The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP003923	Bacillus lehensis G1 chromosome, complete genome	3993073	994998	1003412	3993073		Synechococcus_phage(33.33%)	8	NA	NA
WP_038477863.1|994998_996297_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	26.5	1.0e-18
WP_038477866.1|996325_997036_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	M4R1E8	Synechococcus_phage	43.7	1.3e-47
WP_038477869.1|997244_997496_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_038477872.1|997492_998176_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_038477875.1|998159_1000382_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	41.3	2.4e-161
WP_038477878.1|1000357_1001770_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	34.9	1.5e-52
WP_038477880.1|1001793_1002831_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	44.2	2.4e-63
WP_038477882.1|1002827_1003412_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	35.3	3.5e-27
>prophage 2
NZ_CP003923	Bacillus lehensis G1 chromosome, complete genome	3993073	2048965	2058397	3993073		Staphylococcus_phage(42.86%)	10	NA	NA
WP_038480398.1|2048965_2050627_+	AarF/ABC1/UbiB kinase family protein	NA	E5EQY1	Bathycoccus_sp._RCC1105_virus	29.5	2.3e-39
WP_124742166.1|2050656_2052117_+	cardiolipin synthase	NA	NA	NA	NA	NA
WP_038480401.1|2052215_2053076_-	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	39.9	1.1e-34
WP_038480404.1|2053195_2053780_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	33.9	1.3e-13
WP_038480407.1|2053769_2054531_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	27.5	8.5e-10
WP_078440107.1|2054615_2055098_+	DUF309 domain-containing protein	NA	NA	NA	NA	NA
WP_038480409.1|2055115_2055910_-	formate/nitrite transporter family protein	NA	NA	NA	NA	NA
WP_038480412.1|2056057_2056528_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	57.4	4.7e-43
WP_038480415.1|2056541_2057735_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	54.1	6.2e-116
WP_038480418.1|2057749_2058397_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	42.5	1.1e-37
>prophage 3
NZ_CP003923	Bacillus lehensis G1 chromosome, complete genome	3993073	2704055	2717528	3993073	tRNA	Staphylococcus_phage(88.89%)	12	NA	NA
WP_038482075.1|2704055_2705318_+	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2H4PQX1	Staphylococcus_phage	59.8	2.3e-23
WP_038482078.1|2705353_2707768_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	72.3	0.0e+00
WP_038482081.1|2708111_2709311_-	MFS transporter	NA	A0A2H4PQR6	Staphylococcus_phage	46.5	2.9e-89
WP_038482084.1|2709464_2710415_+	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	67.2	3.6e-50
WP_038482087.1|2710411_2710984_+	class I SAM-dependent methyltransferase	NA	A0A2H4PQV0	Staphylococcus_phage	49.7	6.4e-42
WP_038482090.1|2710999_2711566_+	carbonic anhydrase	NA	NA	NA	NA	NA
WP_038482093.1|2711530_2711752_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038482096.1|2711804_2712587_-	alpha/beta hydrolase	NA	Q9DHU9	Yaba-like_disease_virus	26.2	3.0e-10
WP_038482099.1|2712676_2713189_+	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_038482102.1|2713258_2714458_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	74.9	5.2e-163
WP_038482105.1|2715145_2716726_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	58.9	2.4e-176
WP_038482108.1|2716742_2717528_-	S9 family peptidase	NA	A0A2H4PQM6	Staphylococcus_phage	40.8	5.1e-34
>prophage 4
NZ_CP003923	Bacillus lehensis G1 chromosome, complete genome	3993073	2744008	2787343	3993073	terminase,portal,tail,integrase,head,protease,holin,capsid	Bacillus_phage(48.39%)	63	2743773:2743826	2787497:2787550
2743773:2743826	attL	CTGCCAGCGAAGCGCTCTCCCAGCTGAGCTAAGGCCCCTTGTTTAGTATGTTAA	NA	NA	NA	NA
WP_038482173.1|2744008_2744449_-	transcriptional regulator	NA	A0A0S2SXN1	Bacillus_phage	49.3	3.3e-30
WP_038482176.1|2744461_2744662_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148305187.1|2744666_2744858_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038482182.1|2744857_2745448_-	dUTP diphosphatase	NA	R9TQ23	Paenibacillus_phage	50.5	5.6e-41
WP_038482185.1|2745444_2745723_-	hypothetical protein	NA	R4JGP0	Bacillus_phage	37.1	4.6e-06
WP_038482188.1|2745770_2746016_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158318538.1|2746027_2746192_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038482191.1|2746551_2746794_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038482195.1|2746819_2747236_-	hypothetical protein	NA	R4IDY1	Listeria_phage	36.4	2.1e-18
WP_038482197.1|2747274_2747577_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038482200.1|2747606_2747834_-	hypothetical protein	NA	NA	NA	NA	NA
WP_084167498.1|2747935_2748208_-	DUF3310 domain-containing protein	NA	I1TLI0	Bacillus_phage	53.1	1.4e-10
WP_038482203.1|2748209_2748479_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148305188.1|2748475_2749012_-	nuclease	NA	A0A0S2SXQ1	Bacillus_phage	68.0	4.7e-63
WP_038482209.1|2749019_2749535_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038482212.1|2749538_2749973_-	hypothetical protein	NA	A0A0S2SXU2	Bacillus_phage	38.1	2.6e-19
WP_038482215.1|2750196_2752557_-	DNA primase	NA	D6R422	Bacillus_phage	61.6	4.3e-286
WP_038482217.1|2752614_2753046_-	DUF669 domain-containing protein	NA	Q9ZXC5	Bacillus_phage	46.9	1.0e-31
WP_038482220.1|2753058_2753982_-	AAA family ATPase	NA	A0A0S2SY47	Bacillus_phage	65.2	1.6e-111
WP_038482223.1|2753993_2754542_-	host-nuclease inhibitor Gam family protein	NA	A0A0S2SXN7	Bacillus_phage	45.9	7.7e-37
WP_180316747.1|2754619_2754772_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038482226.1|2754758_2755103_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038482229.1|2755103_2755415_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038482231.1|2755564_2755792_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_051667587.1|2756067_2756472_+	helix-turn-helix domain-containing protein	NA	S6C481	Thermus_phage	45.2	2.4e-11
WP_158318539.1|2756669_2756957_+	helix-turn-helix transcriptional regulator	NA	A0A1L2JY18	Aeribacillus_phage	39.6	7.1e-10
WP_038482237.1|2757240_2758359_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038485950.1|2758511_2759102_-	replication-relaxation family protein	NA	A0A1B1P7T2	Bacillus_phage	47.1	1.3e-42
WP_051667589.1|2759094_2760279_-	hypothetical protein	NA	Q0H250	Geobacillus_phage	42.1	2.2e-73
WP_038482239.1|2760290_2760530_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038482242.1|2760886_2761111_+	hypothetical protein	NA	S5MBY6	Brevibacillus_phage	39.2	1.9e-10
WP_038482245.1|2761191_2761680_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038482248.1|2761770_2762139_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051667590.1|2762355_2762991_+	DUF4352 domain-containing protein	NA	E5DV69	Deep-sea_thermophilic_phage	41.0	5.6e-23
WP_051667591.1|2763062_2764013_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1L2JY70	Aeribacillus_phage	53.3	1.5e-48
WP_038482251.1|2764015_2764258_-|holin	phage holin	holin	M4ZR48	Bacillus_phage	57.1	1.6e-15
WP_038482254.1|2764270_2764525_-	hemolysin XhlA family protein	NA	A0A2H4JD40	uncultured_Caudovirales_phage	45.1	3.1e-09
WP_038482257.1|2764568_2765996_-|tail	phage tail protein	tail	A0A0U4JID8	Exiguobacterium_phage	28.7	7.4e-31
WP_038482260.1|2766009_2766609_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038482263.1|2766871_2767105_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038482270.1|2767115_2769308_-	right-handed parallel beta-helix repeat-containing protein	NA	NA	NA	NA	NA
WP_051667592.1|2769319_2770159_-|tail	phage tail family protein	tail	A0A0U4B037	Exiguobacterium_phage	32.5	1.0e-24
WP_051667593.1|2770162_2774461_-|tail	phage tail tape measure protein	tail	D6R3Z8	Bacillus_phage	52.5	5.4e-101
WP_038482273.1|2774479_2774692_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038482276.1|2774706_2775069_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051667594.1|2775190_2775772_-	hypothetical protein	NA	A0A0K2CZP8	Paenibacillus_phage	30.3	1.3e-18
WP_038482279.1|2775784_2776138_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051667595.1|2776134_2776539_-	HK97 gp10 family phage protein	NA	NA	NA	NA	NA
WP_158318540.1|2776543_2776900_-|head,tail	head-tail adaptor protein	head,tail	NA	NA	NA	NA
WP_051667596.1|2776874_2777174_-|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
WP_051667597.1|2777163_2777616_-	Ig-like domain-containing protein	NA	NA	NA	NA	NA
WP_038482288.1|2777697_2778951_-|capsid	phage major capsid protein	capsid	A0A0A7RTL2	Clostridium_phage	44.5	2.2e-87
WP_038482291.1|2778993_2779626_-|head,protease	HK97 family phage prohead protease	head,protease	Q9ZXF7	Bacillus_phage	67.8	7.0e-74
WP_038482294.1|2779582_2780872_-|portal	phage portal protein	portal	D6R3Y6	Bacillus_phage	59.7	4.5e-144
WP_038482297.1|2780876_2781077_-	hypothetical protein	NA	Q9ZXF9	Bacillus_phage	60.7	1.1e-09
WP_038482300.1|2781085_2782780_-|terminase	terminase large subunit	terminase	A6M948	Geobacillus_virus	50.8	3.0e-164
WP_038482303.1|2782776_2783253_-|terminase	phage terminase small subunit P27 family	terminase	A6M947	Geobacillus_virus	36.3	4.4e-20
WP_038482305.1|2783631_2784033_-	HNH endonuclease	NA	A0A2H4J3B4	uncultured_Caudovirales_phage	51.1	7.4e-29
WP_038482308.1|2784010_2784256_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038482311.1|2784262_2784667_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038482314.1|2784734_2785529_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038482316.1|2785637_2785991_-	hypothetical protein	NA	NA	NA	NA	NA
WP_084167502.1|2786287_2787343_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
2787497:2787550	attR	CTGCCAGCGAAGCGCTCTCCCAGCTGAGCTAAGGCCCCTTGTTTAGTATGTTAA	NA	NA	NA	NA
>prophage 5
NZ_CP003923	Bacillus lehensis G1 chromosome, complete genome	3993073	3402796	3409238	3993073		Escherichia_phage(33.33%)	7	NA	NA
WP_038483690.1|3402796_3403015_+	helix-turn-helix transcriptional regulator	NA	A0A0A7RUJ5	Clostridium_phage	42.4	1.7e-08
WP_038483692.1|3403120_3404215_-	Ig-like domain repeat protein	NA	NA	NA	NA	NA
WP_038483694.1|3404532_3405903_-	cupin domain-containing protein	NA	A0A1V0SH58	Hokovirus	28.6	6.8e-42
WP_038483696.1|3405921_3406764_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	40.6	2.0e-39
WP_038483698.1|3406756_3407776_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	46.1	7.5e-78
WP_038483700.1|3407775_3408339_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	46.7	2.3e-36
WP_038483702.1|3408335_3409238_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	K7QKA7	Escherichia_phage	66.7	1.3e-105
>prophage 6
NZ_CP003923	Bacillus lehensis G1 chromosome, complete genome	3993073	3698599	3710175	3993073	tail	Geobacillus_phage(85.71%)	9	NA	NA
WP_124742855.1|3698599_3699799_-	ornithine--oxo-acid transaminase	NA	A0A1V0SKB7	Klosneuvirus	29.6	5.4e-35
WP_038484336.1|3699911_3701135_+	MFS transporter	NA	NA	NA	NA	NA
WP_038484339.1|3701155_3702208_-	hypothetical protein	NA	W8EIX3	Geobacillus_phage	31.6	1.2e-30
WP_038486328.1|3702232_3705076_-	glycoside hydrolase	NA	W8EK73	Geobacillus_phage	39.2	4.5e-189
WP_038484342.1|3705078_3705924_-	hypothetical protein	NA	W8EBC9	Geobacillus_phage	41.1	1.6e-49
WP_035398992.1|3705916_3706102_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038484346.1|3706133_3707627_-|tail	phage tail protein	tail	W8EEW0	Geobacillus_phage	51.1	2.0e-140
WP_038484349.1|3707636_3708386_-|tail	phage tail family protein	tail	W8EK66	Geobacillus_phage	43.8	6.3e-58
WP_038484352.1|3708387_3710175_-	hypothetical protein	NA	W8EBC4	Geobacillus_phage	41.7	2.1e-19
