-coupling factor ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	23.8	1.9e-07
>prophage 331
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	5019056	5023746	6152190		Deep-sea_thermophilic_phage(50.0%)	3	NA	NA
WP_014226651.1|5019056_5020310_-	N-acetylmuramoyl-L-alanine amidase	NA	E5DV68	Deep-sea_thermophilic_phage	29.4	5.0e-15
WP_004853841.1|5020537_5021869_+	amino-acid N-acetyltransferase	NA	NA	NA	NA	NA
WP_038423517.1|5021910_5023746_-	exodeoxyribonuclease V subunit alpha	NA	A0A0K2FLP8	Brevibacillus_phage	24.2	2.2e-19
>prophage 332
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	5027284	5030170	6152190		Klosneuvirus(100.0%)	1	NA	NA
WP_042946007.1|5027284_5030170_-	pitrilysin	NA	A0A1V0SJA4	Klosneuvirus	23.8	2.0e-59
>prophage 333
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	5035644	5054640	6152190		Geobacillus_virus(16.67%)	16	NA	NA
WP_004124584.1|5035644_5036439_-	thymidylate synthase	NA	A6M9A2	Geobacillus_virus	72.0	2.6e-118
WP_014226659.1|5036445_5037321_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_014226660.1|5037616_5039863_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	22.9	1.5e-09
WP_004124593.1|5039875_5040406_-	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_038423524.1|5041088_5041784_+	DNA mismatch repair endonuclease MutH	NA	NA	NA	NA	NA
WP_004105253.1|5041865_5042579_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	46.8	1.0e-44
WP_004105255.1|5042703_5042922_+	YgdI/YgdR family lipoprotein	NA	NA	NA	NA	NA
WP_042946010.1|5043159_5044200_+	NADP(H)-dependent aldo-keto reductase	NA	NA	NA	NA	NA
WP_025107412.1|5044299_5045493_-	lysophospholipid transporter LplT	NA	NA	NA	NA	NA
WP_032694707.1|5045485_5047645_-	bifunctional acyl-ACP--phospholipid O-acyltransferase/long-chain-fatty-acid--ACP ligase	NA	A0A2H4PQU7	Staphylococcus_phage	25.4	4.9e-18
WP_014226665.1|5048267_5049284_+	HTH-type transcriptional regulator GalR	NA	NA	NA	NA	NA
WP_014226666.1|5049244_5049724_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_004105268.1|5049720_5050494_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_042946011.1|5050562_5051990_-	glycoside hydrolase family 1 protein	NA	A0A0B5JD41	Pandoravirus	27.5	1.0e-35
WP_014226668.1|5051997_5053335_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_162763199.1|5053638_5054640_+	substrate-binding domain-containing protein	NA	C6ZCU4	Enterobacteria_phage	29.6	9.8e-30
>prophage 334
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	5066034	5067162	6152190		Bacillus_phage(100.0%)	1	NA	NA
WP_014226681.1|5066034_5067162_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	23.9	3.9e-11
>prophage 335
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	5075274	5077766	6152190		Aichi_virus(50.0%)	2	NA	NA
WP_042946019.1|5075274_5076693_-	sugar porter family MFS transporter	NA	O13311	Aichi_virus	28.2	1.2e-25
WP_004124661.1|5077004_5077766_-	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.9	1.4e-20
>prophage 336
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	5108927	5112776	6152190		Acinetobacter_phage(50.0%)	4	NA	NA
WP_004124798.1|5108927_5110481_-	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	57.8	6.6e-158
WP_014226713.1|5110978_5111401_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042946027.1|5111668_5112022_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009654966.1|5112002_5112776_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.0	6.8e-23
>prophage 337
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	5120074	5121631	6152190		Catovirus(100.0%)	1	NA	NA
WP_014226721.1|5120074_5121631_+	acyl--CoA ligase	NA	A0A1V0SBX8	Catovirus	25.2	8.7e-17
>prophage 338
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	5128993	5130169	6152190		Streptococcus_phage(100.0%)	1	NA	NA
WP_032694028.1|5128993_5130169_+	glycerate kinase	NA	W6LM47	Streptococcus_phage	37.8	7.7e-42
>prophage 339
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	5135311	5137446	6152190		uncultured_Caudovirales_phage(100.0%)	3	NA	NA
WP_014839481.1|5135311_5135737_-	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.0	1.2e-50
WP_014839482.1|5135750_5137043_-	arsenite efflux transporter membrane subunit ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	72.8	7.4e-171
WP_014839483.1|5137095_5137446_-	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.4	1.3e-24
>prophage 340
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	5142735	5143416	6152190		Bacillus_phage(100.0%)	1	NA	NA
WP_014839488.1|5142735_5143416_+	heavy metal response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.0	1.7e-30
>prophage 341
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	5149407	5151395	6152190	transposase	Escherichia_phage(50.0%)	2	NA	NA
WP_000019441.1|5149407_5150388_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	2.3e-185
WP_032694017.1|5150543_5151395_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	38.9	6.8e-48
>prophage 342
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	5154402	5154654	6152190		Erwinia_phage(100.0%)	1	NA	NA
WP_038423574.1|5154402_5154654_+	DUF1471 domain-containing protein	NA	A0A1B2IE60	Erwinia_phage	53.8	1.0e-07
>prophage 343
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	5160527	5161739	6152190		Tupanvirus(100.0%)	1	NA	NA
WP_038423586.1|5160527_5161739_-	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L7I1	Tupanvirus	38.0	2.2e-68
>prophage 344
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	5164840	5167082	6152190	integrase	Enterobacteria_phage(50.0%)	2	5156666:5156679	5167882:5167895
5156666:5156679	attL	AAAACCGGCTTCCG	NA	NA	NA	NA
WP_038423595.1|5164840_5166037_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	59.6	6.4e-137
WP_004854045.1|5166356_5167082_-	peptidoglycan DD-metalloendopeptidase family protein	NA	I3PV79	Clostridium_phage	35.0	2.5e-11
5167882:5167895	attR	AAAACCGGCTTCCG	NA	NA	NA	NA
>prophage 345
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	5171739	5177822	6152190	tRNA	Catovirus(25.0%)	5	NA	NA
WP_004134430.1|5171739_5173257_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.5	7.7e-87
WP_100248296.1|5173266_5174365_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	3.1e-05
WP_038423602.1|5174450_5176184_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.9	2.1e-59
WP_004854054.1|5176189_5176903_-	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
WP_004105555.1|5176925_5177822_-	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	28.6	3.6e-31
>prophage 346
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	5190062	5195970	6152190		Pandoravirus(50.0%)	4	NA	NA
WP_042946034.1|5190062_5191496_+	6-phospho-beta-glucosidase BglA	NA	A0A0B5JD41	Pandoravirus	25.7	1.5e-31
WP_004854083.1|5191686_5192178_+	protein disulfide oxidoreductase	NA	NA	NA	NA	NA
WP_032720087.1|5192292_5193036_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_014226805.1|5193096_5195970_-	aminomethyl-transferring glycine dehydrogenase	NA	E3SN07	Prochlorococcus_phage	51.3	9.7e-264
>prophage 347
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	5204149	5205382	6152190		Catovirus(100.0%)	1	NA	NA
WP_004115297.1|5204149_5205382_-	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	48.9	1.4e-102
>prophage 348
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	5222875	5223532	6152190		Bacillus_virus(100.0%)	1	NA	NA
WP_032693819.1|5222875_5223532_+	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	25.4	5.3e-08
>prophage 349
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	5230808	5231963	6152190		Staphylococcus_phage(100.0%)	1	NA	NA
WP_014226830.1|5230808_5231963_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.4	8.1e-129
>prophage 350
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	5249980	5251063	6152190		Geobacillus_virus(100.0%)	1	NA	NA
WP_103433509.1|5249980_5251063_+	membrane-bound lytic murein transglycosylase MltC	NA	A0A0H3V0Q1	Geobacillus_virus	38.1	3.8e-11
>prophage 351
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	5258449	5259820	6152190		Streptococcus_phage(100.0%)	1	NA	NA
WP_014839553.1|5258449_5259820_+	pyridoxal-phosphate dependent enzyme	NA	A0A1X9I5F1	Streptococcus_phage	35.4	4.3e-44
>prophage 352
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	5278981	5281491	6152190		Staphylococcus_phage(33.33%)	3	NA	NA
WP_014226865.1|5278981_5279809_+	2,5-didehydrogluconate reductase DkgA	NA	A0A2H4PQR8	Staphylococcus_phage	43.2	4.2e-63
WP_014226866.1|5279907_5280363_+	HIT family protein	NA	Q5YEY9	Rock_bream_iridovirus	36.8	3.8e-21
WP_077255285.1|5280456_5281491_-	DUF3362 domain-containing protein	NA	M1QSD9	Pseudomonas_phage	70.4	2.1e-104
>prophage 353
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	5285188	5287956	6152190	transposase	Salmonella_phage(50.0%)	3	NA	NA
WP_031942297.1|5285188_5286157_-|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	99.1	1.5e-184
WP_042946050.1|5286174_5286738_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087855188.1|5286805_5287956_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	41.5	5.4e-48
>prophage 354
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	5293291	5294401	6152190		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_017384070.1|5293291_5294401_+	S-(hydroxymethyl)glutathione dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	28.7	2.2e-30
>prophage 355
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	5297854	5303989	6152190		Pseudomonas_phage(50.0%)	2	NA	NA
WP_001189111.1|5297854_5299363_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.6e-44
WP_012561117.1|5301337_5303989_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	34.1	5.4e-152
>prophage 356
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	5326380	5330116	6152190		Bacillus_virus(50.0%)	3	NA	NA
WP_014226868.1|5326380_5328639_-	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	35.1	5.7e-86
WP_009651841.1|5328761_5329631_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_014839568.1|5329708_5330116_-	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	52.2	1.5e-21
>prophage 357
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	5333407	5335303	6152190		Bacillus_virus(100.0%)	1	NA	NA
WP_004854242.1|5333407_5335303_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	35.9	1.4e-90
>prophage 358
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	5339625	5341460	6152190		Erwinia_phage(50.0%)	2	NA	NA
WP_004125303.1|5339625_5340294_+	DUF1190 family protein	NA	A0A173GEW8	Erwinia_phage	48.1	4.7e-36
WP_014226876.1|5340299_5341460_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	44.2	4.8e-89
>prophage 359
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	5348792	5352076	6152190		Staphylococcus_phage(50.0%)	4	NA	NA
WP_004854262.1|5348792_5349446_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	43.3	1.2e-44
WP_004854265.1|5349823_5350105_+	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_004854266.1|5350159_5350369_-	cell surface composition regulator GlgS	NA	NA	NA	NA	NA
WP_014226884.1|5350642_5352076_-	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	29.8	5.1e-40
>prophage 360
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	5357186	5358428	6152190		Sinorhizobium_phage(100.0%)	1	NA	NA
WP_014226887.1|5357186_5358428_+	multifunctional CCA addition/repair protein	NA	A0A0F6YPT7	Sinorhizobium_phage	51.6	2.7e-90
>prophage 361
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	5367612	5373303	6152190	tRNA	Moraxella_phage(33.33%)	4	NA	NA
WP_014839584.1|5367612_5368626_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	58.9	5.3e-108
WP_001144069.1|5368989_5369205_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_014226898.1|5369439_5371185_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	39.0	4.1e-76
WP_004105908.1|5371458_5373303_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.4e-35
>prophage 362
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	5386382	5392702	6152190	tRNA	Klosneuvirus(50.0%)	4	NA	NA
WP_004854393.1|5386382_5387762_+	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	28.2	9.0e-34
WP_014226909.1|5387799_5388132_-|tRNA	tRNA-binding protein	tRNA	NA	NA	NA	NA
WP_014226910.1|5388351_5389335_+	transcriptional regulator EbgR	NA	NA	NA	NA	NA
WP_042946060.1|5389609_5392702_+	beta-galactosidase subunit alpha	NA	L0N6M2	Herpes_simplex_virus	33.7	4.8e-160
>prophage 363
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	5404066	5405554	6152190		Staphylococcus_phage(100.0%)	1	NA	NA
WP_014226925.1|5404066_5405554_-	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	24.2	1.2e-10
>prophage 364
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	5417958	5418927	6152190		Escherichia_phage(100.0%)	1	NA	NA
WP_032751374.1|5417958_5418927_+	TerC family protein	NA	A0A291LBC5	Escherichia_phage	34.9	1.0e-39
>prophage 365
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	5435163	5436309	6152190		Streptococcus_phage(100.0%)	1	NA	NA
WP_014226948.1|5435163_5436309_-	glycerate 2-kinase	NA	W6LM47	Streptococcus_phage	38.6	2.2e-46
>prophage 366
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	5441577	5442387	6152190		Escherichia_phage(100.0%)	1	NA	NA
WP_025108325.1|5441577_5442387_-	DeoR family transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.5	2.5e-28
>prophage 367
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	5452025	5460341	6152190		Streptococcus_phage(20.0%)	11	NA	NA
WP_009651852.1|5452025_5452886_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	47.2	2.1e-49
WP_038423727.1|5452949_5455031_+	penicillin-binding protein activator	NA	NA	NA	NA	NA
WP_038423729.1|5454988_5455375_+	YraN family protein	NA	NA	NA	NA	NA
WP_002918211.1|5455397_5455988_+	DnaA initiator-associating protein DiaA	NA	A0A067XQR2	Caulobacter_phage	31.8	5.4e-12
WP_004125578.1|5455997_5456573_+	divisome-associated lipoprotein YraP	NA	NA	NA	NA	NA
WP_038423731.1|5456680_5457721_-	permease	NA	NA	NA	NA	NA
WP_032693255.1|5457790_5458441_-	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_004854517.1|5458569_5459088_+	type 1 glutamine amidotransferase	NA	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	29.0	2.4e-11
WP_014226969.1|5459067_5459511_-	YhbP family protein	NA	NA	NA	NA	NA
WP_014226970.1|5459566_5459851_+	GIY-YIG nuclease family protein	NA	A0A120L170	Cnaphalocrocis_medinalis_granulovirus	50.6	5.8e-12
WP_032693256.1|5459837_5460341_-	N-acetyltransferase	NA	A0A1P8CWJ6	Bacillus_phage	32.7	1.7e-14
>prophage 368
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	5465535	5467497	6152190		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_014839626.1|5465535_5467497_-	DEAD/DEAH family ATP-dependent RNA helicase	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	31.0	4.7e-52
>prophage 369
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	5472896	5484537	6152190	protease	Cafeteria_roenbergensis_virus(25.0%)	8	NA	NA
WP_004106093.1|5472896_5475587_-	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	26.6	3.9e-25
WP_004854539.1|5475611_5477099_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_004125659.1|5477126_5477579_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_004106101.1|5478170_5479514_+	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	94.4	1.6e-64
WP_004106103.1|5479766_5480096_-	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_014226977.1|5480325_5481663_-	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_014226978.1|5481655_5482504_-	dihydropteroate synthase	NA	S4VNV0	Pandoravirus	31.0	3.7e-22
WP_004854549.1|5482602_5484537_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	G8DDJ2	Micromonas_pusilla_virus	43.5	9.2e-117
>prophage 370
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	5491125	5492567	6152190		Indivirus(50.0%)	2	NA	NA
WP_004854564.1|5491125_5492097_+	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	25.4	1.3e-07
WP_004854566.1|5492294_5492567_+	DNA-binding transcriptional regulator SfsB	NA	A0A2I7S995	Vibrio_phage	68.3	1.3e-16
>prophage 371
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	5496626	5510609	6152190		Staphylococcus_phage(28.57%)	16	NA	NA
WP_004125691.1|5496626_5497439_-	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	29.8	6.3e-19
WP_004854581.1|5497648_5498626_+	calcium/sodium antiporter	NA	NA	NA	NA	NA
WP_160741439.1|5498622_5499627_+	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	32.2	3.6e-40
WP_004854584.1|5499641_5500208_+	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	82.8	1.3e-58
WP_042946069.1|5500204_5500780_+	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_004125703.1|5500748_5501294_+	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_004125705.1|5501300_5502026_+	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.9	9.3e-22
WP_004854591.1|5502073_5503507_+	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_004106167.1|5503529_5503817_+	ribosome hibernation promoting factor	NA	NA	NA	NA	NA
WP_004854593.1|5503882_5504371_+	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_004106169.1|5504416_5505271_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.4	1.4e-05
WP_004106170.1|5505267_5505540_+	PTS phosphocarrier protein NPr	NA	NA	NA	NA	NA
WP_014226984.1|5505592_5506318_-	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
WP_014226985.1|5506314_5506968_-	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_014226986.1|5507202_5509542_-	aerobic respiration two-component sensor histidine kinase ArcB	NA	A0A1V0SGX0	Hokovirus	31.1	6.0e-38
WP_032693264.1|5509673_5510609_-	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	33.3	2.9e-15
>prophage 372
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	5519317	5523313	6152190	protease	Burkholderia_virus(50.0%)	4	NA	NA
WP_032693265.1|5519317_5520805_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	23.9	1.3e-09
WP_014839641.1|5520911_5521805_-	N-acetylneuraminate lyase	NA	NA	NA	NA	NA
WP_032693266.1|5521924_5522731_-	transcriptional regulator NanR	NA	NA	NA	NA	NA
WP_014226996.1|5522824_5523313_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	54.7	4.9e-27
>prophage 373
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	5527217	5528585	6152190	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_042946070.1|5527217_5528585_+|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	24.5	1.5e-20
>prophage 374
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	5535637	5536906	6152190		Oenococcus_phage(100.0%)	1	NA	NA
WP_032694499.1|5535637_5536906_-	SLC13/DASS family transporter	NA	Q6A201	Oenococcus_phage	33.7	3.0e-60
>prophage 375
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	5555799	5556843	6152190		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_002918653.1|5555799_5556843_-	rod shape-determining protein MreB	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
>prophage 376
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	5585749	5587221	6152190	tRNA	Synechococcus_phage(50.0%)	2	NA	NA
WP_004854751.1|5585749_5586259_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	41.1	6.7e-19
WP_025107519.1|5586273_5587221_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	37.8	1.7e-07
>prophage 377
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	5607102	5612674	6152190		Tupanvirus(33.33%)	7	NA	NA
WP_004097636.1|5607102_5608287_-	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	27.2	8.9e-14
WP_004115957.1|5608357_5610472_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.2	6.2e-58
WP_004106370.1|5610568_5611039_-	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_002920115.1|5611134_5611509_-	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_025107828.1|5611633_5611921_-	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
WP_004854839.1|5611928_5612288_-	sulfurtransferase complex subunit TusC	NA	NA	NA	NA	NA
WP_014227040.1|5612287_5612674_-	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	39.8	1.2e-20
>prophage 378
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	5618303	5631155	6152190		Tupanvirus(14.29%)	12	NA	NA
WP_004854860.1|5618303_5620208_+	ABC transporter ATP-binding protein	NA	A0A2K9L0W2	Tupanvirus	33.1	3.8e-75
WP_032693747.1|5620269_5621760_-	nicotinate phosphoribosyltransferase	NA	K4F7Y4	Cronobacter_phage	49.9	9.1e-141
WP_032693737.1|5621764_5622634_-	ribose-phosphate pyrophosphokinase	NA	A0A2P1CBA5	Salmonella_phage	41.3	2.4e-48
WP_032693738.1|5622830_5623550_+	NUDIX hydrolase	NA	G3MA14	Bacillus_virus	27.3	7.3e-19
WP_160741663.1|5623655_5624654_+	hydrolase	NA	NA	NA	NA	NA
WP_004125965.1|5624650_5624869_+	YheU family protein	NA	A0A2H4J8A7	uncultured_Caudovirales_phage	38.8	4.0e-05
WP_004854874.1|5624904_5625777_+	phosphoribulokinase	NA	NA	NA	NA	NA
WP_004854875.1|5625820_5626225_-	OsmC family protein	NA	NA	NA	NA	NA
WP_000242758.1|5626529_5627162_+	cAMP-activated global transcriptional regulator CRP	NA	NA	NA	NA	NA
WP_014839675.1|5627213_5629292_+	membrane protein	NA	H9YQA8	environmental_Halophage	86.2	1.8e-62
WP_014839676.1|5629281_5630502_-	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_014227049.1|5630591_5631155_-	aminodeoxychorismate synthase component 2	NA	A0A0P0IKJ1	Acinetobacter_phage	57.1	4.3e-59
>prophage 379
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	5643470	5644298	6152190		Vibrio_phage(100.0%)	1	NA	NA
WP_014227055.1|5643470_5644298_-	adenine-specific DNA-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	51.1	1.2e-70
>prophage 380
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	5659232	5665410	6152190		Staphylococcus_phage(50.0%)	3	NA	NA
WP_014227066.1|5659232_5660855_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	52.9	4.5e-141
WP_014227067.1|5660915_5663009_-	4-alpha-glucanotransferase	NA	NA	NA	NA	NA
WP_042946078.1|5663019_5665410_-	maltodextrin phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	41.4	1.2e-14
>prophage 381
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	5668900	5669659	6152190		Escherichia_phage(100.0%)	1	NA	NA
WP_004106478.1|5668900_5669659_-	DeoR/GlpR family transcriptional regulator	NA	A0A077SK06	Escherichia_phage	31.6	3.0e-23
>prophage 382
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	5672670	5675118	6152190		Dickeya_phage(100.0%)	1	NA	NA
WP_014227071.1|5672670_5675118_-	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	83.3	1.6e-33
>prophage 383
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	5692813	5694621	6152190		Enterococcus_phage(50.0%)	2	NA	NA
WP_014227082.1|5692813_5693554_-	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	26.1	3.1e-12
WP_025107858.1|5693550_5694621_-	sn-glycerol-3-phosphate import ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	34.7	2.6e-20
>prophage 384
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	5702959	5704458	6152190		Anomala_cuprea_entomopoxvirus(100.0%)	2	NA	NA
WP_103433599.1|5702959_5703673_-	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivF	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	26.0	7.2e-11
WP_004855045.1|5703690_5704458_-	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.6	4.4e-14
>prophage 385
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	5712978	5718739	6152190		Klosneuvirus(25.0%)	5	NA	NA
WP_014839711.1|5712978_5714244_-	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.9	3.7e-26
WP_014839712.1|5714361_5715876_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	26.9	1.5e-13
WP_004106554.1|5715908_5716763_-	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	41.7	7.0e-45
WP_025106848.1|5717019_5718078_-	cell division protein FtsX	NA	NA	NA	NA	NA
WP_004106557.1|5718070_5718739_-	cell division ATP-binding protein FtsE	NA	A0A2H4PQG7	Staphylococcus_phage	27.6	9.5e-13
>prophage 386
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	5721832	5725898	6152190		Dickeya_phage(50.0%)	4	NA	NA
WP_004855080.1|5721832_5722459_+	lysoplasmalogenase	NA	A0A140XAH6	Dickeya_phage	62.8	5.5e-31
WP_042946082.1|5722537_5724742_+	Zn(II)/Cd(II)/Pb(II) translocating P-type ATPase ZntA	NA	E4ZFI9	Streptococcus_phage	36.8	9.4e-118
WP_004106582.1|5724820_5725066_-	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	83.3	6.1e-10
WP_004126198.1|5725232_5725898_+	7-cyano-7-deazaguanine/7-aminomethyl-7- deazaguanine transporter	NA	A0A2I7SAW6	Vibrio_phage	55.8	6.2e-57
>prophage 387
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	5748436	5752543	6152190		Tupanvirus(66.67%)	3	NA	NA
WP_014227124.1|5748436_5750422_-	bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA	NA	A0A2K9KZK0	Tupanvirus	25.7	1.6e-20
WP_004126208.1|5750418_5751402_-	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase ArnC	NA	A8CG95	Salmonella_phage	32.7	2.8e-37
WP_004855110.1|5751403_5752543_-	UDP-4-amino-4-deoxy-L-arabinose aminotransferase	NA	A0A2K9L0G1	Tupanvirus	27.2	2.3e-27
>prophage 388
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	5759096	5759867	6152190		Bacillus_virus(100.0%)	1	NA	NA
WP_032694213.1|5759096_5759867_+	nickel import ATP-binding protein NikE	NA	G3M9Y6	Bacillus_virus	29.9	2.5e-17
>prophage 389
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	5763034	5763988	6152190		Cedratvirus(100.0%)	1	NA	NA
WP_025106833.1|5763034_5763988_+	hydroxyacid dehydrogenase	NA	A0A285PXZ1	Cedratvirus	33.9	5.6e-35
>prophage 390
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	5776171	5778214	6152190		Indivirus(100.0%)	1	NA	NA
WP_032719958.1|5776171_5778214_-	oligopeptidase A	NA	A0A1V0SD92	Indivirus	22.9	2.2e-44
>prophage 391
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	5789193	5791271	6152190		Bacillus_phage(100.0%)	2	NA	NA
WP_001157751.1|5789193_5789913_+	two-component system response regulator OmpR	NA	W8CYM9	Bacillus_phage	34.7	3.5e-29
WP_004855221.1|5789909_5791271_+	two-component system sensor histidine kinase EnvZ	NA	W8CYF6	Bacillus_phage	23.6	1.3e-11
>prophage 392
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	5822076	5823189	6152190	transposase	Phage_Gifsy-1(100.0%)	1	NA	NA
WP_032694189.1|5822076_5823189_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q9G0F2	Phage_Gifsy-1	88.6	9.4e-191
>prophage 393
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	5839767	5845979	6152190		Paramecium_bursaria_Chlorella_virus(33.33%)	5	NA	NA
WP_049870926.1|5839767_5841879_-	UDP-forming cellulose synthase catalytic subunit	NA	M1I277	Paramecium_bursaria_Chlorella_virus	33.9	5.6e-35
WP_014227183.1|5841899_5842703_-	cellulose synthase operon protein YhjQ	NA	NA	NA	NA	NA
WP_032694180.1|5842693_5843272_-	cellulose biosynthesis protein BcsO	NA	NA	NA	NA	NA
WP_014227185.1|5843985_5844999_-	dipeptide ABC transporter ATP binding subunit DppF	NA	G3M9Y6	Bacillus_virus	29.4	2.5e-17
WP_032694179.1|5844995_5845979_-	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.5	1.1e-14
>prophage 394
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	5863576	5864548	6152190		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_009652700.1|5863576_5864548_+	glyoxylate/hydroxypyruvate reductase GhrB	NA	M1HST2	Paramecium_bursaria_Chlorella_virus	26.5	1.4e-17
>prophage 395
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	5867906	5869838	6152190		Morganella_phage(50.0%)	2	NA	NA
WP_004126446.1|5867906_5868119_+	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	71.4	6.0e-22
WP_042946105.1|5868218_5869838_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2I4R674	Erysipelothrix_phage	25.7	2.1e-26
>prophage 396
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	5874225	5875221	6152190		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_032692958.1|5874225_5875221_+	acyltransferase	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	24.2	6.6e-10
>prophage 397
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	5880162	5881704	6152190		Staphylococcus_phage(100.0%)	1	NA	NA
WP_004855381.1|5880162_5881704_+	xylose ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	31.2	1.0e-17
>prophage 398
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	5903300	5905142	6152190		Tupanvirus(100.0%)	1	NA	NA
WP_042946113.1|5903300_5905142_-	selenocysteine-specific translation elongation factor	NA	A0A2K9KZ60	Tupanvirus	25.1	4.5e-12
>prophage 399
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	5921395	5930543	6152190		Rhizobium_phage(20.0%)	9	NA	NA
WP_004106850.1|5921395_5921647_-	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	53.4	7.6e-16
WP_004126582.1|5921758_5922190_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_014227235.1|5922435_5923980_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_025107808.1|5923989_5925261_+	murein hydrolase activator EnvC	NA	G9BW84	Planktothrix_phage	33.9	2.1e-08
WP_038423860.1|5925264_5926200_+	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_014227237.1|5926196_5926994_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_004855475.1|5927155_5928181_-	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	82.7	1.0e-18
WP_014227238.1|5928190_5929384_-	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	29.3	1.7e-36
WP_014227239.1|5929598_5930543_+	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	36.1	8.6e-36
>prophage 400
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	5943405	5948144	6152190		uncultured_Mediterranean_phage(25.0%)	7	NA	NA
WP_004106901.1|5943405_5943882_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	42.7	2.4e-26
WP_014227251.1|5944005_5944815_-	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	F8WPX6	Bacillus_phage	31.6	3.8e-24
WP_003024094.1|5945014_5945182_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_002436699.1|5945202_5945439_-	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_004126657.1|5945655_5946321_-	JAB domain-containing protein	NA	NA	NA	NA	NA
WP_042946116.1|5946493_5947708_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	35.5	3.8e-44
WP_004855506.1|5947685_5948144_+	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	58.8	2.4e-47
>prophage 401
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	5953711	5958738	6152190		Pseudomonas_phage(33.33%)	4	NA	NA
WP_038423865.1|5953711_5955388_-	NAD-dependent DNA ligase LigB	NA	F8SJM3	Pseudomonas_phage	22.9	2.1e-21
WP_004106926.1|5955645_5956269_+	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	36.2	3.3e-20
WP_004106927.1|5956323_5956599_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_004855514.1|5956617_5958738_+	bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase	NA	A0A291L9W9	Bordetella_phage	34.5	2.8e-10
>prophage 402
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	5969826	5970678	6152190		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_004855525.1|5969826_5970678_+	aquaporin	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.6	1.3e-14
>prophage 403
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	5974529	5975921	6152190		environmental_Halophage(100.0%)	1	NA	NA
WP_004855527.1|5974529_5975921_+	uracil-xanthine permease	NA	H9YQ34	environmental_Halophage	95.9	1.6e-67
>prophage 404
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	5994207	5995374	6152190	integrase	Enterobacteria_phage(100.0%)	1	5992800:5992812	5998186:5998198
5992800:5992812	attL	GGTGAGCGGCTTC	NA	NA	NA	NA
WP_042946124.1|5994207_5995374_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	89.4	3.7e-206
WP_042946124.1|5994207_5995374_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	89.4	3.7e-206
5998186:5998198	attR	GGTGAGCGGCTTC	NA	NA	NA	NA
>prophage 405
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	5998601	6011158	6152190		Enterobacteria_phage(75.0%)	17	NA	NA
WP_042946127.1|5998601_5999168_-	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	64.9	3.3e-59
WP_004136116.1|5999185_5999431_-	hypothetical protein	NA	Q7M294	Enterobacteria_phage	58.0	1.9e-19
WP_042946128.1|5999427_6000165_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	60.2	1.5e-72
WP_015585920.1|6000725_6000992_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	70.5	1.3e-29
WP_162763200.1|6000994_6001540_+	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	74.1	1.0e-36
WP_004098168.1|6001536_6001764_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004185276.1|6001760_6002081_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_042946129.1|6002095_6004429_+	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	81.3	0.0e+00
WP_042946130.1|6005168_6005897_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023321787.1|6005913_6006105_-	toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_042946131.1|6006231_6006519_+	type I addiction module toxin, SymE family	NA	NA	NA	NA	NA
WP_077255288.1|6006643_6007237_+	hypothetical protein	NA	Q9JMN3	Wolbachia_phage	45.7	3.7e-37
WP_042946132.1|6007264_6007870_-	shikimate kinase	NA	NA	NA	NA	NA
WP_032718838.1|6008057_6008525_+	DUF3237 domain-containing protein	NA	NA	NA	NA	NA
WP_032695124.1|6008637_6009645_+	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_004855548.1|6009646_6009949_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_014227281.1|6010108_6011158_+	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L339	Tupanvirus	45.2	4.5e-70
>prophage 406
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	6026748	6027915	6152190		Salmonella_phage(100.0%)	1	NA	NA
WP_042946137.1|6026748_6027915_+	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	25.1	6.5e-25
>prophage 407
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	6032402	6033368	6152190	transposase	Sodalis_phage(100.0%)	1	NA	NA
WP_038423881.1|6032402_6033368_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	53.1	1.0e-68
>prophage 408
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	6040654	6041767	6152190		Bacillus_virus(100.0%)	1	NA	NA
WP_014227307.1|6040654_6041767_-	2-aminoethylphosphonate ABC transport system ATP-binding subunit PhnT	NA	G3M9Y6	Bacillus_virus	34.5	8.6e-27
>prophage 409
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	6054470	6059812	6152190		Micromonas_sp._RCC1109_virus(50.0%)	6	NA	NA
WP_004855639.1|6054470_6056159_-	acetolactate synthase large subunit	NA	E5EQ70	Micromonas_sp._RCC1109_virus	31.0	6.9e-60
WP_004107123.1|6056261_6056357_-	ilvB operon leader peptide IvbL	NA	NA	NA	NA	NA
WP_004107126.1|6056938_6057028_+	type I toxin-antitoxin system toxin TisB	NA	NA	NA	NA	NA
WP_004855646.1|6057099_6057546_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_014227319.1|6057616_6058450_+	EamA family transporter	NA	NA	NA	NA	NA
WP_042946141.1|6058627_6059812_+	multidrug efflux MFS transporter EmrD	NA	S4TR35	Salmonella_phage	23.7	3.7e-12
>prophage 410
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	6071209	6072170	6152190		Synechococcus_phage(50.0%)	2	NA	NA
WP_042946144.1|6071209_6071638_-	heat shock chaperone IbpB	NA	A0A1D8KPX5	Synechococcus_phage	36.4	9.3e-14
WP_004126917.1|6071756_6072170_-	heat shock chaperone IbpA	NA	A0A1D7SU06	Cyanophage	35.4	1.3e-17
>prophage 411
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	6075667	6076816	6152190		Oenococcus_phage(100.0%)	1	NA	NA
WP_014227329.1|6075667_6076816_-	galactonate dehydratase	NA	Q6A202	Oenococcus_phage	32.8	4.7e-52
>prophage 412
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	6082248	6089767	6152190		Bacillus_virus(33.33%)	7	NA	NA
WP_004126944.1|6082248_6084663_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	33.9	4.8e-115
WP_004126948.1|6084691_6085765_-	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_004107206.1|6085903_6087004_-	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	35.3	6.9e-53
WP_004871826.1|6087008_6088409_-	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_004871828.1|6089030_6089171_+	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_004871829.1|6089186_6089546_+	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_004871831.1|6089509_6089767_+	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	55.2	7.1e-17
>prophage 413
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	6097244	6098582	6152190		Moraxella_phage(100.0%)	1	NA	NA
WP_014839859.1|6097244_6098582_-	adenine permease AdeP	NA	A0A0R6PHV4	Moraxella_phage	36.4	5.8e-62
>prophage 414
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	6103227	6113263	6152190	transposase	Escherichia_phage(20.0%)	8	NA	NA
WP_016947617.1|6103227_6104208_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	6.8e-185
WP_004107251.1|6104886_6105612_-	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_004855746.1|6105661_6106435_-	phosphate ABC transporter ATP-binding protein PstB	NA	W8CYL7	Bacillus_phage	31.1	9.9e-14
WP_004855748.1|6106482_6107373_-	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_004107261.1|6107372_6108332_-	phosphate ABC transporter permease PstC	NA	NA	NA	NA	NA
WP_004127017.1|6108524_6109565_-	phosphate ABC transporter substrate-binding protein PstS	NA	E3SKK5	Synechococcus_phage	38.4	4.0e-50
WP_014227346.1|6109881_6111711_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	41.7	1.6e-126
WP_014227347.1|6111892_6113263_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	37.4	9.6e-36
>prophage 415
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	6127844	6128837	6152190		Heterosigma_akashiwo_virus(100.0%)	1	NA	NA
WP_038423898.1|6127844_6128837_+	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	38.0	4.2e-49
>prophage 416
NZ_CP008788	Klebsiella oxytoca KONIH1 chromosome, complete genome	6152190	6132006	6137885	6152190		Paramecium_bursaria_Chlorella_virus(33.33%)	5	NA	NA
WP_014227355.1|6132006_6133875_+	low affinity potassium transporter Kup	NA	M1I6H8	Paramecium_bursaria_Chlorella_virus	30.5	1.4e-66
WP_004855789.1|6134060_6134480_+	D-ribose pyranase	NA	NA	NA	NA	NA
WP_032718765.1|6134490_6135996_+	ribose ABC transporter ATP-binding protein RbsA	NA	A0A2K9L0W2	Tupanvirus	22.5	6.9e-19
WP_004855792.1|6136001_6136967_+	ribose ABC transporter permease	NA	NA	NA	NA	NA
WP_004855794.1|6136994_6137885_+	ribose ABC transporter substrate-binding protein RbsB	NA	C6ZCU4	Enterobacteria_phage	24.5	7.4e-05
>prophage 1
NZ_CP008789	Klebsiella oxytoca KONIH1 plasmid pKOX-137, complete sequence	133397	26042	57892	133397	transposase,integrase,protease	uncultured_Caudovirales_phage(25.0%)	37	22697:22710	62102:62115
22697:22710	attL	GACGGAAGAAAATA	NA	NA	NA	NA
WP_009654304.1|26042_27044_+|protease	CAAX amino protease	protease	NA	NA	NA	NA
WP_009654302.1|27182_27761_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009310051.1|28050_28314_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009654312.1|28310_28877_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013023776.1|28907_29402_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042946273.1|29445_29814_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004098931.1|29844_30048_+	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
WP_004098928.1|30096_30354_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004118702.1|30429_30684_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004098921.1|30859_31126_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_004098919.1|31113_31596_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_077255298.1|31804_33151_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_003032641.1|33209_34001_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_001067855.1|35032_35737_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001247892.1|35862_36153_+	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_001293886.1|36149_36551_+	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_003465043.1|36540_36897_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_003100858.1|37151_37478_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003100856.1|37474_37975_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003100853.1|37971_38343_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003100847.1|38336_38894_+	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	63.2	3.3e-59
WP_000427619.1|38972_39977_+|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_011787830.1|40532_43613_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	30.6	8.2e-51
WP_011918375.1|43636_43948_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_011787805.1|43947_44208_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_011787804.1|44377_44998_+	recombinase family protein	NA	E5FFF9	Burkholderia_phage	37.1	1.1e-26
WP_011787803.1|45115_45448_-	conjugal transfer protein TraR	NA	NA	NA	NA	NA
WP_011787802.1|45538_46393_-	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	48.6	1.3e-67
WP_011787801.1|46427_47918_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	82.2	8.6e-224
WP_042946278.1|49607_51341_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.6	6.9e-15
WP_004118225.1|51348_52296_-	acetamidase/formamidase family protein	NA	A0A1V0S8X7	Catovirus	22.7	9.6e-11
WP_004152278.1|52340_53945_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004118227.1|53957_54878_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_004118228.1|54877_55726_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_004118229.1|55722_56316_-	ANTAR domain-containing protein	NA	NA	NA	NA	NA
WP_004118230.1|56312_57440_-	transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004118231.1|57724_57892_-|integrase	integrase	integrase	NA	NA	NA	NA
62102:62115	attR	TATTTTCTTCCGTC	NA	NA	NA	NA
>prophage 1
NZ_CP008790	Klebsiella oxytoca KONIH1 plasmid pKOX-86d, complete sequence	193725	37961	46697	193725	transposase	Acidithiobacillus_phage(33.33%)	12	NA	NA
WP_000268395.1|37961_38900_+	hypothetical protein	NA	A0A2P9HXK7	Yersinia_phage	50.2	1.5e-69
WP_001096362.1|39334_39577_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001258027.1|39579_39942_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000098292.1|39934_40147_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000194038.1|40206_40962_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	51.0	5.8e-59
WP_001274811.1|40976_42518_-|transposase	IS21-like element ISAs29 family transposase	transposase	K4I413	Acidithiobacillus_phage	47.6	4.4e-130
WP_001050849.1|42762_43797_+	site-specific DNA-methyltransferase	NA	H8ZMF1	Synechococcus_phage	20.9	1.0e-05
WP_000058870.1|43810_44260_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000338945.1|44241_44553_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014342215.1|44567_44699_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001151304.1|44726_45512_+	ParA family protein	NA	A0A1X9IGI7	Lactococcus_phage	26.4	6.1e-11
WP_001207227.1|45515_46697_+	ParB/RepB/Spo0J family partition protein	NA	I3NLC2	Bifidobacterium_phage	28.7	2.4e-11
>prophage 2
NZ_CP008790	Klebsiella oxytoca KONIH1 plasmid pKOX-86d, complete sequence	193725	92167	148459	193725	integrase,transposase	Salmonella_phage(31.25%)	52	137692:137751	154169:154369
WP_042944088.1|92167_93415_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_042944089.1|93401_94964_+	recombinase	NA	NA	NA	NA	NA
WP_042944099.1|101770_102091_-	hypothetical protein	NA	J9Q750	Salmonella_phage	51.9	9.1e-30
WP_074181092.1|102368_103337_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	96.9	1.0e-180
WP_103433594.1|103873_105147_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.3	3.0e-169
WP_001548021.1|105251_105497_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001282585.1|105816_106806_+	phage recombination protein Bet	NA	B5AX97	Iodobacteriophage	39.6	1.1e-52
WP_000706865.1|106868_107879_+	YqaJ viral recombinase family protein	NA	E0YQ48	Mycobacterium_phage	28.7	5.6e-09
WP_000170086.1|108078_109356_+	DUF3150 domain-containing protein	NA	NA	NA	NA	NA
WP_000039318.1|109440_111237_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_001071288.1|111298_111634_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000018872.1|111898_112438_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000793769.1|112528_113029_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000477209.1|113102_113987_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001102700.1|114052_114277_+	2Fe-2S ferredoxin-like protein	NA	NA	NA	NA	NA
WP_000026577.1|114338_114728_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001176699.1|114717_115170_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000651508.1|115507_115699_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001337696.1|115743_116121_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000209093.1|116312_116657_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000410925.1|116734_117037_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000201432.1|117114_118740_+	DNA cytosine methyltransferase	NA	A0A0N9SK84	Staphylococcus_phage	25.8	1.2e-05
WP_015058950.1|118755_119232_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001093868.1|119305_119860_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000042274.1|120092_120479_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001187970.1|120566_123020_+	phosphoadenosine phosphosulfate reductase	NA	NA	NA	NA	NA
WP_000050848.1|123221_123425_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000071870.1|123496_124102_+	5'-deoxynucleotidase	NA	NA	NA	NA	NA
WP_000184110.1|124094_124364_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000260293.1|124377_124596_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000064432.1|124669_125227_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000595210.1|125301_126153_+	hypothetical protein	NA	A0A219UQS0	Bacillus_phage	29.4	3.6e-09
WP_001032042.1|126357_126504_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001077335.1|126610_126997_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000122923.1|127174_128902_+	hypothetical protein	NA	A0A0P0ZFY3	Escherichia_phage	32.6	9.9e-14
WP_000268337.1|128888_129167_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000714162.1|129239_129479_+	permease	NA	NA	NA	NA	NA
WP_000338626.1|129488_129605_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000868821.1|129725_130100_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000988732.1|130213_130939_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014342218.1|130913_131117_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001138073.1|134055_137028_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.1	0.0e+00
WP_001162012.1|137030_137588_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	81.3	5.8e-48
137692:137751	attL	TGTCGTTTTCAGAAGACGGCTGCACTGAACGTCAGAAGCCGACTGCACTATAGCAGCGGA	NA	NA	NA	NA
WP_000845039.1|137893_138907_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001931474.1|139112_139979_+	PSE family carbenicillin-hydrolyzing class A beta-lactamase CARB-2	NA	A0A077SL40	Escherichia_phage	44.1	4.8e-57
WP_001261740.1|140096_140888_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_042946310.1|140976_142326_-	group II intron reverse transcriptase/maturase	NA	H7BV81	unidentified_phage	28.1	5.2e-10
WP_001256774.1|143126_144386_+	CmlA family chloramphenicol efflux MFS transporter	NA	S4TR35	Salmonella_phage	31.7	4.8e-26
WP_000800689.1|144510_145143_+	type B-2 chloramphenicol O-acetyltransferase CatB11	NA	M1HKK6	Paramecium_bursaria_Chlorella_virus	43.0	7.1e-26
WP_000679427.1|145332_145680_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|145673_146513_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000050481.1|146917_148459_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
154169:154369	attR	TGTCGTTTTCAGAAGACGGCTGCACTGAACGTCAGAAGCCGACTGCACTATAGCAGCGGAGGGGTTGGATCCATCAGGCAACGACGGGCTGCTGCCGGCCATCAGCGGACGCAGGGAGGACTTTCCGCAACCGGCCGTTCGATGCGGCACCGATGGCCTTCGCGCAGGGGTAGTGAATCCGCCAGGATTGACTTGCGCTGC	NA	NA	NA	NA
>prophage 3
NZ_CP008790	Klebsiella oxytoca KONIH1 plasmid pKOX-86d, complete sequence	193725	152698	163588	193725	integrase,transposase	Escherichia_phage(33.33%)	13	150670:150682	156945:156957
150670:150682	attL	ACAAGAAAAAGCC	NA	NA	NA	NA
WP_002008781.1|152698_153199_+	hypothetical protein	NA	A0A1V0SB21	Catovirus	31.7	3.3e-10
WP_000019304.1|153198_153768_+	trimethoprim-resistant dihydrofolate reductase DfrA19	NA	A0A1V0SD48	Indivirus	27.2	3.5e-08
WP_048228299.1|153778_154384_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000845039.1|154370_155384_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_000381802.1|155529_156063_+	aminoglycoside nucleotidyltransferase ANT(2'')-Ia	NA	NA	NA	NA	NA
WP_000186237.1|156145_156778_+	type B-3 chloramphenicol O-acetyltransferase CatB3	NA	A0A2R8FE91	Brazilian_cedratvirus	41.2	4.1e-26
WP_000679427.1|156934_157282_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
156945:156957	attR	GGCTTTTTCTTGT	NA	NA	NA	NA
WP_000259032.1|157275_158115_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_001389365.1|158289_159054_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_001067855.1|159230_159935_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000052512.1|160384_161860_+	ABC-F type ribosomal protection protein Msr(E)	NA	A0A1B0RXA0	Streptococcus_phage	59.0	2.3e-160
WP_000155092.1|161915_162800_+	Mph(E) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_001067855.1|162883_163588_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
>prophage 4
NZ_CP008790	Klebsiella oxytoca KONIH1 plasmid pKOX-86d, complete sequence	193725	166819	176301	193725	integrase,transposase	uncultured_Caudovirales_phage(33.33%)	9	165216:165231	178433:178448
165216:165231	attL	TAATTATGATAATTAC	NA	NA	NA	NA
WP_000543934.1|166819_167830_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0K0N6I5	Gordonia_phage	31.9	3.1e-07
WP_044489169.1|167834_168464_+	3'-5' exonuclease	NA	A2I2Z6	Vibrio_virus	43.3	4.1e-18
WP_011787801.1|168915_170406_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	82.2	8.6e-224
WP_011787802.1|170440_171295_+	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	48.6	1.3e-67
WP_011787803.1|171385_171718_+	conjugal transfer protein TraR	NA	NA	NA	NA	NA
WP_011787804.1|171835_172456_-	recombinase family protein	NA	E5FFF9	Burkholderia_phage	37.1	1.1e-26
WP_011787805.1|172625_172886_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_011918375.1|172885_173197_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_011787830.1|173220_176301_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	30.6	8.2e-51
178433:178448	attR	TAATTATGATAATTAC	NA	NA	NA	NA
>prophage 1
NZ_CP008791	Klebsiella oxytoca KONIH1 plasmid pKPC-727, complete sequence	205586	13844	63324	205586	transposase	Burkholderia_phage(21.43%)	41	NA	NA
WP_000227969.1|13844_14921_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_009309879.1|18612_19305_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042946330.1|21739_26998_+	conjugative transfer relaxase/helicase TraI	NA	A0A1P8DII4	Virus_Rctr197k	33.3	6.8e-05
WP_015065543.1|27077_27803_+	type-F conjugative transfer system pilin acetylase TraX	NA	A0A1D6ZIU7	Xanthomonas_phage	28.3	1.2e-05
WP_042946331.1|27958_28552_+	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_013023836.1|28712_29315_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077255299.1|29364_29619_+	alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_001067855.1|29509_30214_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_042946373.1|30249_30555_+	IncN plasmid KikA protein	NA	NA	NA	NA	NA
WP_013279382.1|30590_30902_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012561158.1|30957_31599_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_001749967.1|31603_31810_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001288432.1|32191_33625_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.6	7.0e-106
WP_005012528.1|33658_34873_-	type II site-specific deoxyribonuclease	NA	E5E3X4	Burkholderia_phage	42.5	1.2e-34
WP_001749988.1|35112_35682_+	recombinase family protein	NA	E5FFF9	Burkholderia_phage	43.2	5.2e-36
WP_017384071.1|37103_37379_+	formaldehyde-responsive transcriptional repressor FrmR	NA	NA	NA	NA	NA
WP_017384070.1|37413_38523_+	S-(hydroxymethyl)glutathione dehydrogenase	NA	E3SJ82	Synechococcus_phage	28.3	4.9e-30
WP_012561111.1|38566_38965_+	VOC family protein	NA	NA	NA	NA	NA
WP_012561110.1|39029_39866_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000227969.1|40452_41529_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_001189111.1|42070_43579_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.6e-44
WP_001326844.1|45078_45240_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000176305.1|45236_45848_-	DUF2913 family protein	NA	NA	NA	NA	NA
WP_040212832.1|45901_46183_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011977766.1|46355_46691_+	C2H2-type zinc finger protein	NA	NA	NA	NA	NA
WP_015065551.1|47678_48692_-	replication protein	NA	NA	NA	NA	NA
WP_022631532.1|48684_49236_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014386216.1|49228_49306_-	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_022631531.1|49517_49787_-	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_023157996.1|49922_50402_-	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	31.7	1.2e-17
WP_015065549.1|50577_50886_-	hypothetical protein	NA	K7PKY8	Enterobacterial_phage	40.4	1.7e-17
WP_014343480.1|50882_51533_-	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
WP_113706811.1|51588_52221_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|52211_52916_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000427619.1|54812_55817_+|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_000954592.1|55998_56175_-	DUF4102 domain-containing protein	NA	T1S9J3	Salmonella_phage	68.6	1.0e-06
WP_001043260.1|56504_57320_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
WP_001082319.1|57380_58184_+	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
WP_000480968.1|58183_59020_+	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_009652586.1|59177_60200_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_004152397.1|62004_63324_+|transposase	IS1182-like element ISKpn6 family transposase	transposase	Q9MBP7	Staphylococcus_prophage	24.2	1.9e-12
>prophage 2
NZ_CP008791	Klebsiella oxytoca KONIH1 plasmid pKPC-727, complete sequence	205586	109764	181528	205586	transposase,integrase	Escherichia_phage(21.21%)	85	106203:106217	152016:152030
106203:106217	attL	CTTTCAGGTGGTGGC	NA	NA	NA	NA
WP_000019449.1|109764_110745_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	5.2e-185
WP_022631514.1|111381_111867_+	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_011977736.1|111899_112229_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152492.1|112261_113083_-	DUF945 domain-containing protein	NA	K4F5L3	Cronobacter_phage	40.1	1.2e-44
WP_004152751.1|113902_114736_-	N-6 DNA methylase	NA	A0A2K9V411	Faecalibacterium_phage	33.5	1.8e-21
WP_004152750.1|114786_114933_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152749.1|115027_115375_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152748.1|115431_115785_-	hypothetical protein	NA	A0A248SL90	Klebsiella_phage	64.2	5.0e-29
WP_072093151.1|115786_115906_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_004153414.1|116414_116765_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152661.1|116761_117034_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022631513.1|117081_117441_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004199367.1|117551_117875_-	hypothetical protein	NA	I3UM57	Rhodobacter_phage	34.2	2.3e-09
WP_022631512.1|117878_118601_-	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_040217767.1|118597_119029_-	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_004152656.1|119074_121084_-	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	27.4	1.5e-24
WP_004152655.1|121152_121395_-	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_004152654.1|121442_121955_-	single-stranded DNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	84.7	8.5e-54
WP_023158019.1|122210_122387_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004118473.1|122694_123012_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074184110.1|123046_123301_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	48.7	2.0e-11
WP_001568047.1|123488_123680_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042946350.1|123722_124229_-	antirestriction protein	NA	G9FHQ1	Rhodococcus_virus	31.1	7.7e-07
WP_015060021.1|124271_124937_-	DUF1472 domain-containing protein	NA	NA	NA	NA	NA
WP_015344998.1|124951_125308_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013214013.1|125380_126148_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001568043.1|126201_126621_-	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_001568042.1|126630_126852_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032736797.1|126851_127553_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.7	3.2e-27
WP_014343518.1|127754_127871_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001568040.1|127989_128220_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032736798.1|128283_128955_-	Mediator of plasmid stability	NA	NA	NA	NA	NA
WP_001568038.1|128957_129929_-	hypothetical protein	NA	A0A222YXF2	Escherichia_phage	46.8	1.1e-73
WP_001568036.1|130162_130594_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	53.3	2.1e-29
WP_004197646.1|130593_131865_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	64.0	5.2e-153
WP_004098982.1|132276_133152_+	RepB family plasmid replication initiator protein	NA	Q71TL8	Escherichia_phage	56.4	5.6e-82
WP_004197649.1|133784_134411_+	ParA family plasmid-partitioning AAA ATPase	NA	A0A222YXS3	Escherichia_phage	43.6	2.9e-40
WP_077253981.1|134530_134710_+	Par-like protein	NA	NA	NA	NA	NA
WP_004197635.1|135141_135936_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	88.7	5.5e-52
WP_017899884.1|136133_137150_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053389906.1|137160_137475_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017899885.1|137501_137897_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013023785.1|138065_138371_-	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_001568025.1|138372_138591_-	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_162763201.1|138760_139222_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001261282.1|139178_139409_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001044770.1|139405_139822_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_001348075.1|139895_140132_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_001067855.1|140178_140883_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001217881.1|141320_141878_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	98.4	2.0e-93
WP_014454105.1|142111_142666_+	aminoglycoside N-acetyltransferase AAC(6')-Ib'	NA	NA	NA	NA	NA
WP_001206315.1|142735_143524_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_000722315.1|143583_144408_+	oxacillin-hydrolyzing class D beta-lactamase OXA-9	NA	NA	NA	NA	NA
WP_004152391.1|145478_147194_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_004152392.1|147303_150333_+|transposase	IS3-like element Tn4401 family transposase	transposase	NA	NA	NA	NA
WP_004199214.1|150439_151465_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	50.3	1.4e-87
WP_004152394.1|151461_152241_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	61.8	2.5e-89
152016:152030	attR	CTTTCAGGTGGTGGC	NA	NA	NA	NA
WP_004199234.1|152627_153509_+	carbapenem-hydrolyzing class A beta-lactamase KPC-2	NA	A0A1B0VBP7	Salmonella_phage	52.2	2.2e-73
WP_004152397.1|153758_155078_-|transposase	IS1182-like element ISKpn6 family transposase	transposase	Q9MBP7	Staphylococcus_prophage	24.2	1.9e-12
WP_004098862.1|155567_155822_+	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_020323529.1|156060_156138_+	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_020314728.1|156130_157150_+	RepA protein, IncFII family	NA	NA	NA	NA	NA
WP_000509966.1|158362_158968_-	recombinase family protein	NA	A0A1S5Y2X8	uncultured_archaeal_virus	35.3	5.5e-20
WP_042946358.1|159062_161960_+|transposase	Tn3-like element Tn5403 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.8	9.3e-182
WP_023317852.1|162089_162725_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001567660.1|163617_164640_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_001141270.1|164993_165269_+	formaldehyde-responsive transcriptional repressor FrmR	NA	NA	NA	NA	NA
WP_000842086.1|165299_166409_+	S-(hydroxymethyl)glutathione dehydrogenase	NA	E3SJ82	Synechococcus_phage	28.1	3.7e-30
WP_000235177.1|166450_166849_+	VOC family protein	NA	NA	NA	NA	NA
WP_009652884.1|166914_167751_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000470624.1|167778_168414_-	recombinase family protein	NA	NA	NA	NA	NA
WP_022644720.1|168581_171620_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	53.6	2.5e-294
WP_001567660.1|171643_172666_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_020314648.1|173125_173404_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020804876.1|173721_174333_+	DUF2913 family protein	NA	NA	NA	NA	NA
WP_020314639.1|174329_175283_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	57.1	9.5e-75
WP_022644719.1|175403_175670_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020314642.1|175689_176310_-	recombinase family protein	NA	A0A219Y912	Aeromonas_phage	31.0	1.0e-08
WP_022644718.1|176907_177534_+	ParA family protein	NA	A0A2H4EW66	Aeromonas_phage	34.4	4.5e-25
WP_020314634.1|177578_177806_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020314652.1|177980_179255_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	60.7	1.3e-148
WP_046960466.1|179266_179716_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	52.0	2.3e-31
WP_020314635.1|179712_179958_-	DinI-like family protein	NA	Q7Y3V9	Yersinia_phage	39.3	1.1e-08
WP_020314631.1|180161_180392_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020314651.1|180826_181528_+	DNA methylase	NA	A0A2K9VH43	Faecalibacterium_phage	34.7	6.2e-23
