The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP008713	Candidatus Arthromitus sp. SFB-mouse-NL chromosome, complete genome	1654902	111347	189910	1654902	plate,holin,integrase,portal,capsid,head,terminase,protease,tail	Clostridium_phage(18.52%)	85	104807:104823	134792:134808
104807:104823	attL	TAAATATGAACTTAATT	NA	NA	NA	NA
WP_042293981.1|111347_112538_-|integrase	site-specific integrase	integrase	A0A0A8WIE1	Clostridium_phage	49.9	9.6e-101
WP_042293983.1|112700_113192_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144238980.1|113242_113779_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042293986.1|113738_114674_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042293988.1|114848_115100_-	peptidase S24	NA	Q4ZCB4	Staphylococcus_virus	35.3	1.6e-05
WP_005807572.1|115440_116175_+	DUF3644 domain-containing protein	NA	A0A220NQR4	Corynebacterium_phage	35.8	1.1e-17
WP_081832567.1|116912_117626_-	helix-turn-helix domain-containing protein	NA	A0A1B2APZ3	Phage_Wrath	31.4	5.5e-19
WP_042293990.1|117765_117969_+	DUF739 family protein	NA	NA	NA	NA	NA
WP_005807562.1|118087_118303_-	helix-turn-helix transcriptional regulator	NA	A0A1L2JY18	Aeribacillus_phage	44.1	3.8e-08
WP_042293992.1|118421_118622_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005807558.1|118666_118885_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_005807556.1|118889_119069_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042293996.1|119155_119422_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042293999.1|119438_119738_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042294001.1|119737_120874_+	DUF2800 domain-containing protein	NA	A0A0A7S066	Clostridium_phage	48.2	2.8e-97
WP_042294002.1|120889_121450_+	DUF2815 family protein	NA	A0A0A7RVM4	Clostridium_phage	61.2	1.8e-57
WP_042294004.1|121449_123369_+	DNA polymerase	NA	S5M5X4	Brevibacillus_phage	54.2	5.2e-189
WP_042294005.1|123384_125889_+	virulence-associated protein E	NA	A0A0A7RTG3	Clostridium_phage	44.8	2.8e-198
WP_042294007.1|126182_126491_+	VRR-NUC domain-containing protein	NA	A0A1W6JQA8	Corynebacterium_phage	43.8	3.6e-15
WP_042294010.1|126442_127783_+	DEAD/DEAH box helicase family protein	NA	M9QRT1	Staphylococcus_phage	52.2	8.8e-135
WP_042294011.1|127795_128221_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042294014.1|128207_128423_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_042294019.1|128689_128887_+	type II toxin-antitoxin system HicA family toxin	NA	A0A0C5AC70	Paenibacillus_phage	57.9	1.8e-12
WP_042294021.1|129020_129467_+	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0K2CYJ8	Paenibacillus_phage	37.8	1.0e-15
WP_042295220.1|129562_129787_+	DUF3310 domain-containing protein	NA	A0A249XUN0	Enterococcus_phage	39.4	3.4e-07
WP_042294023.1|129978_130458_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052341879.1|130450_132229_+|terminase	phage terminase large subunit family protein	terminase	A0A0C5ABH4	Bacteriophage	43.5	8.7e-122
WP_173400382.1|132276_132474_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042294026.1|132482_134036_+|portal	phage portal protein	portal	A0A0C5AJ48	Bacteriophage	45.4	2.6e-122
WP_052341881.1|134036_135035_+|protease	Clp protease ClpP	protease	A6M950	Geobacillus_virus	42.9	4.7e-32
134792:134808	attR	TAAATATGAACTTAATT	NA	NA	NA	NA
WP_052341882.1|135034_135397_+|head	head decoration protein	head	A0A067ZIL6	Vibrio_phage	29.1	2.7e-06
WP_042294027.1|135399_136530_+|capsid	major capsid protein	capsid	A0A0C5ABI0	Bacteriophage	32.5	4.2e-37
WP_042294030.1|136530_136776_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042294032.1|136775_137348_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_042294034.1|137340_137667_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052341883.1|137813_138737_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042294036.1|138720_138966_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042294038.1|138953_140693_+	DUF2326 domain-containing protein	NA	NA	NA	NA	NA
WP_042294040.1|140702_141236_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042294042.1|141246_142695_+	hypothetical protein	NA	A0A0C5AEE8	Bacteriophage	28.7	3.1e-45
WP_042294044.1|142697_143216_+|tail	phage major tail tube protein	tail	NA	NA	NA	NA
WP_042294046.1|143224_143605_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042294048.1|143601_143934_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042294050.1|144261_147228_+|tail	phage tail tape measure protein	tail	H8YJ81	Vibrio_phage	24.7	8.7e-26
WP_052341884.1|147217_147475_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042294052.1|147477_148401_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042294055.1|148400_148607_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042294057.1|148596_149049_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_042294060.1|149053_149332_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052341885.1|149333_150425_+|plate	baseplate J/gp47 family protein	plate	A0A067ZJB4	Vibrio_phage	35.1	4.0e-53
WP_042294063.1|150421_151138_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042294066.1|151124_151889_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042294068.1|151893_152739_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042294070.1|152738_154451_+|tail	phage tail protein	tail	A0A0C5AEQ0	Bacteriophage	36.6	4.0e-15
WP_042294072.1|154636_155068_+|holin	phage holin family protein	holin	D2XPZ9	Bacillus_virus	30.2	1.2e-05
WP_042294074.1|155254_155917_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A0A8WI59	Clostridium_phage	40.4	2.3e-27
WP_042294077.1|156360_157893_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040054030.1|158151_158655_+	signal peptidase I	NA	NA	NA	NA	NA
WP_005807454.1|158736_160824_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_005807452.1|160820_161807_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042294078.1|161879_163052_-	cation transporter	NA	NA	NA	NA	NA
WP_005807447.1|163199_164399_+	aspartate kinase	NA	NA	NA	NA	NA
WP_005807445.1|164413_165694_+	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
WP_005807444.1|165761_166901_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005807442.1|166922_168203_+	M18 family aminopeptidase	NA	NA	NA	NA	NA
WP_005807440.1|168215_168701_-	2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase	NA	NA	NA	NA	NA
WP_005807438.1|168714_169446_-	pseudouridine synthase	NA	NA	NA	NA	NA
WP_005807437.1|169494_170430_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005807435.1|170683_171436_+	DUF3298 and DUF4163 domain-containing protein	NA	NA	NA	NA	NA
WP_081467327.1|171561_171849_+	hypothetical protein	NA	M1PLC0	Streptococcus_phage	33.3	3.9e-08
WP_042294084.1|171868_172498_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005807428.1|172597_172957_-	DUF1540 domain-containing protein	NA	NA	NA	NA	NA
WP_042294086.1|173105_173954_+	YitT family protein	NA	NA	NA	NA	NA
WP_042294088.1|174262_175138_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005807422.1|175319_175484_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005807420.1|175527_176424_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042294089.1|176445_177360_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042294090.1|177434_178442_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005807414.1|178624_179944_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_014017815.1|179940_180600_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	29.1	1.3e-17
WP_007441790.1|180623_181832_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_005807409.1|181824_182337_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005807407.1|182414_183497_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005807405.1|183505_183919_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007441789.1|188998_189910_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 2
NZ_CP008713	Candidatus Arthromitus sp. SFB-mouse-NL chromosome, complete genome	1654902	771907	842779	1654902	plate,holin,tRNA,capsid,portal,integrase,head,terminase,protease,tail	Clostridium_phage(32.43%)	72	807141:807200	841315:841402
WP_005806325.1|771907_772948_+|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
WP_005806324.1|772978_774028_+	flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase	NA	NA	NA	NA	NA
WP_042294587.1|774083_778277_+	PolC-type DNA polymerase III	NA	A0A1X9I5C8	Streptococcus_phage	33.6	1.8e-24
WP_005806320.1|778626_779088_+	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_005806318.1|779098_780259_+	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_005806317.1|780248_780518_+	YlxR family protein	NA	NA	NA	NA	NA
WP_042294588.1|780543_782688_+	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	25.6	6.7e-28
WP_005806313.1|782709_783066_+	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_007445250.1|783058_784018_+	bifunctional oligoribonuclease/PAP phosphatase NrnA	NA	NA	NA	NA	NA
WP_005806310.1|784014_784914_+|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	E3T4J1	Cafeteria_roenbergensis_virus	34.5	3.4e-05
WP_005806307.1|784900_785824_+	bifunctional riboflavin kinase/FAD synthetase	NA	A0A1V0SD03	Indivirus	30.6	2.6e-05
WP_040054077.1|785927_786191_+	30S ribosomal protein S15	NA	NA	NA	NA	NA
WP_005806304.1|786273_788388_+	polyribonucleotide nucleotidyltransferase	NA	NA	NA	NA	NA
WP_042294589.1|788508_788796_+	YlmC/YmxH family sporulation protein	NA	NA	NA	NA	NA
WP_042294590.1|788820_790020_+	aspartate kinase	NA	NA	NA	NA	NA
WP_005806299.1|790133_790934_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	NA	NA	NA	NA
WP_042294591.1|791044_793321_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.2	3.4e-86
WP_173400384.1|793349_794666_+	30S ribosomal protein S12 methylthiotransferase RimO	NA	NA	NA	NA	NA
WP_042294593.1|794665_795235_+	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_042294594.1|795237_796311_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	64.2	3.8e-120
WP_005806283.1|796488_798063_+	ribonuclease Y	NA	NA	NA	NA	NA
WP_007440222.1|798191_798452_+	stage V sporulation protein S	NA	A0A1J0GVV0	Streptomyces_phage	39.2	3.6e-08
WP_005806279.1|798552_798813_+	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_042294596.1|799526_800468_+	tyrosine recombinase XerC	NA	A0A1B1IQT7	uncultured_Mediterranean_phage	29.8	7.8e-13
WP_042294597.1|800487_801759_-	methionine gamma-lyase family protein	NA	NA	NA	NA	NA
WP_042294598.1|801771_802692_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_042294599.1|802694_804524_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	34.4	6.7e-77
WP_005806266.1|804580_807142_-	DNA mismatch repair protein MutS	NA	A0A1V0SJ67	Klosneuvirus	29.3	2.4e-48
WP_042294600.1|807138_808068_-	transcriptional regulator	NA	NA	NA	NA	NA
807141:807200	attL	ATAATGAATTTCTCCTATCGATATTTAACTCTTTATTTTTGTTAGTTTTTTCATTGACTT	NA	NA	NA	NA
WP_042294601.1|808222_809017_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052341890.1|809179_809527_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042294602.1|809575_809989_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158336021.1|809991_810162_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042294603.1|810523_811150_+	Ltp family lipoprotein	NA	NA	NA	NA	NA
WP_042294604.1|811297_812212_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042295270.1|812293_812950_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A0A8WI59	Clostridium_phage	42.3	1.6e-28
WP_042294605.1|813053_813485_-|holin	phage holin family protein	holin	D2XPZ9	Bacillus_virus	30.2	3.2e-06
WP_042294606.1|813713_814850_-	DUF2971 domain-containing protein	NA	NA	NA	NA	NA
WP_158336022.1|814995_815139_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042294607.1|815144_815429_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042294608.1|815425_817567_-	hypothetical protein	NA	H7BUY5	unidentified_phage	30.5	6.1e-13
WP_042294609.1|817591_818263_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042294610.1|818255_819050_-	DUF2313 domain-containing protein	NA	NA	NA	NA	NA
WP_042294611.1|819030_820089_-|plate	baseplate J/gp47 family protein	plate	A0A0A7RVT9	Clostridium_phage	29.0	4.5e-33
WP_042294612.1|820081_820504_-	DUF2634 domain-containing protein	NA	A0A1V0DZX2	Clostridioides_phage	43.1	4.7e-18
WP_158336023.1|820500_820869_-	DUF2577 family protein	NA	NA	NA	NA	NA
WP_042294614.1|820873_821842_-	hypothetical protein	NA	A0A1V0DZX6	Clostridioides_phage	29.3	3.6e-29
WP_042294615.1|821838_822447_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A0K2SUI2	Clostridium_phage	29.5	8.0e-19
WP_052341891.1|822436_825034_-|tail	phage tail tape measure protein	tail	E2ELJ5	Clostridium_phage	44.9	6.6e-78
WP_052341892.1|825182_825569_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042294616.1|825571_826012_-|tail	phage tail tube protein	tail	A0A0A8WF55	Clostridium_phage	47.0	1.7e-26
WP_042294617.1|826023_827079_-	hypothetical protein	NA	A0A0A8WJL8	Clostridium_phage	40.0	2.2e-64
WP_042294618.1|827275_827680_-	hypothetical protein	NA	A0A0A8WFN4	Clostridium_phage	32.4	1.3e-09
WP_081832587.1|827681_828053_-	HK97 gp10 family phage protein	NA	NA	NA	NA	NA
WP_052341893.1|828042_828381_-|head	phage head closure protein	head	A0A0A8WI51	Clostridium_phage	46.0	7.1e-09
WP_042294620.1|828370_828655_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBP7	Clostridium_phage	42.4	8.1e-14
WP_042294621.1|828657_829473_-	hypothetical protein	NA	A0A0K2CZ99	Paenibacillus_phage	35.0	7.0e-34
WP_042294622.1|829459_830596_-|capsid	phage major capsid protein	capsid	A0A1B1P7R4	Bacillus_phage	41.1	3.6e-73
WP_052341894.1|830588_831212_-|head,protease	HK97 family phage prohead protease	head,protease	E2ELI4	Clostridium_phage	34.6	8.5e-24
WP_144238982.1|831213_832443_-|portal	phage portal protein	portal	A0A2I6PF26	Staphylococcus_phage	30.3	1.4e-38
WP_042294624.1|832453_834133_-|terminase	terminase large subunit	terminase	A6M948	Geobacillus_virus	49.5	3.4e-152
WP_042294625.1|834129_834618_-|terminase	phage terminase small subunit P27 family	terminase	H0USW2	Bacillus_phage	38.8	9.9e-20
WP_042294626.1|834732_834978_-	helix-turn-helix transcriptional regulator	NA	A0A2K9V426	Faecalibacterium_phage	44.4	8.2e-07
WP_052341904.1|834979_835345_-	HNH endonuclease	NA	Q8SBK4	Clostridium_phage	40.8	6.1e-22
WP_042295279.1|835328_835568_-	DUF3310 domain-containing protein	NA	A0A218MLR8	uncultured_virus	50.8	2.5e-08
WP_042294628.1|835871_836582_-	DUF4065 domain-containing protein	NA	M4SRU1	Rhodobacter_phage	31.6	3.7e-07
WP_052341896.1|836610_837318_-	hypothetical protein	NA	Q0H269	Geobacillus_phage	31.6	1.8e-17
WP_042294629.1|837545_838091_-|integrase	tyrosine-type recombinase/integrase	integrase	E2ELN7	Clostridium_phage	43.4	5.1e-41
WP_042294630.1|838087_839053_-	site-specific DNA-methyltransferase	NA	Q58MT6	Prochlorococcus_phage	28.7	2.1e-21
WP_042294631.1|839338_839740_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042294632.1|840140_841205_+|integrase	site-specific integrase	integrase	A0A1B0T6A8	Bacillus_phage	28.7	6.3e-27
WP_005806264.1|841435_842779_-|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
841315:841402	attR	ATAATGAATTTCTCCTATCGATATTTAACTCTTTATTTTTGTTAGTTTTTTCATTGACTTCTTCCAAAAATAGTTTTACATCAATATT	NA	NA	NA	NA
>prophage 3
NZ_CP008713	Candidatus Arthromitus sp. SFB-mouse-NL chromosome, complete genome	1654902	1514473	1602119	1654902	plate,holin,tRNA,capsid,portal,integrase,head,terminase,tail,protease	Bacteriophage(14.71%)	100	1563964:1563982	1607752:1607770
WP_042295047.1|1514473_1515898_-|tRNA	cysteine--tRNA ligase	tRNA	A0A1V0SAQ2	Catovirus	33.9	1.5e-60
WP_005805109.1|1515910_1516594_-	2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_042295049.1|1516713_1519152_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	H6X3M6	Enterobacteria_phage	36.0	1.8e-133
WP_042295051.1|1519168_1520203_-	protein arginine kinase	NA	NA	NA	NA	NA
WP_042295053.1|1520203_1520737_-	UvrB/UvrC motif-containing protein	NA	NA	NA	NA	NA
WP_005805105.1|1520867_1521041_-	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_005805104.1|1521150_1522020_-	stage 0 sporulation family protein	NA	NA	NA	NA	NA
WP_042295055.1|1522019_1522838_-	DNA polymerase III subunit delta'	NA	NA	NA	NA	NA
WP_042295057.1|1522843_1523491_-	thymidylate kinase	NA	G3MB74	Bacillus_virus	29.4	1.4e-16
WP_005805101.1|1523487_1524942_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_042295060.1|1525021_1525954_+	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_042295062.1|1526007_1526928_+	LD-carboxypeptidase	NA	NA	NA	NA	NA
WP_042295064.1|1526992_1527871_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042295066.1|1528104_1528911_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042295068.1|1529002_1529563_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042295069.1|1529562_1529745_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042295072.1|1529769_1530171_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158336027.1|1530176_1530347_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042295074.1|1530362_1530593_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042295076.1|1530623_1530935_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042295077.1|1530953_1531301_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042295079.1|1531381_1532569_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A0A7RTT7	Clostridium_phage	38.4	1.1e-69
WP_042295082.1|1532659_1533124_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_042295085.1|1533503_1534733_+	type II toxin-antitoxin system RnlA family toxin	NA	NA	NA	NA	NA
WP_042295086.1|1534933_1535296_+	type II toxin-antitoxin system RnlB family antitoxin	NA	NA	NA	NA	NA
WP_081832590.1|1535296_1535467_-	DUF4214 domain-containing protein	NA	NA	NA	NA	NA
WP_042295312.1|1535499_1535916_-	SocA family protein	NA	Q938J3	Temperate_phage	37.4	3.3e-16
WP_042295088.1|1536739_1536991_+	DUF4160 domain-containing protein	NA	NA	NA	NA	NA
WP_042295090.1|1537031_1537289_+	DUF2442 domain-containing protein	NA	NA	NA	NA	NA
WP_042295315.1|1537296_1537533_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_042295093.1|1537538_1537787_+	DUF4160 domain-containing protein	NA	NA	NA	NA	NA
WP_042295318.1|1537830_1538496_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A0A8WI59	Clostridium_phage	40.3	1.8e-27
WP_042295094.1|1538601_1539033_-|holin	phage holin family protein	holin	D2XPZ9	Bacillus_virus	30.2	4.2e-06
WP_042294070.1|1539222_1540935_-|tail	phage tail protein	tail	A0A0C5AEQ0	Bacteriophage	36.6	4.0e-15
WP_042295096.1|1540934_1541780_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042294066.1|1541784_1542549_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042294063.1|1542535_1543252_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052341885.1|1543248_1544340_-|plate	baseplate J/gp47 family protein	plate	A0A067ZJB4	Vibrio_phage	35.1	4.0e-53
WP_042294060.1|1544341_1544620_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042294057.1|1544624_1545077_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_042294055.1|1545066_1545273_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042294052.1|1545272_1546196_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052341884.1|1546198_1546456_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042295098.1|1546445_1549412_-|tail	phage tail tape measure protein	tail	H8YJ81	Vibrio_phage	24.7	8.7e-26
WP_042294048.1|1549739_1550072_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042294046.1|1550068_1550449_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042294044.1|1550457_1550976_-|tail	phage major tail tube protein	tail	NA	NA	NA	NA
WP_042295099.1|1550978_1552427_-	hypothetical protein	NA	A0A0C5AEE8	Bacteriophage	28.5	1.2e-44
WP_042294040.1|1552437_1552971_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042294038.1|1552980_1554720_-	DUF2326 domain-containing protein	NA	NA	NA	NA	NA
WP_042294036.1|1554707_1554953_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052341883.1|1554936_1555860_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042294034.1|1556006_1556333_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042295101.1|1556325_1556898_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_042295103.1|1556897_1557143_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042295104.1|1557143_1558274_-|capsid	major capsid protein	capsid	A0A0C5ABI0	Bacteriophage	32.2	7.1e-37
WP_052341882.1|1558276_1558639_-|head	head decoration protein	head	A0A067ZIL6	Vibrio_phage	29.1	2.7e-06
WP_052341881.1|1558638_1559637_-|protease	Clp protease ClpP	protease	A6M950	Geobacillus_virus	42.9	4.7e-32
WP_042294026.1|1559637_1561191_-|portal	phage portal protein	portal	A0A0C5AJ48	Bacteriophage	45.4	2.6e-122
WP_173400382.1|1561199_1561397_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052341879.1|1561444_1563223_-|terminase	phage terminase large subunit family protein	terminase	A0A0C5ABH4	Bacteriophage	43.5	8.7e-122
WP_042294023.1|1563215_1563695_-	hypothetical protein	NA	NA	NA	NA	NA
1563964:1563982	attL	ATCTAAAAATATTTTTAAT	NA	NA	NA	NA
WP_052341900.1|1564125_1564392_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_042295106.1|1564393_1564759_-	HNH endonuclease	NA	Q8SBK4	Clostridium_phage	37.5	9.7e-20
WP_042295322.1|1564742_1564967_-	DUF3310 domain-containing protein	NA	A0A249XUN0	Enterococcus_phage	39.4	4.4e-07
WP_042295107.1|1565062_1565509_-	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0K2CYJ8	Paenibacillus_phage	37.8	1.4e-15
WP_042294019.1|1565641_1565839_-	type II toxin-antitoxin system HicA family toxin	NA	A0A0C5AC70	Paenibacillus_phage	57.9	1.8e-12
WP_173400387.1|1565986_1566490_-	DUF2442 domain-containing protein	NA	NA	NA	NA	NA
WP_042295110.1|1566560_1566821_-	DUF4160 domain-containing protein	NA	NA	NA	NA	NA
WP_042295112.1|1567088_1567634_-|integrase	tyrosine-type recombinase/integrase	integrase	E2ELN7	Clostridium_phage	42.9	2.5e-40
WP_042295114.1|1568024_1568441_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042295116.1|1568800_1569868_+|integrase	site-specific integrase	integrase	A0A1B0T6A8	Bacillus_phage	30.1	3.8e-32
WP_014018071.1|1570078_1571470_+	UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase	NA	NA	NA	NA	NA
WP_042295118.1|1571487_1572873_-|tRNA	glycine--tRNA ligase	tRNA	A0A1V0SIF1	Klosneuvirus	27.1	5.0e-48
WP_007441875.1|1572964_1574047_-	AAA family ATPase	NA	G3M9Z9	Bacillus_virus	35.1	3.9e-56
WP_005805095.1|1574339_1575812_-|tRNA	lysine--tRNA ligase	tRNA	A0A2K9KZX5	Tupanvirus	42.7	6.8e-96
WP_042295120.1|1575834_1576314_-	transcription elongation factor GreA	NA	NA	NA	NA	NA
WP_005805093.1|1576401_1577376_-|tRNA	tRNA-dihydrouridine synthase	tRNA	NA	NA	NA	NA
WP_014018072.1|1577438_1579244_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	C7U047	Ostreococcus_tauri_virus	46.9	3.1e-111
WP_005805091.1|1579406_1579946_-	hypoxanthine phosphoribosyltransferase	NA	A0A2K9L634	Tupanvirus	25.6	5.1e-09
WP_042295124.1|1579935_1581393_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_042295127.1|1581492_1583847_-	SpoIIE family protein phosphatase	NA	NA	NA	NA	NA
WP_005805088.1|1584320_1584743_-	RNA-binding protein S1	NA	NA	NA	NA	NA
WP_007440410.1|1584778_1585063_-	septum formation initiator family protein	NA	NA	NA	NA	NA
WP_042295130.1|1585135_1585516_-	spore cortex biosynthesis protein YabQ	NA	NA	NA	NA	NA
WP_005805084.1|1585512_1585827_-	sporulation protein YabP	NA	NA	NA	NA	NA
WP_042295132.1|1585896_1586136_-	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
WP_005805082.1|1586181_1586457_-	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	56.2	3.6e-19
WP_005805080.1|1586622_1588158_-	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_005805079.1|1588273_1588822_-	stage V sporulation protein T	NA	A0A2I7SC16	Paenibacillus_phage	66.7	3.6e-10
WP_007440409.1|1588924_1589914_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_042295134.1|1589950_1590970_-	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_042295136.1|1590998_1594508_-	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_042295138.1|1594525_1595080_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_005805075.1|1595128_1595965_-|protease	serine protease	protease	NA	NA	NA	NA
WP_042295141.1|1596008_1597412_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	31.4	1.7e-27
WP_005805073.1|1597411_1598098_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	40.5	9.6e-45
WP_042295143.1|1598276_1599254_-	ribose-phosphate pyrophosphokinase	NA	A0A1V0SHF7	Hokovirus	36.6	8.3e-50
WP_042295146.1|1599271_1600633_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A1V0SFS6	Hokovirus	36.5	1.2e-30
WP_005805070.1|1600730_1602119_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	39.9	4.7e-91
1607752:1607770	attR	ATTAAAAATATTTTTAGAT	NA	NA	NA	NA
