The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP007409	Bacillus subtilis subsp. subtilis str. OH 131.1 strain OH131.1 chromosome, complete genome	4039155	652607	660973	4039155		Synechococcus_phage(50.0%)	8	NA	NA
WP_015715438.1|652607_653903_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	25.7	4.5e-19
WP_029726599.1|653976_654702_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3G7P8	Synechococcus_phage	44.1	1.2e-45
WP_003219409.1|654694_654949_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_029726600.1|654945_655629_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_029726601.1|655612_657841_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	40.0	7.2e-158
WP_003233947.1|657816_659247_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.5	1.2e-52
WP_003233945.1|659348_660389_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	42.0	2.8e-64
WP_015252651.1|660385_660973_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	41.0	2.4e-28
>prophage 2
NZ_CP007409	Bacillus subtilis subsp. subtilis str. OH 131.1 strain OH131.1 chromosome, complete genome	4039155	1150300	1194498	4039155	coat,tRNA	Planktothrix_phage(25.0%)	49	NA	NA
WP_003232972.1|1150300_1150540_-|coat	spore coat protein YjzB	coat	NA	NA	NA	NA
WP_003232971.1|1150704_1151643_+	beta-ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_003244890.1|1151665_1152907_+	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_003232967.1|1152982_1153768_+	DUF2268 domain-containing protein	NA	NA	NA	NA	NA
WP_003232965.1|1153959_1154946_+	oligopeptide ABC transporter ATP-binding protein AppD	NA	G9BWD6	Planktothrix_phage	32.9	5.7e-22
WP_003232964.1|1154942_1155932_+	oligopeptide ABC transporter ATP-binding protein AppF	NA	F2Y302	Organic_Lake_phycodnavirus	26.1	6.7e-07
WP_003245082.1|1156019_1157651_+	oligopeptide-binding protein AppA	NA	NA	NA	NA	NA
WP_003245828.1|1157726_1158677_+	oligopeptide ABC transporter permease AppB	NA	NA	NA	NA	NA
WP_003232961.1|1158693_1159605_+	oligopeptide ABC transporter permease AppC	NA	NA	NA	NA	NA
WP_003239298.1|1159809_1160562_+	YjbA family protein	NA	A0A0A0RP53	Bacillus_phage	43.9	5.4e-49
WP_003245134.1|1160596_1161589_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_003232957.1|1162332_1163970_+	oligopeptide ABC transporter substrate-binding protein OppA	NA	NA	NA	NA	NA
WP_003245554.1|1164077_1165013_+	oligopeptide ABC transporter permease OppB	NA	NA	NA	NA	NA
WP_003232954.1|1165016_1165934_+	oligopeptide ABC transporter permease OppC	NA	NA	NA	NA	NA
WP_014906294.1|1165938_1167015_+	oligopeptide ABC transporter ATP-binding protein OppD	NA	G9BWD6	Planktothrix_phage	30.8	2.1e-17
WP_003245567.1|1167016_1167934_+	oligopeptide ABC transporter ATP-binding protein OppF	NA	M1HP82	Acanthocystis_turfacea_Chlorella_virus	24.6	1.2e-05
WP_010886478.1|1168040_1169258_+	MFS transporter	NA	NA	NA	NA	NA
WP_003244921.1|1169421_1170000_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003245483.1|1170180_1170576_+	transcriptional regulator Spx	NA	NA	NA	NA	NA
WP_003232944.1|1170618_1171275_-	TerC family protein	NA	A0A2R2YAT9	Pseudomonas_phage	38.0	1.1e-29
WP_121572562.1|1171444_1171585_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015383354.1|1171551_1172208_+	adaptor protein MecA	NA	NA	NA	NA	NA
WP_029726275.1|1172367_1173519_+	competence protein CoiA	NA	NA	NA	NA	NA
WP_009967010.1|1173565_1175578_+	oligoendopeptidase F	NA	NA	NA	NA	NA
WP_003244944.1|1175615_1175783_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003245184.1|1176097_1176997_-	adaptor protein SpxH	NA	NA	NA	NA	NA
WP_003232928.1|1176993_1177392_-	group 2 truncated hemoglobin YjbI	NA	NA	NA	NA	NA
WP_072692654.1|1177646_1178192_-	bifunctional muramidase/murein lytic transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	60.4	3.7e-39
WP_014479452.1|1178395_1178968_-	CYTH domain-containing protein	NA	NA	NA	NA	NA
WP_038427600.1|1179092_1179461_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003245294.1|1179489_1180125_+	GTP diphosphokinase	NA	NA	NA	NA	NA
WP_003232918.1|1180143_1180944_+	NAD kinase	NA	NA	NA	NA	NA
WP_010886481.1|1181006_1181858_+	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_003244765.1|1181870_1182605_-	bis(5'-nucleosyl)-tetraphosphatase PrpE	NA	M4Q4T6	Vibrio_phage	25.0	3.2e-06
WP_003232910.1|1182839_1184684_+	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_003232909.1|1184932_1185643_+	thiaminase II	NA	NA	NA	NA	NA
WP_003232908.1|1185617_1186235_+	thiazole tautomerase TenI	NA	NA	NA	NA	NA
WP_029726273.1|1186218_1187328_+	glycine oxidase ThiO	NA	NA	NA	NA	NA
WP_072173897.1|1187327_1187528_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_003232902.1|1187524_1188295_+	thiazole synthase	NA	NA	NA	NA	NA
WP_003232900.1|1188291_1189302_+	thiazole biosynthesis adenylyltransferase ThiF	NA	NA	NA	NA	NA
WP_014479462.1|1189320_1190136_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_003232896.1|1190271_1191048_+	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_072692635.1|1191148_1191832_+|coat	spore coat protein CotO	coat	NA	NA	NA	NA
WP_014479464.1|1191924_1192374_-|coat	spore coat protein CotZ	coat	NA	NA	NA	NA
WP_038427601.1|1192501_1192990_-|coat	spore coat protein CotY	coat	NA	NA	NA	NA
WP_015252341.1|1193141_1193654_-|coat	Spore coat protein X	coat	NA	NA	NA	NA
WP_015252340.1|1193748_1194072_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029726269.1|1194111_1194498_-|coat	spore coat protein	coat	NA	NA	NA	NA
>prophage 3
NZ_CP007409	Bacillus subtilis subsp. subtilis str. OH 131.1 strain OH131.1 chromosome, complete genome	4039155	1258891	1294018	4039155	holin,portal,terminase,tail,plate	Bacillus_phage(27.27%)	46	NA	NA
WP_003245490.1|1258891_1260163_+	ATPase YjoB	NA	A0A1V0SEI6	Indivirus	37.1	8.6e-15
WP_010886491.1|1260307_1261444_+	response regulator aspartate phosphatase RapA	NA	A0A1P8CWN8	Bacillus_phage	47.4	8.3e-94
WP_003245487.1|1261433_1261568_+	phosphatase RapA inhibitor PhrA	NA	NA	NA	NA	NA
WP_003232731.1|1261598_1261856_-	YciI family protein	NA	NA	NA	NA	NA
WP_003244876.1|1261976_1262930_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A218KC88	Bacillus_phage	74.1	7.3e-67
WP_003245254.1|1262969_1263347_-	PH domain-containing protein	NA	A5GYQ0	Lactococcus_phage	42.3	6.1e-17
WP_003244789.1|1263452_1264055_+	poly-gamma-glutamate hydrolase family protein	NA	F8WQ53	Bacillus_phage	49.2	3.8e-45
WP_003245071.1|1264131_1264968_+	manganese catalase	NA	NA	NA	NA	NA
WP_003232721.1|1265011_1265608_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4JA43	uncultured_Caudovirales_phage	51.7	8.1e-40
WP_003232719.1|1265770_1266112_-	helix-turn-helix transcriptional regulator	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	45.8	1.3e-18
WP_003232712.1|1266289_1266469_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003245799.1|1266455_1267292_+	phage-like element PBSX protein XkdB	NA	S6BFM4	Thermus_phage	28.2	1.8e-24
WP_010886492.1|1267191_1267992_+	ATP-binding protein	NA	A6XMI1	Bacillus_virus	51.7	5.0e-61
WP_003245588.1|1267991_1268159_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003245290.1|1268243_1268594_+	phage-like element PBSX protein XkdD	NA	NA	NA	NA	NA
WP_003244900.1|1268590_1268797_+	phage-like element PBSX protein XtrA	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	50.0	1.6e-11
WP_003245797.1|1268912_1269422_+	sigma-70 family RNA polymerase sigma factor	NA	A0A1L2JY33	Aeribacillus_phage	38.6	1.9e-21
WP_003244697.1|1269537_1270335_+|terminase	PBSX phage terminase small subunit	terminase	A0A0S2MVB6	Bacillus_phage	50.2	8.0e-59
WP_003245584.1|1270331_1271633_+|terminase	PBSX family phage terminase large subunit	terminase	A0A2P1JTW5	Anoxybacillus_phage	60.2	2.4e-153
WP_003245427.1|1271636_1273124_+|portal	phage portal protein	portal	A0A1B1P7C8	Bacillus_phage	55.7	1.7e-139
WP_003245836.1|1273143_1273971_+	phage-like element PBSX protein XkdF	NA	A0A1B1P7E4	Bacillus_phage	58.7	2.1e-54
WP_003232690.1|1273996_1274932_+	phage-like element PBSX protein XkdG	NA	A0A1B1P7E3	Bacillus_phage	63.8	1.1e-104
WP_014479552.1|1274953_1275337_+	DUF3199 family protein	NA	A0A1B1P7D6	Bacillus_phage	40.5	1.4e-13
WP_009967053.1|1275333_1275690_+	YqbH/XkdH family protein	NA	NA	NA	NA	NA
WP_003245226.1|1275686_1276172_+	HK97 gp10 family phage protein	NA	A0A249XXA4	Clostridium_phage	47.0	2.1e-38
WP_029726235.1|1276184_1276625_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003232679.1|1276628_1276847_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003245369.1|1276843_1278244_+	phage-like element PBSX protein XkdK	NA	A0A0A7S087	Clostridium_phage	39.3	2.3e-77
WP_003232677.1|1278245_1278689_+|tail	phage tail tube protein	tail	A0A0K2CNG3	Brevibacillus_phage	45.2	8.4e-26
WP_015715734.1|1278779_1279226_+|portal	phage portal protein	portal	A0A0A7RTY8	Clostridium_phage	37.7	5.9e-11
WP_072692631.1|1279267_1279408_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038427611.1|1279408_1284418_+	transglycosylase SLT domain-containing protein	NA	A0A1L2JY60	Aeribacillus_phage	43.8	1.1e-41
WP_029727048.1|1284410_1285070_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A0A8WJR4	Clostridium_phage	33.2	1.1e-24
WP_003245730.1|1285085_1286063_+	phage-like element PBSX protein XkdQ	NA	H7BV96	unidentified_phage	32.6	1.0e-39
WP_015715735.1|1286062_1286329_+	DUF2577 family protein	NA	S6C459	Thermus_phage	36.4	1.7e-05
WP_015715736.1|1286386_1286812_+	DUF2634 domain-containing protein	NA	A0A2H4J6K5	uncultured_Caudovirales_phage	38.0	6.6e-12
WP_015715737.1|1286804_1287851_+|plate	baseplate J/gp47 family protein	plate	S6AVU3	Thermus_phage	44.0	2.4e-71
WP_015483131.1|1287834_1288413_+	YmfQ family protein	NA	A0A2H4J717	uncultured_Caudovirales_phage	33.1	5.1e-15
WP_015715738.1|1288409_1288682_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029727047.1|1288684_1291126_+	hypothetical protein	NA	A0A2H4J4R1	uncultured_Caudovirales_phage	35.2	1.1e-21
WP_029727046.1|1291143_1291470_+|portal	phage portal protein	portal	NA	NA	NA	NA
WP_014479563.1|1291466_1291631_+	XkdX family protein	NA	A0A2H4JAA1	uncultured_Caudovirales_phage	67.9	1.9e-15
WP_029727045.1|1291674_1292514_+	phage-like element PBSX protein XepA	NA	NA	NA	NA	NA
WP_015252265.1|1292566_1292836_+	hypothetical protein	NA	A0A2H4JD40	uncultured_Caudovirales_phage	64.8	4.8e-24
WP_014479566.1|1292848_1293112_+|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	64.4	6.1e-24
WP_029727044.1|1293124_1294018_+	LysM peptidoglycan-binding domain-containing protein	NA	Q9ZXD7	Bacillus_phage	68.8	2.0e-82
>prophage 4
NZ_CP007409	Bacillus subtilis subsp. subtilis str. OH 131.1 strain OH131.1 chromosome, complete genome	4039155	1804095	1900133	4039155	coat,protease,integrase,tRNA,head,holin,portal,terminase,tail,plate,capsid	Bacillus_phage(69.05%)	104	1810467:1810486	1895210:1895229
WP_029726462.1|1804095_1805424_-|protease	serine protease AprX	protease	A0A1B0T6A2	Bacillus_phage	33.2	1.6e-27
WP_014476869.1|1805648_1805882_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003245758.1|1806161_1806869_+	poly-gamma-glutamate hydrolase family protein	NA	F8WQ53	Bacillus_phage	56.9	3.2e-51
WP_003245175.1|1806938_1807391_+	OsmC family protein	NA	NA	NA	NA	NA
WP_003245163.1|1807404_1807758_-	multidrug efflux SMR transporter subunit EbrB	NA	NA	NA	NA	NA
WP_009967307.1|1807771_1808089_-	multidrug efflux SMR transporter subunit EbrA	NA	NA	NA	NA	NA
WP_029317825.1|1808224_1808500_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003231769.1|1808588_1809002_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029726461.1|1809101_1810046_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_003221097.1|1810085_1810307_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
1810467:1810486	attL	ATATTATGTATAAAATGAAT	NA	NA	NA	NA
WP_014479841.1|1810502_1810775_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003245262.1|1810856_1811087_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003231758.1|1811329_1811722_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	G3MBF1	Bacillus_virus	58.3	2.5e-29
WP_014479842.1|1811681_1813784_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	U5PY35	Bacillus_phage	86.8	0.0e+00
WP_003231754.1|1813801_1814791_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	F8WQ21	Bacillus_phage	83.5	1.9e-155
WP_003245105.1|1814840_1815461_+	hypothetical protein	NA	A0A127AYS1	Bacillus_phage	48.4	1.6e-46
WP_014476879.1|1815524_1816292_-	sporulation-specific N-acetylmuramoyl-L-alanine amidase	NA	E5DV68	Deep-sea_thermophilic_phage	50.0	5.3e-52
WP_003231746.1|1816924_1817893_+	stage V sporulation protein K	NA	G3MAX6	Bacillus_virus	40.5	5.2e-52
WP_015483254.1|1818025_1819288_+	GTPase HflX	NA	NA	NA	NA	NA
WP_029726458.1|1819305_1820571_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_003238341.1|1820680_1821088_+	transcriptional repressor GlnR	NA	NA	NA	NA	NA
WP_015252037.1|1821146_1822481_+	type I glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_038427664.1|1822593_1823748_-|integrase	site-specific integrase	integrase	A0A0M5M609	Bacillus_phage	39.7	2.2e-65
WP_038427666.1|1824055_1825237_+	helix-turn-helix transcriptional regulator	NA	Q2I8D6	Bacillus_phage	27.4	2.6e-13
WP_154230814.1|1825175_1825388_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038427668.1|1825609_1826023_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_038427669.1|1826200_1826401_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_038427671.1|1826443_1826773_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154230815.1|1826830_1826986_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038427672.1|1826982_1827609_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038427674.1|1827877_1828759_+	replication protein	NA	V9QKF6	Oenococcus_phage	36.7	3.0e-30
WP_038427675.1|1828742_1829573_+	ATP-binding protein	NA	A0A0U3U1U1	Bacillus_phage	35.1	3.8e-35
WP_038427676.1|1829878_1830427_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154230816.1|1830534_1830675_+	BH0509 family protein	NA	NA	NA	NA	NA
WP_038427677.1|1830921_1831119_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038427678.1|1831161_1831488_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038427680.1|1831484_1831745_+	hypothetical protein	NA	A0A2H4JA61	uncultured_Caudovirales_phage	47.4	3.3e-06
WP_038427681.1|1831853_1832996_+	DUF3578 domain-containing protein	NA	NA	NA	NA	NA
WP_038427682.1|1832985_1833669_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038427683.1|1833878_1834328_+	ArpU family transcriptional regulator	NA	S6AVV9	Thermus_phage	56.6	4.4e-38
WP_038427685.1|1834327_1834870_+|integrase	tyrosine-type recombinase/integrase	integrase	D2XR58	Bacillus_phage	63.9	5.8e-61
WP_038427686.1|1835099_1835561_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038427687.1|1835768_1836185_-	pilus assembly protein HicB	NA	D6R430	Bacillus_phage	86.9	1.2e-66
WP_038427688.1|1836252_1836435_-	addiction module toxin, HicA family	NA	D6R431	Bacillus_phage	86.7	1.1e-24
WP_051673211.1|1836648_1837542_+	TIR domain-containing protein	NA	NA	NA	NA	NA
WP_038427689.1|1838071_1838980_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038427690.1|1839001_1839523_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038427691.1|1839644_1840010_+	HNH endonuclease	NA	A0A1U7Q1S7	Geobacillus_virus	51.7	4.3e-28
WP_038427692.1|1840237_1840753_+|terminase	phage terminase small subunit P27 family	terminase	A6M947	Geobacillus_virus	43.4	2.2e-33
WP_038427693.1|1840749_1842459_+|terminase	terminase large subunit	terminase	A0A0S2GLF0	Bacillus_phage	62.1	2.1e-205
WP_038427694.1|1842647_1843928_+|portal	phage portal protein	portal	D6R3Y6	Bacillus_phage	63.1	3.4e-152
WP_038427695.1|1843890_1844517_+|head,protease	HK97 family phage prohead protease	head,protease	Q9ZXF7	Bacillus_phage	75.8	4.5e-81
WP_032725456.1|1844555_1845851_+|capsid	phage major capsid protein	capsid	A0A0A7RTL2	Clostridium_phage	48.3	5.2e-92
WP_019712666.1|1845873_1846326_+	collagen-like protein	NA	D6R3Z0	Bacillus_phage	57.1	1.0e-10
WP_019846973.1|1846343_1846646_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0S2GLH6	Bacillus_phage	46.3	3.6e-12
WP_019712664.1|1846635_1846950_+|head	phage head closure protein	head	A0A2H4JCB1	uncultured_Caudovirales_phage	36.3	2.2e-12
WP_038427696.1|1846949_1847348_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038427697.1|1847344_1847737_+	phage protein	NA	NA	NA	NA	NA
WP_019260068.1|1847751_1848363_+|tail	tail protein	tail	J7KKC8	Streptococcus_phage	35.1	3.6e-11
WP_038427698.1|1848429_1848807_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038427699.1|1849006_1853494_+|tail	phage tail tape measure protein	tail	A6M961	Geobacillus_virus	41.5	2.0e-66
WP_038427700.1|1853487_1854327_+|tail	phage tail family protein	tail	D6R3Z9	Bacillus_phage	57.6	1.9e-90
WP_038427701.1|1854341_1856045_+	alkaline phosphatase	NA	D6R400	Bacillus_phage	55.5	1.6e-178
WP_038427703.1|1856096_1857995_+	teichoic acid biosynthesis protein	NA	A0A185AMX0	Staphylococcus_phage	32.8	1.2e-41
WP_038427704.1|1858010_1858319_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051673212.1|1858501_1860085_+|plate	phage baseplate upper protein	plate	A0A1P8CWR7	Bacillus_phage	48.0	6.2e-63
WP_038427706.1|1860098_1860467_+	hypothetical protein	NA	Q9ZXE0	Bacillus_phage	47.6	3.5e-17
WP_080282461.1|1860466_1860640_+	XkdX family protein	NA	Q9ZXD9	Bacillus_phage	75.4	2.5e-18
WP_119900114.1|1860789_1861041_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038427709.1|1861106_1861529_+|holin	holin	holin	D6R405	Bacillus_phage	82.7	2.4e-54
WP_038427711.1|1861572_1862550_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A218KC88	Bacillus_phage	68.7	7.0e-65
WP_038427712.1|1862590_1862890_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038427715.1|1862896_1864744_-	ribonuclease YeeF family protein	NA	A0A1P8CWI7	Bacillus_phage	55.9	1.3e-120
WP_029726441.1|1865839_1866130_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029726440.1|1866368_1866857_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029726887.1|1870455_1871127_-	glycosyl transferase	NA	NA	NA	NA	NA
WP_029726888.1|1871123_1871831_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_029726889.1|1871817_1872924_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_051673223.1|1872920_1874297_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_153912179.1|1875050_1875215_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029726893.1|1875491_1876028_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_029726894.1|1876106_1877009_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_029726895.1|1877086_1877467_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003231687.1|1878009_1878240_+	helix-turn-helix transcriptional regulator	NA	A0A1P8CWU2	Bacillus_phage	82.4	2.0e-23
WP_029726896.1|1878236_1878875_+	DUF3885 domain-containing protein	NA	NA	NA	NA	NA
WP_003231681.1|1879143_1879308_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029726897.1|1879437_1879908_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029726898.1|1880434_1880965_+	N-acetyltransferase	NA	A0A1P8CWJ6	Bacillus_phage	82.9	2.5e-77
WP_017697653.1|1881967_1883359_+	MFS transporter	NA	NA	NA	NA	NA
WP_029726899.1|1883389_1884991_+	glycoside hydrolase family 43 protein	NA	NA	NA	NA	NA
WP_029726900.1|1885127_1886282_-	ROK family protein	NA	NA	NA	NA	NA
WP_003231664.1|1886524_1887862_+	xylose isomerase	NA	NA	NA	NA	NA
WP_038427718.1|1888012_1889512_+	xylulokinase	NA	NA	NA	NA	NA
WP_038427719.1|1889996_1890632_-	endonuclease YncB	NA	A0A1P8CWK6	Bacillus_phage	68.1	5.0e-72
WP_029317843.1|1891045_1892461_+	sugar porter family MFS transporter	NA	NA	NA	NA	NA
WP_015713988.1|1892562_1893747_-	alanine racemase	NA	NA	NA	NA	NA
WP_029726906.1|1894212_1894674_+	DUF2691 family protein	NA	NA	NA	NA	NA
WP_003245820.1|1894703_1895138_+	dUTP diphosphatase	NA	A0A1P8CX51	Bacillus_phage	93.0	2.0e-72
WP_029726907.1|1895779_1896040_-|coat	spore coat protein CotU	coat	NA	NA	NA	NA
1895210:1895229	attR	ATATTATGTATAAAATGAAT	NA	NA	NA	NA
WP_003231643.1|1896441_1896606_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029317846.1|1896880_1897720_+	thymidylate synthase	NA	A0A1P8CX42	Bacillus_phage	98.6	1.9e-164
WP_121572629.1|1898447_1899170_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029726909.1|1899330_1899687_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024573164.1|1899932_1900133_-|coat	spore coat protein CotC	coat	NA	NA	NA	NA
>prophage 5
NZ_CP007409	Bacillus subtilis subsp. subtilis str. OH 131.1 strain OH131.1 chromosome, complete genome	4039155	2044842	2054451	4039155		Bacillus_phage(71.43%)	14	NA	NA
WP_015714072.1|2044842_2047443_-	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	34.5	5.6e-45
WP_015714073.1|2047900_2048542_-	endo-1,4-beta-xylanase XynA	NA	NA	NA	NA	NA
WP_029727213.1|2049174_2049414_-	TM2 domain-containing protein	NA	M4ZS56	Bacillus_phage	65.8	1.2e-18
WP_038427749.1|2049584_2049923_+	helix-turn-helix transcriptional regulator	NA	A0A0P0IZG9	Lactobacillus_phage	31.7	5.5e-09
WP_004399488.1|2049956_2050313_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029727212.1|2050414_2050699_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029318060.1|2050732_2051062_-	HIT domain-containing protein	NA	NA	NA	NA	NA
WP_029727211.1|2051540_2051852_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029727210.1|2052007_2052220_-	hypothetical protein	NA	O64089	Bacillus_phage	77.5	6.0e-22
WP_029727209.1|2052223_2052475_-	hypothetical protein	NA	A0A1P8CWV6	Bacillus_phage	97.6	4.6e-37
WP_080282471.1|2052540_2052720_+	hypothetical protein	NA	A0A1P8CWV7	Bacillus_phage	89.3	6.0e-23
WP_038427751.1|2052740_2053658_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029727207.1|2053818_2054049_+	membrane protein	NA	NA	NA	NA	NA
WP_029727206.1|2054058_2054451_-	UPF0715 family protein	NA	O64087	Bacillus_phage	84.5	1.0e-51
>prophage 6
NZ_CP007409	Bacillus subtilis subsp. subtilis str. OH 131.1 strain OH131.1 chromosome, complete genome	4039155	2279315	2285411	4039155		Staphylococcus_phage(66.67%)	8	NA	NA
WP_003223904.1|2279315_2279909_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	35.4	2.0e-14
WP_015714192.1|2279898_2280654_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	25.8	9.4e-09
WP_015251790.1|2280934_2281459_+	DUF309 domain-containing protein	NA	NA	NA	NA	NA
WP_003223910.1|2281472_2281847_-	GNAT family N-acetyltransferase RibT	NA	NA	NA	NA	NA
WP_003223915.1|2281959_2282424_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	60.0	5.5e-44
WP_014480160.1|2282456_2283653_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	54.9	4.1e-115
WP_038427787.1|2283667_2284315_-	riboflavin synthase subunit alpha	NA	A0A2H4PQS5	Staphylococcus_phage	45.9	1.1e-42
WP_004398763.1|2284325_2285411_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	36.1	5.1e-56
>prophage 7
NZ_CP007409	Bacillus subtilis subsp. subtilis str. OH 131.1 strain OH131.1 chromosome, complete genome	4039155	2645569	2699040	4039155	coat,tRNA,protease	uncultured_Mediterranean_phage(12.5%)	56	NA	NA
WP_003229725.1|2645569_2646715_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	44.0	3.4e-87
WP_003229723.1|2646741_2647770_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_003222669.1|2647799_2648000_-	DUF2905 domain-containing protein	NA	NA	NA	NA	NA
WP_003229718.1|2647992_2648997_-	Holliday junction branch migration DNA helicase RuvB	NA	B3GAM6	uncultured_virus	30.8	1.1e-07
WP_003229717.1|2649007_2649613_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_003229715.1|2649751_2650264_-	sporulation cell-cell signaling protein BofC	NA	NA	NA	NA	NA
WP_003246197.1|2650311_2651619_-	MFS transporter	NA	NA	NA	NA	NA
WP_029318179.1|2651689_2652715_-	inositol 2-dehydrogenase	NA	NA	NA	NA	NA
WP_003246159.1|2652952_2653600_+	serine/threonine protein kinase	NA	A0A2R3ZQF2	Marseillevirus	26.3	5.4e-05
WP_003229707.1|2653645_2653768_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157825339.1|2653873_2654299_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004398683.1|2654305_2654446_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038427814.1|2654608_2656063_+	alanine:cation symporter family protein	NA	NA	NA	NA	NA
WP_004398802.1|2656103_2656826_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_029727125.1|2656928_2657525_-	spore germination protein SgpA	NA	NA	NA	NA	NA
WP_029727124.1|2657672_2658836_-|coat	spore coat assembly protein SafA	coat	NA	NA	NA	NA
WP_038427815.1|2658952_2660059_-	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_029318181.1|2660045_2660915_-	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
WP_029727122.1|2660868_2662464_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_029727121.1|2662566_2663754_+	cysteine desulfurase NifS	NA	A0A141ZJV0	Faustovirus	27.4	1.7e-33
WP_004398582.1|2663713_2664256_+	transcription repressor NadR	NA	NA	NA	NA	NA
WP_029727120.1|2664279_2665137_-	prephenate dehydratase	NA	NA	NA	NA	NA
WP_003222630.1|2665153_2665597_-	transcriptional regulator ThrR	NA	NA	NA	NA	NA
WP_029727119.1|2665657_2666944_-	GTPase ObgE	NA	NA	NA	NA	NA
WP_004399131.1|2666977_2667556_-	sporulation initiation phosphotransferase Sop0B	NA	NA	NA	NA	NA
WP_003229671.1|2667633_2667756_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003222623.1|2667876_2668161_-	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_003229669.1|2668173_2668512_-|protease	ribosomal-processing cysteine protease Prp	protease	NA	NA	NA	NA
WP_003229668.1|2668514_2668823_-	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_004398649.1|2668969_2669836_-	stage IV sporulation protein SpoIVFB	NA	NA	NA	NA	NA
WP_029727118.1|2669828_2670623_-	stage IV sporulation protein SpoIVFA	NA	NA	NA	NA	NA
WP_004398624.1|2670771_2671578_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_004398901.1|2671579_2672260_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_004398811.1|2672312_2672831_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_003222609.1|2672827_2673700_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_003229650.1|2673730_2674744_-	rod shape-determining protein MreB	NA	NA	NA	NA	NA
WP_015251546.1|2674835_2675531_-	JAB domain-containing protein	NA	NA	NA	NA	NA
WP_004398496.1|2675567_2676137_-	septum formation protein Maf	NA	NA	NA	NA	NA
WP_038427816.1|2676289_2677285_-	stage II sporulation protein SpoIIB	NA	NA	NA	NA	NA
WP_072692713.1|2677418_2678165_-	prepilin peptidase	NA	NA	NA	NA	NA
WP_038427817.1|2678307_2679600_-	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_029727115.1|2679659_2682302_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	42.6	4.9e-161
WP_003222590.1|2682749_2682941_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029727114.1|2682959_2683985_-|coat	spore coat protein CotN	coat	NA	NA	NA	NA
WP_029727113.1|2684017_2685745_-|coat	spore coat morphogenetic protein SpoVID	coat	NA	NA	NA	NA
WP_015384279.1|2685875_2687168_-	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_029727112.1|2687197_2688172_-	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_029727111.1|2688168_2688957_-	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_072692716.1|2688946_2689891_-	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_003222575.1|2689923_2690754_-	cytochrome c biogenesis protein CcsA	NA	NA	NA	NA	NA
WP_004399038.1|2690761_2692129_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_014477563.1|2692358_2692856_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003229621.1|2692877_2693465_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_029726365.1|2693461_2695786_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	43.7	2.6e-182
WP_029726366.1|2695965_2697624_-|protease	ATP-dependent protease LonB	protease	A0A1V0SHJ7	Hokovirus	33.7	8.1e-05
WP_003229613.1|2697777_2699040_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	64.9	1.3e-148
>prophage 8
NZ_CP007409	Bacillus subtilis subsp. subtilis str. OH 131.1 strain OH131.1 chromosome, complete genome	4039155	3273746	3281481	4039155	holin	Organic_Lake_phycodnavirus(50.0%)	9	NA	NA
WP_038427914.1|3273746_3274427_-|holin	choline ABC transporter permease OpuBD	holin	NA	NA	NA	NA
WP_038427915.1|3274443_3275364_-	osmoprotectant ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003228370.1|3275375_3276029_-|holin	choline ABC transporter permease OpuBB	holin	NA	NA	NA	NA
WP_038427916.1|3276045_3277191_-|holin	betaine/proline/choline family ABC transporter ATP-binding protein	holin	F2Y2R6	Organic_Lake_phycodnavirus	32.3	6.0e-15
WP_014478002.1|3277474_3278008_+	GbsR/MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_038427917.1|3278039_3278714_-|holin	glycine betaine/carnitine/choline/choline sulfate ABC transporter permease OpuCD	holin	NA	NA	NA	NA
WP_072692820.1|3278731_3279643_-	osmoprotectant ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_038427919.1|3279662_3280316_-|holin	glycine betaine/carnitine/choline/choline sulfate ABC transporter permease OpuCB	holin	NA	NA	NA	NA
WP_003243370.1|3280338_3281481_-|holin	betaine/proline/choline family ABC transporter ATP-binding protein	holin	W6JKT0	Anomala_cuprea_entomopoxvirus	29.3	6.2e-12
>prophage 9
NZ_CP007409	Bacillus subtilis subsp. subtilis str. OH 131.1 strain OH131.1 chromosome, complete genome	4039155	3655114	3733682	4039155	bacteriocin,coat,tRNA,protease	Bacillus_phage(25.0%)	80	NA	NA
WP_038427988.1|3655114_3656785_-|tRNA	arginine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_003243604.1|3656781_3657210_-	DUF1934 domain-containing protein	NA	NA	NA	NA	NA
WP_003222002.1|3657522_3657654_+|bacteriocin	subtilosin A family bacteriocin	bacteriocin	NA	NA	NA	NA
WP_010886632.1|3657610_3657763_+|bacteriocin	bacteriocin-like protein SboX	bacteriocin	NA	NA	NA	NA
WP_038427989.1|3657787_3659134_+	subtilosin maturase AlbA	NA	NA	NA	NA	NA
WP_003222006.1|3659146_3659308_+|bacteriocin	antilisterial bacteriocin subtilosin biosynthesis protein AlbB	bacteriocin	NA	NA	NA	NA
WP_029726076.1|3659304_3660024_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.2	5.6e-19
WP_038427990.1|3660016_3661327_+|bacteriocin	antilisterial bacteriocin subtilosin biosynthesis protein AlbD	bacteriocin	NA	NA	NA	NA
WP_072692833.1|3661316_3662477_+	insulinase family protein	NA	NA	NA	NA	NA
WP_003227558.1|3662481_3663762_+	insulinase family protein	NA	NA	NA	NA	NA
WP_038427991.1|3663758_3664460_+|bacteriocin	antilisterial bacteriocin subtilosin biosynthesis protein AlbG	bacteriocin	NA	NA	NA	NA
WP_038427992.1|3664465_3665839_-	YncE family protein	NA	NA	NA	NA	NA
WP_038427993.1|3665881_3667237_-	YncE family protein	NA	NA	NA	NA	NA
WP_009968328.1|3667233_3667464_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029318693.1|3667466_3668612_+	response regulator aspartate phosphatase RapF	NA	A0A1P8CWN8	Bacillus_phage	43.0	1.4e-77
WP_009968329.1|3668595_3668715_+	phosphatase RapF inhibitor PhrF	NA	NA	NA	NA	NA
WP_038427994.1|3668968_3669448_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015714893.1|3669596_3670385_+	membrane protein	NA	NA	NA	NA	NA
WP_015714894.1|3670371_3671046_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038427995.1|3671046_3671853_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015714896.1|3671855_3672503_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	40.0	7.7e-28
WP_015714897.1|3672495_3673056_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003227545.1|3673104_3673977_-	agmatinase	NA	NA	NA	NA	NA
WP_003227543.1|3674037_3674868_-	spermidine synthase	NA	NA	NA	NA	NA
WP_038427996.1|3675068_3677144_+	penicillin-binding protein	NA	NA	NA	NA	NA
WP_015250981.1|3677436_3677955_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003243167.1|3677968_3678628_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_003222038.1|3678736_3678925_+	4-oxalocrotonate tautomerase	NA	NA	NA	NA	NA
WP_003242889.1|3678967_3679387_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003243399.1|3679506_3681423_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	43.2	6.2e-142
WP_003243441.1|3682013_3683414_-	MFS transporter	NA	NA	NA	NA	NA
WP_003243988.1|3683413_3683884_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_003227524.1|3683995_3684496_-	YwgA family protein	NA	NA	NA	NA	NA
WP_003243873.1|3684531_3685833_-	HD domain-containing protein	NA	E3T4P8	Cafeteria_roenbergensis_virus	28.9	4.2e-25
WP_003222050.1|3685994_3686219_-	DUF1450 domain-containing protein	NA	NA	NA	NA	NA
WP_029726231.1|3686433_3687210_+	prespore-specific transcription regulator RsfA	NA	A0A1D6X8E5	Bacillus_phage	50.0	7.6e-06
WP_029726230.1|3687353_3688244_-	DMT family transporter	NA	NA	NA	NA	NA
WP_003227511.1|3688411_3689257_-	octanoyl-[GcvH]:protein N-octanoyltransferase	NA	NA	NA	NA	NA
WP_029726229.1|3689305_3690205_-	cysJI operon transcriptional regulator CysL	NA	A0A2H4J8I9	uncultured_Caudovirales_phage	42.5	3.6e-07
WP_003235941.1|3690350_3691322_-	phosphate acetyltransferase	NA	NA	NA	NA	NA
WP_003227507.1|3691591_3692356_+	heme-dependent peroxidase	NA	NA	NA	NA	NA
WP_038427997.1|3692488_3693268_+	NADPH-dependent reductase BacG	NA	NA	NA	NA	NA
WP_038427998.1|3693282_3694482_-	transaminase BacF	NA	NA	NA	NA	NA
WP_014481236.1|3694482_3695667_-	bacilysin exporter BacE	NA	NA	NA	NA	NA
WP_038427999.1|3695663_3697082_-	alanine--anticapsin ligase	NA	NA	NA	NA	NA
WP_038428162.1|3697100_3697862_-	dihydroanticapsin 7-dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.3	2.6e-22
WP_038428000.1|3697864_3698572_-	3-((4R)-4-hydroxycyclohexa-1, 5-dien-1-yl)-2-oxopropanoate isomerase	NA	NA	NA	NA	NA
WP_009968341.1|3698561_3699176_-	prephenate decarboxylase	NA	NA	NA	NA	NA
WP_038428001.1|3699327_3700566_-	MFS transporter	NA	NA	NA	NA	NA
WP_015250969.1|3700775_3702188_-	amino acid permease	NA	NA	NA	NA	NA
WP_038428002.1|3702187_3703888_-	M20/M25/M40 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_014478322.1|3703972_3705520_-	L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_015250966.1|3705746_3707021_-	glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_003227472.1|3707198_3707663_-	biofilm-surface layer protein BslB	NA	NA	NA	NA	NA
WP_014481242.1|3707986_3708442_-|coat	spore coat polysaccharide biosynthesis protein SpsL	coat	NA	NA	NA	NA
WP_015250965.1|3708434_3709286_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	38.9	3.7e-38
WP_003244201.1|3709299_3710247_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	43.8	4.4e-72
WP_014478328.1|3710246_3710987_-	NTP transferase domain-containing protein	NA	I7I009	Enterobacteria_phage	41.9	4.5e-48
WP_038428003.1|3711011_3712031_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_038428004.1|3712033_3712756_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_029726215.1|3712748_3713870_-|coat	spore coat biosynthesis protein SpsE	coat	NA	NA	NA	NA
WP_029726214.1|3713869_3714739_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_014481249.1|3714739_3715909_-	DegT/DnrJ/EryC1/StrS aminotransferase family protein	NA	A0A1D8KU11	Synechococcus_phage	28.1	1.2e-15
WP_029726213.1|3715929_3717354_-	CDP-glycerol glycerophosphotransferase family protein	NA	NA	NA	NA	NA
WP_015250957.1|3717358_3718129_-|coat	spore coat dTDP-glycosyltransferase SpsA	coat	A0A0F7L2F7	uncultured_marine_virus	28.6	3.4e-06
WP_014481253.1|3718448_3718994_+|coat	spore coat protein GerQ	coat	NA	NA	NA	NA
WP_003227446.1|3719037_3719409_-	DUF423 domain-containing protein	NA	NA	NA	NA	NA
WP_029726212.1|3719470_3720793_-	purine permease	NA	NA	NA	NA	NA
WP_029726211.1|3720812_3721130_-	YwdI family protein	NA	NA	NA	NA	NA
WP_029726210.1|3721297_3722668_+	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_014478341.1|3722692_3723370_-	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	45.7	1.8e-48
WP_015250953.1|3723382_3724189_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_014665830.1|3724379_3725195_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_003243437.1|3725285_3725534_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029726209.1|3725627_3727067_-	sucrose-6-phosphate hydrolase	NA	F8WPR5	Bacillus_phage	26.4	3.1e-21
WP_029726208.1|3727063_3728449_-	PTS system sucrose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_014481261.1|3728750_3729521_+	formate/nitrite transporter family protein	NA	NA	NA	NA	NA
WP_003227423.1|3729559_3730390_-	sac operon transcriptional antiterminator SacT	NA	NA	NA	NA	NA
WP_003222155.1|3730429_3730732_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029726207.1|3731261_3733682_+|protease	serine protease Vpr	protease	A0A217EQY2	Bacillus_phage	38.2	5.3e-21
