The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP004383	Burkholderia thailandensis USAMRU Malaysia #20 chromosome 1, complete sequence	3862646	462076	519443	3862646	integrase,tRNA,transposase,protease	Vibrio_phage(23.08%)	51	472155:472173	520122:520140
WP_009893562.1|462076_462613_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_009902157.1|462622_463966_+|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A191ZC11	Erwinia_phage	28.2	1.0e-37
WP_009893567.1|464371_464914_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_009893568.1|464933_466214_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_025369664.1|466231_466489_-	cysteine-rich CWC family protein	NA	NA	NA	NA	NA
WP_009893574.1|466814_467714_+	acetylglutamate kinase	NA	NA	NA	NA	NA
WP_009893575.1|467710_468514_+	pyrimidine 5'-nucleotidase	NA	NA	NA	NA	NA
WP_009893577.1|468480_469173_+	nucleoid occlusion factor SlmA	NA	NA	NA	NA	NA
WP_009893578.1|469478_470624_+	homoserine O-acetyltransferase	NA	NA	NA	NA	NA
WP_009893580.1|470620_471235_+	methionine biosynthesis protein MetW	NA	NA	NA	NA	NA
WP_009893581.1|471246_472560_+	AmpG family muropeptide MFS transporter	NA	NA	NA	NA	NA
472155:472173	attL	GAAGATCGGCATCGCGCGC	NA	NA	NA	NA
WP_009893583.1|472549_473590_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_009893585.1|473817_474762_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_009893586.1|474980_476045_+	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L339	Tupanvirus	46.7	1.5e-81
WP_009893587.1|476185_476956_-	exodeoxyribonuclease III	NA	R4TWA8	Phaeocystis_globosa_virus	32.7	2.4e-28
WP_009893588.1|476987_477827_-	polyphosphate kinase	NA	NA	NA	NA	NA
WP_009893589.1|477953_479426_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_009893590.1|479428_480919_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_009893592.1|481045_481345_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_004189550.1|481710_482754_+	rod shape-determining protein	NA	NA	NA	NA	NA
WP_009908314.1|482873_483953_+	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_009893619.1|483949_484462_+	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_009893621.1|484625_487034_+	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_009893622.1|487045_488194_+	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_025369666.1|488311_489079_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_009893625.1|489075_489861_-	2-dehydro-3-deoxyglucarate aldolase	NA	NA	NA	NA	NA
WP_009893627.1|490206_490659_-	6-carboxytetrahydropterin synthase QueD	NA	A0A088FAL2	Vibrio_phage	30.1	1.3e-13
WP_009893629.1|490678_491311_-	7-carboxy-7-deazaguanine synthase	NA	R4TAH8	Halovirus	34.7	1.9e-07
WP_009893630.1|491408_492143_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A1B0Z0B4	Vibrio_phage	42.5	2.1e-50
WP_009893632.1|492603_493290_-	response regulator	NA	NA	NA	NA	NA
WP_009893633.1|493290_495699_-	PAS domain-containing sensor histidine kinase	NA	NA	NA	NA	NA
WP_009893635.1|495700_496291_-	DUF4390 domain-containing protein	NA	NA	NA	NA	NA
WP_009893636.1|496287_497700_-	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_038712271.1|497938_499207_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	42.7	9.8e-43
WP_025369668.1|499868_500444_+	recombinase family protein	NA	A0A219Y912	Aeromonas_phage	41.5	5.4e-25
WP_144241895.1|500490_501543_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009908294.1|502990_503215_+	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_009908295.1|503628_504789_+	DUF4382 domain-containing protein	NA	NA	NA	NA	NA
WP_009902052.1|504853_505009_+	lipoprotein	NA	NA	NA	NA	NA
WP_011400919.1|505139_506360_+|transposase	ISL3 family transposase	transposase	A9YX10	Burkholderia_phage	99.0	3.0e-238
WP_025369669.1|506995_507556_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_009902065.1|508042_508390_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009908298.1|508610_509165_+	YaeQ family protein	NA	NA	NA	NA	NA
WP_009908299.1|509292_509709_-	lactoylglutathione lyase	NA	NA	NA	NA	NA
WP_025369670.1|510111_511206_+	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	37.4	2.2e-19
WP_009908301.1|511202_512144_+	3-methyladenine DNA glycosylase 2	NA	NA	NA	NA	NA
WP_009908302.1|512293_513907_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_009908303.1|513922_515374_-	RNA polymerase sigma factor RpoD/SigA	NA	A0A2I7SAT0	Vibrio_phage	34.4	3.4e-31
WP_009908304.1|515616_516165_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025369671.1|516840_518109_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	42.7	9.8e-43
WP_025369672.1|518213_519443_-|integrase	tyrosine-type recombinase/integrase	integrase	G9L697	Escherichia_phage	36.8	8.0e-66
520122:520140	attR	GCGCGCGATGCCGATCTTC	NA	NA	NA	NA
>prophage 2
NZ_CP004383	Burkholderia thailandensis USAMRU Malaysia #20 chromosome 1, complete sequence	3862646	685994	693031	3862646	integrase	Pseudomonas_phage(33.33%)	8	687166:687216	697222:697272
WP_009910245.1|685994_687023_-|integrase	site-specific integrase	integrase	W6MYA3	Pseudomonas_phage	41.3	1.2e-46
687166:687216	attL	TTGGCGCGCCCGGCTGGGATCGAACCAGCAACCCCTGCCTTCGGAGGGCAG	NA	NA	NA	NA
WP_080556798.1|687358_687664_-	DUF3892 domain-containing protein	NA	NA	NA	NA	NA
WP_009910243.1|687863_688181_-	transcriptional regulator	NA	A0A088CD40	Shigella_phage	59.2	2.1e-15
WP_009910242.1|688188_688521_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A088CBP5	Shigella_phage	51.9	9.8e-19
WP_038708106.1|688562_689150_-|integrase	site-specific integrase	integrase	A0A0S2SYQ7	Pseudomonas_phage	48.9	2.0e-43
WP_038712299.1|689497_690274_-	hypothetical protein	NA	A0A1W5LU59	Ralstonia_phage	40.9	4.3e-33
WP_038712304.1|690740_692129_-	type II secretory pathway protein	NA	NA	NA	NA	NA
WP_009910232.1|692125_693031_-	hypothetical protein	NA	Q6UAZ2	Ralstonia_phage	36.1	4.9e-28
697222:697272	attR	TTGGCGCGCCCGGCTGGGATCGAACCAGCAACCCCTGCCTTCGGAGGGCAG	NA	NA	NA	NA
>prophage 3
NZ_CP004383	Burkholderia thailandensis USAMRU Malaysia #20 chromosome 1, complete sequence	3862646	765304	827934	3862646	integrase,transposase,holin	uncultured_Caudovirales_phage(10.0%)	58	815596:815611	827947:827962
WP_009892020.1|765304_766510_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_009906597.1|766848_767457_-	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_009910123.1|767607_768498_+	ATPase	NA	NA	NA	NA	NA
WP_009910122.1|768623_769445_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_009910121.1|769624_770329_-	aquaporin Z	NA	NA	NA	NA	NA
WP_009906591.1|770634_770931_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_009910119.1|771033_772098_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_080511675.1|772620_773013_+	flagellar transcriptional regulator FlhD	NA	NA	NA	NA	NA
WP_009906585.1|773106_773658_+	flagellar transcriptional regulator FlhC	NA	NA	NA	NA	NA
WP_009906583.1|773859_774720_+	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
WP_009906582.1|774736_775771_+	flagellar motor protein MotB	NA	NA	NA	NA	NA
WP_009906581.1|775801_776182_+	response regulator	NA	NA	NA	NA	NA
WP_025369713.1|776213_778445_+	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_009906577.1|778475_779003_+	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_025369714.1|779043_781026_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	41.5	2.8e-12
WP_009906572.1|781029_781977_+	chemotaxis protein CheR	NA	NA	NA	NA	NA
WP_011402604.1|781973_782678_+	chemoreceptor glutamine deamidase CheD	NA	NA	NA	NA	NA
WP_009906568.1|782674_783778_+	chemotaxis response regulator protein-glutamate methylesterase	NA	NA	NA	NA	NA
WP_004185006.1|783863_784259_+	chemotaxis protein CheY	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	2.7e-07
WP_011402603.1|784260_784989_+	protein phosphatase CheZ	NA	NA	NA	NA	NA
WP_009910093.1|785189_785693_+	DUF2844 domain-containing protein	NA	NA	NA	NA	NA
WP_009910092.1|785715_787029_+	DUF3443 domain-containing protein	NA	NA	NA	NA	NA
WP_038712325.1|787208_787709_+	VOC family protein	NA	NA	NA	NA	NA
WP_038712327.1|787809_789276_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_009910087.1|789656_790862_+	flagellar type III secretion system protein FlhB	NA	NA	NA	NA	NA
WP_009906552.1|790858_792961_+	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_009910086.1|792957_794691_+	flagellar biosynthesis protein FlhF	NA	NA	NA	NA	NA
WP_009910085.1|794683_795496_+	flagellar biosynthesis protein FlhG	NA	NA	NA	NA	NA
WP_009906542.1|795520_796252_+	RNA polymerase sigma factor FliA	NA	NA	NA	NA	NA
WP_009906539.1|796604_798026_+	adenosylhomocysteinase	NA	S4VPF6	Pandoravirus	29.9	9.9e-44
WP_009906537.1|798188_798542_+|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_009906536.1|798559_799390_+	methylenetetrahydrofolate reductase [NAD(P)H]	NA	NA	NA	NA	NA
WP_038712329.1|799471_800692_-|transposase	ISL3 family transposase	transposase	A9YX10	Burkholderia_phage	98.5	6.2e-236
WP_038712334.1|800878_802369_-	6-aminohexanoate hydrolase	NA	NA	NA	NA	NA
WP_025369718.1|802457_803150_-	dienelactone hydrolase family protein	NA	NA	NA	NA	NA
WP_009906533.1|803448_804549_+	nitronate monooxygenase	NA	NA	NA	NA	NA
WP_009906532.1|805003_806146_+	branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_025369719.1|806304_807513_-	MFS transporter	NA	NA	NA	NA	NA
WP_025369720.1|807812_808502_+	pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
WP_004195767.1|808886_809180_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_009906524.1|809419_810610_+	cation transporter	NA	NA	NA	NA	NA
WP_004195771.1|810775_811234_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_009906521.1|811324_811981_-	exonuclease	NA	A0A2L0UZL4	Agrobacterium_phage	37.1	1.5e-31
WP_009910074.1|811977_812622_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_009906517.1|813222_813858_+	septal ring lytic transglycosylase RlpA family protein	NA	F5B3X9	Synechococcus_phage	65.5	1.9e-23
WP_009906515.1|813952_814840_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	NA	NA	NA	NA
WP_009910065.1|814886_815321_+	YraN family protein	NA	NA	NA	NA	NA
WP_009910064.1|815443_816022_+	SIS domain-containing protein	NA	NA	NA	NA	NA
815596:815611	attL	CCCGTCGGCCGCCGCG	NA	NA	NA	NA
WP_009906511.1|816040_816841_+	BON domain-containing protein	NA	NA	NA	NA	NA
WP_025369721.1|816837_817200_+	c-type cytochrome	NA	NA	NA	NA	NA
WP_038712338.1|817456_818548_+|integrase	site-specific integrase	integrase	W6MYA3	Pseudomonas_phage	40.5	6.2e-54
WP_025369723.1|818689_819337_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025369724.1|819333_820542_+	ImmA/IrrE family metallo-endopeptidase	NA	B6SBZ6	Clostridium_virus	27.9	3.3e-32
WP_144241896.1|820689_821073_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025369726.1|821842_822160_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025369727.1|822159_822729_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025369671.1|824574_825843_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	42.7	9.8e-43
WP_009889500.1|826362_827934_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	53.8	6.7e-150
827947:827962	attR	CGCGGCGGCCGACGGG	NA	NA	NA	NA
>prophage 4
NZ_CP004383	Burkholderia thailandensis USAMRU Malaysia #20 chromosome 1, complete sequence	3862646	988372	1013736	3862646	integrase,transposase,protease,plate	Pseudomonas_phage(40.0%)	25	980912:980928	1007145:1007161
980912:980928	attL	TCGGCGTCGTCGCGCTC	NA	NA	NA	NA
WP_009909975.1|988372_988885_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	52.5	1.1e-21
WP_038712365.1|989155_990373_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	43.0	8.7e-89
WP_038712368.1|990993_993855_-	DUF927 domain-containing protein	NA	A0A1B0VP75	Pseudomonas_phage	35.4	2.5e-70
WP_038712371.1|993980_994307_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009908645.1|994316_994664_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038712374.1|994656_994869_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038712997.1|994861_995164_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038713001.1|995697_995976_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038712376.1|995990_996200_-	AlpA family phage regulatory protein	NA	E5E3Y1	Burkholderia_phage	52.5	1.7e-08
WP_155719076.1|996425_996902_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080713178.1|997488_999189_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_080713179.1|999200_1000286_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038712385.1|1000646_1001234_+	recombinase family protein	NA	G8I4U3	Mycobacterium_phage	42.8	4.2e-25
WP_011883089.1|1001320_1001806_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038712389.1|1001817_1002951_-	HigA family addiction module antidote protein	NA	NA	NA	NA	NA
WP_158338514.1|1003962_1004091_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_009888580.1|1004724_1005510_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_009888581.1|1005506_1006853_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_025404121.1|1006961_1007576_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
1007145:1007161	attR	GAGCGCGACGACGCCGA	NA	NA	NA	NA
WP_043036367.1|1007949_1008639_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_009888592.1|1008675_1009194_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_009888594.1|1009210_1010701_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_009906860.1|1010773_1011277_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_009888597.1|1011334_1011817_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_009888599.1|1011897_1013736_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
>prophage 5
NZ_CP004383	Burkholderia thailandensis USAMRU Malaysia #20 chromosome 1, complete sequence	3862646	1315787	1325018	3862646		Hokovirus(16.67%)	7	NA	NA
WP_009889255.1|1315787_1317740_+	molecular chaperone DnaK	NA	A0A1V0SH73	Hokovirus	49.5	1.2e-148
WP_009889258.1|1318003_1319134_+	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	38.0	1.8e-24
WP_038712436.1|1319165_1321175_+	bifunctional anthranilate synthase component I family protein/class IV aminotransferase	NA	S4VT78	Pandoravirus	35.2	1.7e-52
WP_009904054.1|1321350_1322166_-	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0N7HVJ8	Ostreococcus_lucimarinus_virus	32.9	3.3e-36
WP_009889263.1|1322230_1322914_-	deoxynucleoside kinase	NA	A0A249XZR7	Enterococcus_phage	26.0	3.3e-05
WP_009889265.1|1322910_1323438_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_009889266.1|1323473_1325018_-	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	31.2	3.3e-24
>prophage 6
NZ_CP004383	Burkholderia thailandensis USAMRU Malaysia #20 chromosome 1, complete sequence	3862646	1572649	1581591	3862646	transposase	Staphylococcus_phage(28.57%)	10	NA	NA
WP_009889661.1|1572649_1573786_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	36.0	3.7e-49
WP_155295660.1|1574483_1575266_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107645277.1|1575193_1575823_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	69.6	1.5e-31
WP_009888727.1|1575819_1576227_-|transposase	transposase	transposase	A0A0P0ZBP6	Stx2-converting_phage	38.2	3.1e-14
WP_038712274.1|1576503_1577763_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.4	1.5e-43
WP_080713227.1|1578793_1579021_-	helicase	NA	NA	NA	NA	NA
WP_009889671.1|1579159_1579387_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_009889673.1|1579383_1579767_+	type II toxin-antitoxin system death-on-curing family toxin	NA	A0A1B3AYM0	Gordonia_phage	43.6	9.9e-07
WP_009889675.1|1579810_1580440_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	36.2	2.4e-26
WP_011402095.1|1580454_1581591_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	32.9	4.3e-42
>prophage 7
NZ_CP004383	Burkholderia thailandensis USAMRU Malaysia #20 chromosome 1, complete sequence	3862646	1706106	1714823	3862646		Bacillus_phage(16.67%)	8	NA	NA
WP_009908912.1|1706106_1707507_+	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	38.7	1.1e-79
WP_009889854.1|1707475_1708462_+	D-glycero-beta-D-manno-heptose-7-phosphate kinase	NA	A0A2H4N7X4	Lake_Baikal_phage	27.9	6.7e-15
WP_009889856.1|1708519_1709512_+	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	30.9	9.1e-28
WP_009889858.1|1709583_1709901_+	competence protein ComE	NA	NA	NA	NA	NA
WP_009904404.1|1710235_1711138_+	cysteine synthase CysM	NA	A0A1X9I5F1	Streptococcus_phage	39.9	4.3e-53
WP_009889862.1|1711232_1712474_-	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_009889864.1|1712652_1713576_+	histone deacetylase family protein	NA	A0A2K9KZC4	Tupanvirus	36.2	3.2e-43
WP_009908916.1|1713911_1714823_-	alpha/beta hydrolase	NA	A7K906	Acanthocystis_turfacea_chlorella_virus	24.6	4.2e-11
>prophage 8
NZ_CP004383	Burkholderia thailandensis USAMRU Malaysia #20 chromosome 1, complete sequence	3862646	1984361	2079353	3862646	protease,terminase,head,capsid,portal,tRNA,tail,plate,integrase	uncultured_Caudovirales_phage(23.91%)	104	2003823:2003842	2087484:2087503
WP_009890173.1|1984361_1985888_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.2	7.3e-85
WP_080554852.1|1985960_1986989_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	37.1	2.0e-06
WP_009909025.1|1987292_1988987_-	single-stranded-DNA-specific exonuclease RecJ	NA	A0A0K2FM92	Brevibacillus_phage	27.5	1.4e-28
WP_025369276.1|1989002_1990088_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009890181.1|1990441_1991695_+	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_011402197.1|1991687_1992437_+	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	38.4	4.9e-34
WP_009890183.1|1992441_1993230_+	TatD family hydrolase	NA	NA	NA	NA	NA
WP_009909028.1|1993283_1995821_+	ComEC/Rec2 family competence protein	NA	NA	NA	NA	NA
WP_009890187.1|1995857_1996685_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_009890189.1|1996927_1998589_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	52.0	1.4e-150
WP_009890191.1|1998585_1999440_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	41.3	1.0e-48
WP_009890193.1|1999544_2000828_+	phosphopyruvate hydratase	NA	W6LP63	Streptococcus_phage	62.1	9.3e-150
WP_009890195.1|2000919_2001351_+	cell division protein FtsB	NA	NA	NA	NA	NA
WP_009904688.1|2001512_2001857_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009904690.1|2001945_2002896_-	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
WP_009890200.1|2002934_2003459_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_009890202.1|2003637_2004456_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
2003823:2003842	attL	GCCGCGCCTGCTCGCGCGGC	NA	NA	NA	NA
WP_009909029.1|2004742_2005633_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_009904694.1|2005843_2006674_+	PHP domain-containing protein	NA	NA	NA	NA	NA
WP_009890207.1|2006737_2007367_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_009890209.1|2007465_2008131_+|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_009890211.1|2008139_2009342_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_025369277.1|2009338_2009956_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_025369278.1|2010000_2010903_+	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
WP_009890216.1|2011013_2012156_+	outer membrane protein assembly factor BamC	NA	NA	NA	NA	NA
WP_009890218.1|2012162_2012939_+	MBL fold metallo-hydrolase	NA	U5PVD0	Bacillus_phage	26.6	1.9e-09
WP_009890221.1|2013605_2014793_-	cupin	NA	NA	NA	NA	NA
WP_009890223.1|2014861_2015407_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_009890224.1|2015386_2016685_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009890225.1|2016671_2019353_-	DNA mismatch repair protein MutS	NA	A0A1V0SDQ0	Indivirus	24.0	2.2e-28
WP_024430959.1|2019512_2020814_+|integrase	integrase family protein	integrase	C7BGE7	Burkholderia_phage	58.7	2.6e-147
WP_009890227.1|2020764_2021007_-	AlpA family phage regulatory protein	NA	C7BGF0	Burkholderia_phage	59.2	9.3e-19
WP_009909036.1|2021015_2021489_-	hypothetical protein	NA	B5TA88	Burkholderia_phage	71.4	2.3e-05
WP_004555250.1|2021497_2021827_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009909037.1|2021940_2023257_-	ParB N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_004538495.1|2023256_2023706_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038712541.1|2023702_2024308_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004534202.1|2024304_2024640_-	hypothetical protein	NA	NA	NA	NA	NA
WP_128972336.1|2024691_2024880_-	NlpBDapX lipoprotein	NA	NA	NA	NA	NA
WP_004555253.1|2025014_2025503_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004555254.1|2025456_2025957_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_024430958.1|2026073_2026283_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009944042.1|2026369_2026900_+	hypothetical protein	NA	C7BGG0	Burkholderia_phage	46.8	4.4e-29
WP_004555255.1|2026913_2027246_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143293908.1|2027273_2027789_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004555256.1|2027847_2028411_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009909046.1|2028784_2029255_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025369284.1|2029376_2031869_+	virulence protein E	NA	A0A2D1GN57	Marinobacter_phage	41.8	3.6e-97
WP_025369285.1|2032086_2032674_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004538506.1|2033054_2033903_+	DUF4747 family protein	NA	NA	NA	NA	NA
WP_144241902.1|2034071_2034503_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004547883.1|2034654_2035224_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_025369286.1|2035186_2037172_+|terminase	phage terminase large subunit family protein	terminase	A0A2D1GMT1	Marinobacter_phage	53.4	2.7e-180
WP_004533700.1|2037182_2037389_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025369287.1|2037385_2038879_+|portal	phage portal protein	portal	A0A2H4JFL5	uncultured_Caudovirales_phage	51.2	7.5e-135
WP_004547849.1|2038875_2039970_+|protease	Clp protease ClpP	protease	A0A2H4JDI2	uncultured_Caudovirales_phage	36.2	2.3e-48
WP_004533707.1|2039996_2040341_+|head	head decoration protein	head	A0A2H4JF15	uncultured_Caudovirales_phage	49.5	3.0e-15
WP_004550216.1|2040375_2041401_+|capsid	major capsid protein	capsid	A0A2H4J890	uncultured_Caudovirales_phage	59.1	1.7e-109
WP_004539695.1|2041404_2041695_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014917510.1|2041696_2042227_+|tail	phage tail protein	tail	A0A2H4JBV1	uncultured_Caudovirales_phage	28.0	9.2e-11
WP_004533675.1|2042216_2042750_+	hypothetical protein	NA	Q9JML9	Wolbachia_phage	39.5	6.2e-23
WP_004533661.1|2042752_2043433_+|plate	phage baseplate assembly protein V	plate	A0A1B2LRU5	Wolbachia_phage	34.4	1.2e-18
WP_025369288.1|2043497_2043704_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004533690.1|2043700_2044045_+	hypothetical protein	NA	A0A2H4JA09	uncultured_Caudovirales_phage	50.9	1.4e-23
WP_009964528.1|2044041_2044935_+|plate	baseplate J protein	plate	A0A1J0I2M3	Salmonella_phage	40.1	8.4e-49
WP_025369289.1|2044927_2045503_+|tail	phage tail protein I	tail	A4JWL7	Burkholderia_virus	43.2	6.0e-32
WP_038712562.1|2045490_2046954_+	hypothetical protein	NA	A4JWL8	Burkholderia_virus	78.0	8.0e-214
WP_025369292.1|2046969_2047422_+|tail	tail assembly chaperone	tail	A4JWL9	Burkholderia_virus	76.8	7.0e-44
WP_025369293.1|2047487_2048657_+|tail	phage tail sheath family protein	tail	A0A2H4J869	uncultured_Caudovirales_phage	73.2	3.7e-161
WP_009964536.1|2048667_2049171_+|tail	phage major tail tube protein	tail	Q7M2A5	Pseudomonas_phage	50.0	1.2e-41
WP_004552769.1|2049240_2049543_+|tail	phage tail assembly protein	tail	V5YST8	Pseudomonas_phage	37.2	1.5e-05
WP_025369294.1|2049630_2052042_+|tail	phage tail tape measure protein	tail	A0A2H4JG00	uncultured_Caudovirales_phage	35.5	1.2e-62
WP_025369295.1|2052050_2052932_+|tail	phage tail protein	tail	A0A2H4J875	uncultured_Caudovirales_phage	37.4	3.9e-30
WP_004540041.1|2052906_2053113_+|tail	phage tail protein	tail	A0A2H4J9Z9	uncultured_Caudovirales_phage	61.2	4.0e-15
WP_025369296.1|2053122_2054175_+	phage late control D protein	NA	A0A2H4JBF6	uncultured_Caudovirales_phage	44.8	7.0e-79
WP_004533694.1|2054250_2054445_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025369297.1|2054437_2054980_+	lysozyme	NA	A4JX20	Burkholderia_virus	90.6	9.8e-85
WP_038712566.1|2054979_2055525_+	lysozyme	NA	Q8W6S5	Burkholderia_virus	95.0	1.0e-81
WP_025369299.1|2055668_2056457_+	DNA adenine methylase	NA	Q8W6S4	Burkholderia_virus	96.9	1.8e-151
WP_004539736.1|2056497_2057208_-	hypothetical protein	NA	A4PE26	Ralstonia_virus	41.5	1.4e-38
WP_038732294.1|2057219_2057735_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025369300.1|2057706_2058180_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025369301.1|2058172_2058679_-	DUF4123 domain-containing protein	NA	A4PE24	Ralstonia_virus	39.4	1.5e-18
WP_025369302.1|2058675_2059101_-	PAAR domain-containing protein	NA	A4JWV5	Burkholderia_virus	46.0	2.4e-14
WP_025369303.1|2059162_2059444_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009890265.1|2059443_2059908_-	hypothetical protein	NA	C7BGE3	Burkholderia_phage	60.4	9.7e-49
WP_024430645.1|2059989_2060559_+	DUF159 family protein	NA	A4JX27	Burkholderia_virus	82.3	2.0e-88
WP_144399193.1|2060856_2061327_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025369304.1|2061679_2062141_+	excisionase family DNA-binding protein	NA	K4ICM4	Acidithiobacillus_phage	62.1	8.4e-45
WP_143292436.1|2063123_2063426_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024430642.1|2063904_2065044_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_038712576.1|2065040_2065874_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009910405.1|2067497_2067770_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009890278.1|2068034_2068838_-	inositol monophosphatase	NA	NA	NA	NA	NA
WP_025404099.1|2069149_2070061_+	RNA methyltransferase	NA	NA	NA	NA	NA
WP_009890280.1|2070262_2071045_+	serine O-acetyltransferase	NA	NA	NA	NA	NA
WP_009890284.1|2071387_2072188_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_009890286.1|2072211_2072703_-	peptidyl-prolyl cis-trans isomerase	NA	A0A2H4UTF4	Bodo_saltans_virus	29.8	8.2e-06
WP_009890287.1|2072783_2073359_-	peptidyl-prolyl cis-trans isomerase	NA	A0A1V0SCU1	Indivirus	40.0	2.4e-12
WP_025369305.1|2073414_2074137_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_009890291.1|2074367_2075765_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	33.8	2.4e-42
WP_009890293.1|2075812_2076751_+	DNA-3-methyladenine glycosylase 2 family protein	NA	NA	NA	NA	NA
WP_009890295.1|2076853_2077825_+	acetyl-CoA carboxylase carboxyltransferase subunit alpha	NA	NA	NA	NA	NA
WP_011402215.1|2077868_2079353_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
2087484:2087503	attR	GCCGCGCGAGCAGGCGCGGC	NA	NA	NA	NA
>prophage 9
NZ_CP004383	Burkholderia thailandensis USAMRU Malaysia #20 chromosome 1, complete sequence	3862646	2887470	2960533	3862646	tRNA,transposase,coat	Stx2-converting_phage(23.08%)	60	NA	NA
WP_009891643.1|2887470_2890338_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	39.3	6.7e-148
WP_009891646.1|2890424_2891309_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	48.3	1.1e-69
WP_009891648.1|2891385_2891991_-	DUF4136 domain-containing protein	NA	NA	NA	NA	NA
WP_009891650.1|2892080_2894474_-	CHASE2 domain-containing protein	NA	NA	NA	NA	NA
WP_009891653.1|2894484_2895849_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_004193573.1|2895845_2896550_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_009891660.1|2896840_2897227_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004193727.1|2897485_2897716_-	sulfurtransferase TusA family protein	NA	NA	NA	NA	NA
WP_009891663.1|2897875_2898913_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_025369419.1|2898925_2899945_-	inositol 2-dehydrogenase	NA	NA	NA	NA	NA
WP_009891665.1|2899937_2900819_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_009891666.1|2901064_2902114_+	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_009891668.1|2902214_2903360_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_009891669.1|2903372_2904173_+	sugar ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.4	1.6e-14
WP_011402440.1|2904186_2906187_+	5-dehydro-2-deoxygluconokinase	NA	NA	NA	NA	NA
WP_043037268.1|2906197_2908201_+	3D-(3,5/4)-trihydroxycyclohexane-1,2-dione acylhydrolase (decyclizing)	NA	NA	NA	NA	NA
WP_009891675.1|2908197_2909118_+	myo-inosose-2 dehydratase	NA	NA	NA	NA	NA
WP_025369421.1|2909117_2909921_+	5-deoxy-glucuronate isomerase	NA	NA	NA	NA	NA
WP_009891678.1|2909985_2910690_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.8	8.7e-09
WP_009891679.1|2910686_2912912_-	branched-chain amino acid ABC transporter ATP-binding protein/permease	NA	A0A2R8FFL6	Cedratvirus	27.9	1.6e-08
WP_009891680.1|2912904_2913840_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_009909721.1|2913844_2914294_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_009891683.1|2914517_2915666_-	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_009891685.1|2915855_2916191_+	YbjQ family protein	NA	NA	NA	NA	NA
WP_009891687.1|2916283_2916838_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_011402443.1|2917300_2918809_-	PDZ domain-containing protein	NA	A0A1B1IT49	uncultured_Mediterranean_phage	25.2	1.5e-10
WP_080713200.1|2919360_2920887_-	YbfB/YjiJ family MFS transporter	NA	NA	NA	NA	NA
WP_009891696.1|2920971_2921937_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_009891699.1|2922375_2925000_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	39.2	7.1e-80
WP_009891700.1|2925441_2926662_+	CoA transferase	NA	NA	NA	NA	NA
WP_009909736.1|2926751_2927558_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038709125.1|2928088_2928298_-	ornithine acetyltransferase	NA	NA	NA	NA	NA
WP_009891706.1|2928578_2930288_+|tRNA	glutamine--tRNA ligase/YqeY domain fusion protein	tRNA	A0A222YZ70	Escherichia_phage	56.9	2.8e-186
WP_009891707.1|2930582_2931059_-	NUDIX hydrolase	NA	A0A2I6PFL2	Proteus_phage	41.3	2.0e-20
WP_009891709.1|2931077_2931464_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025369423.1|2931750_2933850_-	glycoside hydrolase family 3 protein	NA	NA	NA	NA	NA
WP_009905872.1|2933775_2933955_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009891712.1|2933951_2934812_+	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_009891714.1|2934857_2936249_-	cytochrome-c peroxidase	NA	NA	NA	NA	NA
WP_025369424.1|2936482_2938066_+	acid phosphatase	NA	NA	NA	NA	NA
WP_009891718.1|2938290_2939484_+	trans-2-enoyl-CoA reductase family protein	NA	NA	NA	NA	NA
WP_025369425.1|2939501_2940344_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_154660009.1|2940588_2940831_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009891722.1|2941041_2941674_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_025369426.1|2941674_2943747_-	response regulator	NA	A0A1V0SGR3	Hokovirus	25.9	5.0e-12
WP_009891727.1|2944157_2945123_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_025369427.1|2945138_2947550_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_009909750.1|2947594_2948434_-	molecular chaperone	NA	NA	NA	NA	NA
WP_009891731.1|2948451_2948976_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_009891732.1|2949058_2949619_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_025369429.1|2949671_2950217_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_009891734.1|2951019_2951913_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011402450.1|2952328_2953618_+	MFS transporter	NA	NA	NA	NA	NA
WP_009891736.1|2953662_2954589_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_009891740.1|2955074_2955356_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_009891742.1|2955555_2955819_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009891744.1|2956568_2957882_-	divalent metal cation transporter	NA	NA	NA	NA	NA
WP_038712718.1|2958180_2959752_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	53.6	3.3e-149
WP_009889515.1|2959781_2960129_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	72.0	2.1e-40
WP_009888727.1|2960125_2960533_-|transposase	transposase	transposase	A0A0P0ZBP6	Stx2-converting_phage	38.2	3.1e-14
>prophage 10
NZ_CP004383	Burkholderia thailandensis USAMRU Malaysia #20 chromosome 1, complete sequence	3862646	2990316	3092740	3862646	holin,capsid,head,terminase,portal,transposase,tail,plate,integrase	Burkholderia_virus(86.76%)	100	3038106:3038156	3092870:3092920
WP_009910382.1|2990316_2992167_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_009910381.1|2993659_2993878_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025369440.1|2994638_2996117_+	PHB depolymerase family esterase	NA	NA	NA	NA	NA
WP_009891799.1|2996420_2996756_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_009891801.1|2997072_2998359_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	71.8	2.3e-172
WP_025369441.1|2998491_2999397_-	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	75.1	1.7e-129
WP_043036943.1|3000457_3001849_+|integrase	integrase family protein	integrase	NA	NA	NA	NA
WP_025369442.1|3002472_3004530_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_025369443.1|3004532_3004973_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144241904.1|3004969_3005905_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080713203.1|3006124_3006547_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038712728.1|3007048_3007639_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025369446.1|3007793_3009530_-	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_080713204.1|3009554_3009779_-	CDI system lipoprotein BcpO	NA	NA	NA	NA	NA
WP_038712731.1|3009807_3010617_-	immunity 49 family protein	NA	NA	NA	NA	NA
WP_025369447.1|3010626_3020046_-	contact-dependent inhibition toxin BcpA	NA	A0A0R6PJK4	Moraxella_phage	30.9	4.4e-31
WP_025369449.1|3020973_3021201_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025369450.1|3021300_3022269_+	DUF932 domain-containing protein	NA	A0A0H4INH5	Stenotrophomonas_phage	42.3	6.3e-58
WP_038712736.1|3022532_3024104_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	53.6	7.4e-149
WP_038712740.1|3024133_3024481_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	71.0	2.3e-39
WP_009888727.1|3024477_3024885_-|transposase	transposase	transposase	A0A0P0ZBP6	Stx2-converting_phage	38.2	3.1e-14
WP_144241905.1|3024934_3026053_-	hypothetical protein	NA	NA	NA	NA	NA
WP_122813072.1|3026053_3026326_-	hypothetical protein	NA	NA	NA	NA	NA
WP_127462247.1|3026513_3027494_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009905986.1|3028195_3029026_-	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_009891863.1|3029608_3030517_+	aldose 1-epimerase	NA	NA	NA	NA	NA
WP_009891864.1|3030736_3031438_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A292GJG6	Xanthomonas_phage	45.8	3.8e-12
WP_009891866.1|3031786_3033412_+	AMP-binding protein	NA	A0A2H4PQU7	Staphylococcus_phage	34.6	5.6e-67
WP_009891867.1|3033677_3033995_+	DUF2288 domain-containing protein	NA	NA	NA	NA	NA
WP_009910378.1|3034002_3035394_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_038712744.1|3035618_3035807_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009891874.1|3036484_3037303_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_009891880.1|3037454_3037913_-	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
3038106:3038156	attL	CTGATTTGGGATCAGAGGGTCGTAGGTTCGAATCCTATCGCTCCGACCACT	NA	NA	NA	NA
WP_038713122.1|3038351_3039023_-	DUF159 family protein	NA	Q8W6R8	Burkholderia_virus	99.6	1.2e-135
WP_011325405.1|3039108_3039750_+	hypothetical protein	NA	Q8W6R9	Burkholderia_virus	100.0	1.2e-118
WP_004526688.1|3039882_3040974_-	DUF3396 domain-containing protein	NA	Q8W6S0	Burkholderia_virus	100.0	1.5e-212
WP_004552924.1|3041001_3041736_-	VRR-NUC domain-containing protein	NA	Q8W6S1	Burkholderia_virus	100.0	3.6e-138
WP_004552925.1|3041732_3042293_-	PAAR domain-containing protein	NA	Q8W6S2	Burkholderia_virus	100.0	7.5e-104
WP_004526687.1|3042474_3043209_-	hypothetical protein	NA	Q8W6S3	Burkholderia_virus	100.0	1.6e-130
WP_009896543.1|3043461_3044250_-	DNA adenine methylase	NA	Q8W6S4	Burkholderia_virus	99.6	1.5e-155
WP_038712746.1|3044393_3044939_-	lysozyme	NA	Q8W6S5	Burkholderia_virus	91.7	2.4e-78
WP_004552928.1|3044938_3045430_-	lysozyme	NA	Q6JIK8	Burkholderia_virus	100.0	7.8e-89
WP_004552929.1|3045422_3045635_-|holin	class II holin gp23	holin	Q8W6S7	Burkholderia_virus	100.0	6.6e-29
WP_004552930.1|3045677_3046412_-	hypothetical protein	NA	Q8W6S8	Burkholderia_virus	100.0	1.2e-146
WP_004552931.1|3046411_3046678_-	hypothetical protein	NA	Q8W6S9	Burkholderia_virus	100.0	2.5e-49
WP_015967365.1|3046722_3050028_-|tail	phage tail protein	tail	Q8W6T0	Burkholderia_virus	100.0	0.0e+00
WP_038712749.1|3050024_3050609_-|tail	tail assembly protein	tail	Q8W6T1	Burkholderia_virus	99.0	6.2e-101
WP_038712752.1|3050605_3051358_-	C40 family peptidase	NA	Q8W6T2	Burkholderia_virus	100.0	6.0e-149
WP_015967362.1|3051407_3052091_-|tail	phage minor tail protein L	tail	Q8W6T3	Burkholderia_virus	100.0	8.5e-134
WP_038712756.1|3052087_3053476_-|tail	tail fiber domain-containing protein	tail	Q8W6T4	Burkholderia_virus	99.8	7.9e-272
WP_004548805.1|3053484_3053823_-|tail	phage tail protein	tail	Q8W6T5	Burkholderia_virus	100.0	8.0e-61
WP_038712760.1|3053822_3057884_-|tail	phage tail tape measure protein	tail	Q8W6T6	Burkholderia_virus	98.6	0.0e+00
WP_009910356.1|3057897_3058182_-	DUF4035 domain-containing protein	NA	Q8W6T7	Burkholderia_virus	100.0	2.6e-44
WP_038712764.1|3058181_3058646_-|tail	tail assembly protein	tail	Q6JIM0	Burkholderia_virus	96.1	4.3e-81
WP_015967358.1|3058673_3059132_-	hypothetical protein	NA	Q8W6T9	Burkholderia_virus	100.0	2.2e-77
WP_004526671.1|3059193_3059541_-	DUF3168 domain-containing protein	NA	Q6JIM2	Burkholderia_virus	100.0	4.5e-59
WP_038712769.1|3059537_3059960_-	HK97 gp10 family phage protein	NA	A4JX05	Burkholderia_virus	98.6	5.0e-68
WP_015967355.1|3059952_3060279_-|head	phage head closure protein	head	Q8W6U2	Burkholderia_virus	100.0	1.2e-56
WP_038712773.1|3060278_3060845_-	hypothetical protein	NA	Q8W6U3	Burkholderia_virus	99.5	5.4e-102
WP_038712775.1|3060851_3061037_-	hypothetical protein	NA	Q8W6U4	Burkholderia_virus	93.4	2.1e-23
WP_038712777.1|3061096_3062404_-|capsid	phage major capsid protein	capsid	Q8W6U5	Burkholderia_virus	99.3	1.1e-227
WP_009910345.1|3062506_3063475_-	S49 family peptidase	NA	A4JX00	Burkholderia_virus	95.3	8.0e-162
WP_051716428.1|3063471_3064731_-|portal	phage portal protein	portal	Q8W6U7	Burkholderia_virus	99.8	4.7e-239
WP_009910343.1|3064735_3064921_-	hypothetical protein	NA	Q8W6U8	Burkholderia_virus	93.4	3.2e-19
WP_015967348.1|3064917_3066630_-|terminase	terminase large subunit	terminase	Q8W6U9	Burkholderia_virus	100.0	0.0e+00
WP_015967347.1|3066639_3067125_-|terminase	phage terminase small subunit P27 family	terminase	Q8W6V0	Burkholderia_virus	100.0	1.0e-88
WP_038712780.1|3067273_3067630_-	HNH endonuclease	NA	Q8W6N0	Burkholderia_virus	92.4	5.5e-60
WP_004549735.1|3067690_3067948_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	Q8W6N1	Burkholderia_virus	100.0	2.4e-41
WP_004548635.1|3067944_3068331_+	helix-turn-helix transcriptional regulator	NA	Q8W6N2	Burkholderia_virus	99.2	1.4e-64
WP_144241906.1|3068743_3069064_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144241907.1|3069158_3069533_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038712789.1|3069684_3071565_+	ATP-dependent endonuclease	NA	E5E3R2	Burkholderia_phage	76.8	3.8e-269
WP_038712792.1|3071567_3072770_+	DUF2130 domain-containing protein	NA	NA	NA	NA	NA
WP_080713205.1|3072838_3073129_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099005207.1|3073427_3074184_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_038712796.1|3074197_3074866_-	hypothetical protein	NA	Q8W6N4	Burkholderia_virus	95.7	6.6e-107
WP_015967397.1|3074874_3075135_-	hypothetical protein	NA	Q8W6N5	Burkholderia_virus	100.0	4.7e-45
WP_011401114.1|3075110_3075443_-	hypothetical protein	NA	Q8W6N6	Burkholderia_virus	100.0	1.8e-60
WP_009896497.1|3075882_3076239_-	hypothetical protein	NA	Q8W6N8	Burkholderia_virus	100.0	2.1e-59
WP_038712804.1|3076235_3076787_-	DUF1064 domain-containing protein	NA	A4JX56	Burkholderia_virus	94.5	4.9e-92
WP_038712807.1|3076783_3077776_-	hypothetical protein	NA	Q6JIG0	Burkholderia_virus	99.7	9.0e-177
WP_038712809.1|3077929_3078190_-	helix-turn-helix domain-containing protein	NA	Q6JIG2	Burkholderia_virus	69.8	8.4e-26
WP_038712811.1|3078186_3079008_-	hypothetical protein	NA	Q8W6P2	Burkholderia_virus	97.8	1.1e-143
WP_038712813.1|3079863_3080304_-	hypothetical protein	NA	Q6JIG6	Burkholderia_virus	87.7	2.0e-67
WP_038712815.1|3080518_3080737_+	hypothetical protein	NA	Q6JIG7	Burkholderia_virus	80.6	8.6e-24
WP_038712819.1|3080733_3081066_-	hypothetical protein	NA	Q6JIG8	Burkholderia_virus	90.9	6.7e-52
WP_144241908.1|3081327_3081783_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038713138.1|3082687_3083077_+	type II toxin-antitoxin system death-on-curing family toxin	NA	A0A222YZ88	Escherichia_phage	39.8	1.8e-16
WP_038712827.1|3083110_3083311_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144241909.1|3083459_3084092_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011401105.1|3084580_3084856_+	hypothetical protein	NA	Q8W6Q1	Burkholderia_virus	93.4	6.8e-42
WP_009896467.1|3085594_3086407_+	prohibitin family protein	NA	Q8W6Q7	Burkholderia_virus	94.4	2.7e-139
WP_009896465.1|3086668_3087376_+	hypothetical protein	NA	Q8W6Q8	Burkholderia_virus	99.1	2.9e-121
WP_015967379.1|3087389_3088061_+	hypothetical protein	NA	Q8W6Q9	Burkholderia_virus	100.0	1.4e-125
WP_038713142.1|3088063_3088459_+	hypothetical protein	NA	Q8W6R0	Burkholderia_virus	99.2	8.5e-70
WP_038712832.1|3088458_3088737_+	hypothetical protein	NA	Q6JII7	Burkholderia_virus	85.9	3.5e-38
WP_015967374.1|3089800_3090793_+	phage Gp37/Gp68 family protein	NA	Q8W6R4	Burkholderia_virus	100.0	5.4e-206
WP_015967373.1|3090789_3091290_+	hypothetical protein	NA	Q8W6R5	Burkholderia_virus	100.0	1.9e-90
WP_038712837.1|3091415_3091640_+	DUF4224 domain-containing protein	NA	Q8W6R6	Burkholderia_virus	100.0	1.0e-35
WP_015967371.1|3091639_3092740_+|integrase	tyrosine-type recombinase/integrase	integrase	Q8W6R7	Burkholderia_virus	100.0	1.9e-215
3092870:3092920	attR	CTGATTTGGGATCAGAGGGTCGTAGGTTCGAATCCTATCGCTCCGACCACT	NA	NA	NA	NA
>prophage 11
NZ_CP004383	Burkholderia thailandensis USAMRU Malaysia #20 chromosome 1, complete sequence	3862646	3613493	3624375	3862646	protease	Agrobacterium_phage(16.67%)	9	NA	NA
WP_009892610.1|3613493_3615794_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	41.9	5.1e-167
WP_009892611.1|3615790_3616105_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A218MMY6	uncultured_virus	44.6	2.6e-13
WP_004196460.1|3616635_3616839_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	81.8	6.8e-23
WP_009892613.1|3616950_3618546_-	multicopper oxidase family protein	NA	NA	NA	NA	NA
WP_009892614.1|3618707_3619967_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	63.0	6.8e-12
WP_009892615.1|3620231_3620810_+	pseudouridine synthase	NA	NA	NA	NA	NA
WP_080511442.1|3621070_3621286_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011401863.1|3621481_3621997_+	DUF192 domain-containing protein	NA	A0A1B1IUW8	uncultured_Mediterranean_phage	41.2	1.5e-13
WP_009892620.1|3622260_3624375_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	26.8	1.2e-56
>prophage 1
NZ_CP004384	Burkholderia thailandensis USAMRU Malaysia #20 chromosome 2, complete sequence	2821713	1560493	1566559	2821713	integrase	Burkholderia_virus(28.57%)	8	1555353:1555368	1575714:1575729
1555353:1555368	attL	ATTCGGACGAGGCGGA	NA	NA	NA	NA
WP_009893915.1|1560493_1561066_+|integrase	site-specific integrase	integrase	A0A1W6JTA0	Pseudomonas_phage	65.9	1.7e-55
WP_011401460.1|1561684_1562182_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011401461.1|1562610_1563027_-	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0A8JBA5	Ralstonia_phage	58.9	1.2e-26
WP_009893919.1|1563070_1563250_-	type II toxin-antitoxin system HicA family toxin	NA	A0A0D4DC32	Acinetobacter_phage	74.6	1.2e-18
WP_011401462.1|1563529_1564057_+	hypothetical protein	NA	A4JWV5	Burkholderia_virus	66.1	6.2e-60
WP_011401463.1|1564053_1564788_+	VRR-NUC domain-containing protein	NA	A4JWV4	Burkholderia_virus	50.9	3.0e-52
WP_009893924.1|1564797_1565913_+	DUF3396 domain-containing protein	NA	E5E3X7	Burkholderia_phage	80.4	8.6e-176
WP_009893925.1|1565983_1566559_-	recombinase family protein	NA	A0A219Y9V9	Aeromonas_phage	39.0	2.3e-23
1575714:1575729	attR	ATTCGGACGAGGCGGA	NA	NA	NA	NA
>prophage 2
NZ_CP004384	Burkholderia thailandensis USAMRU Malaysia #20 chromosome 2, complete sequence	2821713	2119218	2197133	2821713	transposase,plate,holin	Ralstonia_phage(42.86%)	58	NA	NA
WP_009894648.1|2119218_2121414_+|holin	phospholipase C, phosphocholine-specific	holin	NA	NA	NA	NA
WP_009894655.1|2123128_2124145_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_009894657.1|2124163_2124616_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_009894659.1|2125151_2125997_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_009907076.1|2125983_2126838_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_009894662.1|2126834_2127866_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_009894663.1|2128414_2129485_-|transposase	IS5 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	43.4	3.6e-62
WP_009894664.1|2129644_2129950_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_011400785.1|2130271_2133052_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	34.2	1.8e-89
WP_025370043.1|2133065_2135306_+	DUF3274 domain-containing protein	NA	A0A077K801	Ralstonia_phage	28.9	4.0e-23
WP_011400791.1|2135444_2136980_+	DUF2875 family protein	NA	NA	NA	NA	NA
WP_025370045.1|2136989_2137253_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_080713257.1|2138088_2139579_+	DUF3274 domain-containing protein	NA	A0A077K801	Ralstonia_phage	28.4	1.0e-06
WP_025370050.1|2139717_2141256_+	DUF2875 family protein	NA	NA	NA	NA	NA
WP_009894681.1|2141265_2141529_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_004523721.1|2141943_2142363_-	YjbQ family protein	NA	NA	NA	NA	NA
WP_009894689.1|2142382_2142709_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_004523719.1|2143181_2143874_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009894695.1|2144683_2145040_-	DUF4148 domain-containing protein	NA	NA	NA	NA	NA
WP_041223675.1|2145514_2146657_-	porin	NA	NA	NA	NA	NA
WP_009907082.1|2147288_2148212_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_009894700.1|2148773_2149097_-	hypothetical protein	NA	NA	NA	NA	NA
WP_127446348.1|2149285_2149597_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009894702.1|2149724_2149970_-	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_009894703.1|2150102_2151302_-	transcriptional regulator CynR	NA	NA	NA	NA	NA
WP_025370053.1|2151301_2152726_-	TolC family protein	NA	NA	NA	NA	NA
WP_009894706.1|2152719_2153619_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_009894707.1|2153620_2153845_-	DUF1656 domain-containing protein	NA	NA	NA	NA	NA
WP_041223677.1|2153841_2155908_-	FUSC family protein	NA	NA	NA	NA	NA
WP_025370055.1|2156917_2158459_-	membrane protein	NA	NA	NA	NA	NA
WP_154660021.1|2158806_2159163_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025370056.1|2160007_2162491_+	hypothetical protein	NA	K4F7R4	Cronobacter_phage	46.1	9.0e-08
WP_025370057.1|2162566_2164018_-	PhoPQ-regulated protein	NA	NA	NA	NA	NA
WP_009907087.1|2164268_2164667_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011400800.1|2165448_2166003_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_011400801.1|2166084_2166810_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_162465482.1|2166858_2167017_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009894721.1|2166969_2169666_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_009894722.1|2169685_2170231_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_009907089.1|2170261_2170951_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_009894727.1|2170953_2172630_+	OmpA family protein	NA	NA	NA	NA	NA
WP_009894728.1|2172973_2173513_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_009894729.1|2173546_2175046_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_009894730.1|2175246_2175729_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_011400803.1|2175856_2176399_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_009894732.1|2176404_2177754_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_009894733.1|2177750_2179052_+	type VI secretion system protein TssL	NA	NA	NA	NA	NA
WP_009894736.1|2179066_2182975_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_009894738.1|2183144_2183714_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041223680.1|2183814_2186421_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	26.0	1.8e-35
WP_004523693.1|2186495_2186765_+	PAAR motif protein	NA	NA	NA	NA	NA
WP_025370061.1|2186777_2190230_+	RHS repeat protein	NA	NA	NA	NA	NA
WP_038707671.1|2190122_2191481_-	hypothetical protein	NA	A0A292GJ55	Xanthomonas_phage	49.7	2.6e-110
WP_009894750.1|2191513_2192542_-	fimbrial protein	NA	NA	NA	NA	NA
WP_009894751.1|2192597_2193668_-	type VI secretion protein ImpA	NA	NA	NA	NA	NA
WP_025370062.1|2193686_2194736_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_009894755.1|2194732_2196613_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_009894757.1|2196614_2197133_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
