The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP013730	Burkholderia cepacia JBK9 chromosome 1, complete sequence	3790084	193070	288247	3790084	tail,integrase,plate,holin	Burkholderia_phage(66.67%)	95	264024:264072	288388:288436
WP_006477367.1|193070_193424_-|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_059232686.1|193522_194941_-	adenosylhomocysteinase	NA	S4VPF6	Pandoravirus	30.1	1.3e-43
WP_059232687.1|195185_195920_-	RNA polymerase sigma factor FliA	NA	NA	NA	NA	NA
WP_059232688.1|195938_196757_-	flagellar biosynthesis protein FlhG	NA	NA	NA	NA	NA
WP_059232689.1|196749_198510_-	flagellar biosynthesis protein FlhF	NA	NA	NA	NA	NA
WP_059232690.1|198506_200606_-	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_059232691.1|200805_202005_-	flagellar type III secretion system protein FlhB	NA	NA	NA	NA	NA
WP_059232692.1|202315_202696_-	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_155627095.1|202880_203054_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059232693.1|203188_203686_-	VOC family protein	NA	NA	NA	NA	NA
WP_059232694.1|203851_205081_-	DUF3443 family protein	NA	NA	NA	NA	NA
WP_059232695.1|205097_205601_-	DUF2844 domain-containing protein	NA	NA	NA	NA	NA
WP_059232696.1|205860_206592_-	protein phosphatase CheZ	NA	NA	NA	NA	NA
WP_006485893.1|206593_206989_-	chemotaxis protein CheY	NA	Q56AR1	Bacillus_thuringiensis_phage	31.9	6.0e-07
WP_059232697.1|207056_208148_-	chemotaxis response regulator protein-glutamate methylesterase	NA	NA	NA	NA	NA
WP_059232698.1|208144_208900_-	chemoreceptor glutamine deamidase CheD	NA	NA	NA	NA	NA
WP_059232699.1|208896_209889_-	chemotaxis protein CheR	NA	NA	NA	NA	NA
WP_059232700.1|209892_211857_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	45.0	2.6e-10
WP_059232701.1|211894_212410_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_059232702.1|212457_214692_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_034188085.1|214725_215103_-	response regulator	NA	NA	NA	NA	NA
WP_059232703.1|215132_216152_-	flagellar motor protein MotB	NA	NA	NA	NA	NA
WP_006482649.1|216165_217026_-	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
WP_034209584.1|217193_217748_-	flagellar transcriptional regulator FlhC	NA	NA	NA	NA	NA
WP_081051758.1|217841_218288_-	flagellar transcriptional regulator FlhD	NA	NA	NA	NA	NA
WP_059232704.1|218826_219891_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_059232705.1|219994_220291_-	H-NS histone family protein	NA	F8TUP5	EBPR_podovirus	40.8	1.9e-10
WP_006477345.1|220591_221335_+	aquaporin Z	NA	A0A1B1ISL4	uncultured_Mediterranean_phage	50.8	8.1e-05
WP_059232706.1|221467_222292_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_059232707.1|222438_223320_-	ATPase	NA	NA	NA	NA	NA
WP_059232708.1|223462_224065_+	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_059232709.1|224130_225366_-	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_059232710.1|225596_227720_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_006401410.1|227880_228093_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_155627096.1|228421_228616_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059232711.1|228614_229772_+	flagellin	NA	NA	NA	NA	NA
WP_059232712.1|229904_231413_+	flagellar filament capping protein FliD	NA	NA	NA	NA	NA
WP_059232713.1|231438_231738_+	flagellar protein FliT	NA	NA	NA	NA	NA
WP_059232714.1|231979_234328_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_059232715.1|234356_235499_+	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	A0A0P0CNN6	Ostreococcus_mediterraneus_virus	26.0	1.6e-12
WP_059232716.1|235509_236172_-	acetyltransferase	NA	NA	NA	NA	NA
WP_059232717.1|236265_238206_-	glycosyltransferase family protein	NA	NA	NA	NA	NA
WP_059232718.1|238245_238989_-	acetyltransferase	NA	NA	NA	NA	NA
WP_059232719.1|239253_240864_-	TIGR04222 domain-containing membrane protein	NA	NA	NA	NA	NA
WP_059232720.1|241425_241632_+|tail	phage tail protein	tail	E5E3W5	Burkholderia_phage	63.2	3.3e-17
WP_059232721.1|241648_241993_+	hypothetical protein	NA	A4JWU2	Burkholderia_virus	77.9	5.7e-38
WP_059232722.1|241994_242261_+|holin	phage holin family protein	holin	E5E3W3	Burkholderia_phage	66.7	4.3e-25
WP_059232723.1|242264_243110_+	DUF3380 domain-containing protein	NA	A4JWZ0	Burkholderia_virus	66.9	1.7e-91
WP_059232724.1|243106_243547_+	protein lysB	NA	NA	NA	NA	NA
WP_081051759.1|243500_243671_+	peptidase	NA	K4PAX1	Burkholderia_phage	69.8	1.6e-09
WP_059232726.1|243663_244113_+|tail	phage tail protein	tail	E5E3V9	Burkholderia_phage	55.7	3.0e-31
WP_155627097.1|244272_244431_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059232727.1|244598_245285_+|plate	phage baseplate assembly protein V	plate	K4NXJ5	Burkholderia_phage	69.2	8.9e-83
WP_059232728.1|245281_245644_+|plate	baseplate assembly protein	plate	K4PAX6	Burkholderia_phage	69.2	2.0e-41
WP_059232729.1|245640_246555_+|plate	baseplate assembly protein	plate	E5FFH3	Burkholderia_phage	71.9	5.6e-117
WP_059232730.1|246547_247090_+|tail	phage tail protein I	tail	E5FFH2	Burkholderia_phage	70.9	7.5e-69
WP_059232731.1|247096_249739_+|tail	phage tail protein	tail	E5E3V2	Burkholderia_phage	71.9	0.0e+00
WP_059232732.1|249756_250533_+|tail	phage tail protein	tail	E5E3V1	Burkholderia_phage	79.5	2.6e-86
WP_059232733.1|250588_251761_+|tail	phage tail sheath protein	tail	A4JWS7	Burkholderia_virus	81.5	1.6e-185
WP_081051760.1|251795_252299_+|tail	phage major tail tube protein	tail	E5E3U9	Burkholderia_phage	74.9	1.7e-70
WP_059232735.1|252372_252753_+|tail	phage tail assembly protein	tail	K4NXA3	Burkholderia_phage	68.0	1.0e-27
WP_006484104.1|252761_252875_+|tail	GpE family phage tail protein	tail	A0A089FGX3	Burkholderia_phage	85.7	1.1e-09
WP_059232736.1|252890_255464_+	hypothetical protein	NA	E5E3U6	Burkholderia_phage	44.4	8.1e-145
WP_059232737.1|255488_255920_+|tail	phage tail protein	tail	K4NXK5	Burkholderia_phage	67.4	3.7e-42
WP_059232738.1|255916_256987_+	phage late control D family protein	NA	K4PAY4	Burkholderia_phage	71.9	3.0e-133
WP_059232739.1|257161_257458_-	hypothetical protein	NA	E5E3U3	Burkholderia_phage	50.5	5.5e-13
WP_155627182.1|257775_258231_-	transcriptional regulator	NA	E5E3U2	Burkholderia_phage	60.3	6.6e-42
WP_059232740.1|258357_258573_+	hypothetical protein	NA	E5E3U1	Burkholderia_phage	81.4	1.5e-20
WP_006485448.1|258754_259003_+	ogr/Delta-like zinc finger family protein	NA	K4PAZ0	Burkholderia_phage	91.5	3.5e-37
WP_059236519.1|259131_259395_+	hypothetical protein	NA	A4JWQ9	Burkholderia_virus	61.9	6.5e-18
WP_059236521.1|259400_262193_+	hypothetical protein	NA	E5E3N5	Burkholderia_phage	90.7	0.0e+00
WP_081051761.1|262189_262561_+	hypothetical protein	NA	A0A089FGR9	Burkholderia_phage	52.5	1.1e-07
WP_059232742.1|262893_263970_+|integrase	site-specific integrase	integrase	A0A1S5NNJ1	Burkholderia_phage	81.7	2.7e-166
264024:264072	attL	TTGGCGCGCCCGGCTGGGATCGAACCAGCAACCCCTGCCTTCGGAGGGC	NA	NA	NA	NA
WP_081051762.1|264302_264575_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_059236523.1|264929_265535_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155627098.1|265846_266578_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155627099.1|266586_267057_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155627100.1|267375_267795_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059232746.1|268089_268284_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059232747.1|269041_269758_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059232748.1|270001_270574_+	recombinase family protein	NA	E5FFF9	Burkholderia_phage	55.3	5.9e-48
WP_081051763.1|270654_271299_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_081051764.1|271291_271747_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_155627101.1|271993_272806_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059232751.1|272802_273282_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155627102.1|273278_273758_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155627103.1|273715_275224_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059232753.1|275421_276051_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059232754.1|277558_279400_+	SAM-dependent DNA methyltransferase	NA	A0A220A2U4	Liberibacter_phage	27.5	3.5e-33
WP_081051766.1|279396_280746_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_059232756.1|280742_281675_+	transporter	NA	NA	NA	NA	NA
WP_059232757.1|281730_284844_+	type I restriction endonuclease subunit R	NA	NA	NA	NA	NA
WP_059232758.1|285004_285931_+	DNA-processing protein DprA	NA	NA	NA	NA	NA
WP_155627104.1|285943_287158_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059232760.1|287239_288247_-|integrase	site-specific integrase	integrase	A0A1L7DQ84	Ralstonia_phage	38.1	6.1e-48
288388:288436	attR	TTGGCGCGCCCGGCTGGGATCGAACCAGCAACCCCTGCCTTCGGAGGGC	NA	NA	NA	NA
>prophage 2
NZ_CP013730	Burkholderia cepacia JBK9 chromosome 1, complete sequence	3790084	1329095	1339560	3790084		Burkholderia_virus(33.33%)	8	NA	NA
WP_059233509.1|1329095_1330211_-	DUF3396 domain-containing protein	NA	E5E3X7	Burkholderia_phage	80.7	1.4e-173
WP_081051801.1|1330215_1330968_-	VRR-NUC domain-containing protein	NA	A4JWV4	Burkholderia_virus	44.5	2.2e-42
WP_059233510.1|1330964_1331492_-	PAAR domain-containing protein	NA	A4JWV5	Burkholderia_virus	58.0	4.5e-50
WP_034190709.1|1332027_1332210_-	rubredoxin	NA	NA	NA	NA	NA
WP_059233511.1|1332409_1332814_+	DUF4399 domain-containing protein	NA	NA	NA	NA	NA
WP_059233512.1|1333016_1334966_+	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	29.1	3.1e-48
WP_059233513.1|1335186_1337169_+	type IIA DNA topoisomerase subunit B	NA	G3M9Z3	Bacillus_virus	34.8	3.6e-92
WP_059233514.1|1337238_1339560_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	36.0	2.1e-83
>prophage 3
NZ_CP013730	Burkholderia cepacia JBK9 chromosome 1, complete sequence	3790084	1632188	1726340	3790084	plate,terminase,head,tail,capsid,tRNA,portal,protease,integrase,holin	uncultured_Caudovirales_phage(29.27%)	100	1666512:1666537	1705445:1705470
WP_059233721.1|1632188_1633715_-|tRNA	lysine--tRNA ligase	tRNA	A0A2K9KZX5	Tupanvirus	40.5	3.6e-84
WP_155627123.1|1633788_1634893_-	peptide chain release factor 2	NA	W8EDB3	Pseudomonas_phage	35.4	1.3e-06
WP_059233722.1|1635048_1636746_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	30.5	7.1e-57
WP_155627124.1|1636760_1637825_-	regulator	NA	NA	NA	NA	NA
WP_059233724.1|1637987_1639241_+	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_059233725.1|1639296_1639992_+	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	41.0	1.7e-33
WP_059233726.1|1640059_1640848_+	TatD family hydrolase	NA	NA	NA	NA	NA
WP_059233727.1|1640905_1643389_+	DNA internalization-related competence protein ComEC/Rec2	NA	NA	NA	NA	NA
WP_059233728.1|1643577_1644423_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_059233729.1|1644604_1646257_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	51.8	4.9e-151
WP_047898480.1|1646260_1647115_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	40.5	6.8e-48
WP_011352544.1|1647221_1648505_+	phosphopyruvate hydratase	NA	W6LP63	Streptococcus_phage	62.1	1.1e-150
WP_059233730.1|1648586_1649012_+	cell division protein FtsB	NA	NA	NA	NA	NA
WP_059233731.1|1649098_1649455_-	hypothetical protein	NA	NA	NA	NA	NA
WP_034188925.1|1649590_1650541_-	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
WP_059233732.1|1650566_1651091_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_059233733.1|1651240_1652092_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_059233734.1|1652260_1653151_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_155627125.1|1653222_1654062_+	PHP domain-containing protein	NA	NA	NA	NA	NA
WP_059233735.1|1654128_1654761_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_059233736.1|1654808_1655471_+|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_006487046.1|1655479_1656682_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_059233737.1|1656690_1657293_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_059233738.1|1657339_1658242_+	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
WP_059233739.1|1658353_1659499_+	outer membrane protein assembly factor BamC	NA	NA	NA	NA	NA
WP_059233740.1|1659503_1660280_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_034195863.1|1660393_1660657_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059233741.1|1660889_1662110_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_059233742.1|1662142_1662685_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_059236691.1|1662664_1663912_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059233743.1|1663916_1666607_-	DNA mismatch repair protein MutS	NA	A0A1V0SDQ0	Indivirus	24.1	3.7e-23
1666512:1666537	attL	GCGCAGGTACTGCTGCATCATCGGGG	NA	NA	NA	NA
WP_059233744.1|1666766_1668041_+|integrase	integrase family protein	integrase	C7BGE7	Burkholderia_phage	58.7	1.1e-147
WP_081051898.1|1668018_1668261_-	AlpA family phage regulatory protein	NA	C7BGF0	Burkholderia_phage	66.2	1.2e-18
WP_059233745.1|1668269_1668641_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059233746.1|1668742_1670347_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059236693.1|1670346_1670709_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059233747.1|1670759_1670978_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155627126.1|1671283_1671892_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059233748.1|1671908_1672127_+	hypothetical protein	NA	A0A2H4JCB6	uncultured_Caudovirales_phage	50.8	1.0e-08
WP_059236695.1|1672138_1672711_+	hypothetical protein	NA	C7BGG0	Burkholderia_phage	46.8	4.7e-29
WP_059236697.1|1672697_1673081_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059233749.1|1673341_1675849_+	virulence protein E	NA	A0A2D1GN57	Marinobacter_phage	40.0	3.1e-93
WP_059233750.1|1676069_1676843_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059233751.1|1677096_1677693_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059233754.1|1678454_1680566_+|terminase	phage terminase large subunit family protein	terminase	A0A2D1GMT1	Marinobacter_phage	53.3	1.0e-177
WP_059233755.1|1680579_1680786_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059233756.1|1680782_1682267_+|portal	phage portal protein	portal	A0A2H4JFL5	uncultured_Caudovirales_phage	50.9	1.8e-133
WP_059233757.1|1682272_1683346_+|protease	Clp protease ClpP	protease	A0A2H4JDI2	uncultured_Caudovirales_phage	35.7	2.0e-44
WP_059233758.1|1683376_1683721_+|head	head decoration protein	head	NA	NA	NA	NA
WP_059233759.1|1683794_1684790_+|capsid	major capsid protein	capsid	A0A2H4J890	uncultured_Caudovirales_phage	55.8	2.8e-101
WP_059233760.1|1684791_1685082_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059233761.1|1685085_1685616_+|tail	phage tail protein	tail	A0A2H4JBV1	uncultured_Caudovirales_phage	31.0	8.3e-12
WP_059233762.1|1685605_1686136_+	hypothetical protein	NA	Q75QM3	Wolbachia_phage	38.2	8.5e-25
WP_059233763.1|1686132_1686813_+|plate	phage baseplate assembly protein V	plate	A0A1B2LRU5	Wolbachia_phage	29.8	8.4e-17
WP_059233764.1|1686873_1687074_+	hypothetical protein	NA	NA	NA	NA	NA
WP_034188724.1|1687073_1687409_+|plate	phage baseplate protein	plate	A0A2H4JA09	uncultured_Caudovirales_phage	48.1	5.0e-23
WP_059233765.1|1687405_1688302_+|plate	baseplate J protein	plate	A0A2H4JFK9	uncultured_Caudovirales_phage	43.8	4.6e-47
WP_059233766.1|1688291_1688870_+|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	44.1	7.4e-30
WP_059233767.1|1688857_1690810_+|tail	tail fiber protein	tail	A4JWS9	Burkholderia_virus	41.6	7.9e-100
WP_059233768.1|1690825_1691605_+|tail	phage tail protein	tail	E5E3Q6	Burkholderia_phage	56.5	2.8e-56
WP_059233769.1|1691689_1692859_+|tail	phage tail sheath family protein	tail	A0A2H4J869	uncultured_Caudovirales_phage	72.1	9.3e-157
WP_059233770.1|1692869_1693373_+|tail	phage major tail tube protein	tail	Q7M2A5	Pseudomonas_phage	51.9	4.3e-42
WP_059233771.1|1693469_1693772_+|tail	phage tail assembly protein	tail	A0A1B2LRV6	Wolbachia_phage	38.7	3.5e-07
WP_059233772.1|1693852_1696294_+|tail	phage tail protein	tail	A0A2H4JG00	uncultured_Caudovirales_phage	37.6	1.0e-56
WP_059233773.1|1696303_1697182_+|tail	phage tail protein	tail	A0A2H4J875	uncultured_Caudovirales_phage	37.5	1.5e-34
WP_059236699.1|1697156_1697363_+|tail	phage tail protein	tail	A0A2H4J9Z9	uncultured_Caudovirales_phage	58.2	1.5e-14
WP_059233774.1|1697372_1698419_+	late control protein	NA	A0A2H4JBF6	uncultured_Caudovirales_phage	46.9	2.6e-81
WP_059233775.1|1698499_1698784_+|holin	holin	holin	C7BGD7	Burkholderia_phage	92.6	2.8e-38
WP_059233776.1|1698786_1699281_+	glycoside hydrolase family 104 protein	NA	Q6J1Q5	Burkholderia_virus	87.8	6.9e-77
WP_059233777.1|1699277_1699772_+	DUF2514 family protein	NA	C7BGD9	Burkholderia_phage	51.3	4.7e-33
WP_059233778.1|1699941_1700727_+	DNA adenine methylase	NA	Q8W6S4	Burkholderia_virus	82.8	2.4e-132
WP_155627127.1|1700791_1701292_-	hypothetical protein	NA	Q8W6R9	Burkholderia_virus	45.5	4.7e-25
WP_059233780.1|1701500_1702157_+	DUF159 family protein	NA	Q8W6R8	Burkholderia_virus	62.3	3.6e-81
WP_155627128.1|1702219_1702708_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155627129.1|1702842_1703253_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155627130.1|1703732_1704146_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059233783.1|1704694_1704928_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059233785.1|1705640_1706222_-	fasciclin domain-containing protein	NA	NA	NA	NA	NA
1705445:1705470	attR	GCGCAGGTACTGCTGCATCATCGGGG	NA	NA	NA	NA
WP_059233786.1|1706345_1707068_-	anti-sigma factor	NA	NA	NA	NA	NA
WP_081051810.1|1707064_1707751_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_059233788.1|1708582_1708924_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059233789.1|1709690_1709975_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081051811.1|1710022_1710232_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059233790.1|1710265_1710478_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_059233791.1|1711080_1711398_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059236701.1|1711867_1712152_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059236703.1|1712204_1712444_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059233792.1|1713008_1713335_+	EthD family reductase	NA	NA	NA	NA	NA
WP_059233793.1|1713575_1715198_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_006493635.1|1715507_1716311_-	inositol monophosphatase	NA	NA	NA	NA	NA
WP_059233794.1|1716593_1717418_+	RNA methyltransferase	NA	NA	NA	NA	NA
WP_059233795.1|1717693_1718497_+	serine O-acetyltransferase	NA	NA	NA	NA	NA
WP_059233796.1|1718554_1719355_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_011352518.1|1719378_1719870_-	peptidyl-prolyl cis-trans isomerase	NA	A0A2H4UTF4	Bodo_saltans_virus	29.6	2.2e-06
WP_059233797.1|1719958_1720534_-	peptidyl-prolyl cis-trans isomerase	NA	A0A1V0SCU1	Indivirus	38.5	1.2e-11
WP_155627190.1|1720573_1721428_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_059233799.1|1721528_1722926_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	31.2	3.7e-43
WP_059233800.1|1722969_1723797_+	DNA-3-methyladenine glycosylase 2 family protein	NA	NA	NA	NA	NA
WP_048248707.1|1723900_1724872_+	acetyl-CoA carboxylase carboxyltransferase subunit alpha	NA	NA	NA	NA	NA
WP_059233801.1|1724918_1726340_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
>prophage 4
NZ_CP013730	Burkholderia cepacia JBK9 chromosome 1, complete sequence	3790084	2021012	2072131	3790084	protease,tRNA,plate	Powai_lake_megavirus(33.33%)	41	NA	NA
WP_059234012.1|2021012_2022353_+|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_059234013.1|2022408_2023038_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_059234014.1|2023079_2024225_+	outer membrane protein assembly factor BamB	NA	NA	NA	NA	NA
WP_059234015.1|2024474_2025812_+	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_059234016.1|2025941_2026196_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_059234017.1|2026253_2027444_+	GTPase HflX	NA	NA	NA	NA	NA
WP_059234018.1|2027491_2028838_+|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_059234019.1|2028853_2029753_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_009687995.1|2029789_2029981_+	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_059234020.1|2030084_2031233_+	ATP phosphoribosyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_059234021.1|2031346_2032693_+	adenylosuccinate synthase	NA	A0A160ER07	Powai_lake_megavirus	36.6	6.9e-71
WP_059234022.1|2032700_2033297_+	phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_059234023.1|2033572_2035489_+	potassium transporter Kup	NA	A7J6G4	Paramecium_bursaria_Chlorella_virus	33.0	2.9e-78
WP_059234024.1|2035511_2036537_-	sesquiterpene cyclase	NA	NA	NA	NA	NA
WP_059234025.1|2036945_2039270_-	RNA-binding transcriptional accessory protein	NA	NA	NA	NA	NA
WP_059234026.1|2039434_2040187_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006478692.1|2040263_2040479_+	YdcH family protein	NA	NA	NA	NA	NA
WP_059234027.1|2040534_2042784_+	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	29.1	3.1e-76
WP_059234028.1|2042904_2043729_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_059234029.1|2043770_2044979_+	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_059236728.1|2044985_2045825_+	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
WP_059234030.1|2046185_2048069_+	class I poly(R)-hydroxyalkanoic acid synthase	NA	NA	NA	NA	NA
WP_059234031.1|2048168_2049350_+	acetyl-CoA C-acetyltransferase	NA	NA	NA	NA	NA
WP_059234032.1|2049470_2050211_+	3-ketoacyl-ACP reductase	NA	NA	NA	NA	NA
WP_059234033.1|2050329_2050896_+	polyhydroxyalkanoate synthesis repressor PhaR	NA	NA	NA	NA	NA
WP_059234034.1|2051294_2052140_+	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_059234035.1|2052336_2053377_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_059234036.1|2053530_2053785_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059234038.1|2054759_2058491_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_059234039.1|2058506_2059943_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_081051819.1|2059930_2060635_-	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_059234040.1|2060631_2062194_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_081051820.1|2062205_2062664_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059234042.1|2063136_2063640_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_081051900.1|2063674_2065162_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_059234044.1|2065177_2065606_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_059234045.1|2065625_2067392_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_059234046.1|2067355_2068375_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_059234047.1|2068371_2069724_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_059234048.1|2069720_2070797_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_059234049.1|2070793_2072131_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
>prophage 5
NZ_CP013730	Burkholderia cepacia JBK9 chromosome 1, complete sequence	3790084	2430843	2473734	3790084	head,terminase	Burkholderia_phage(70.73%)	58	NA	NA
WP_059234443.1|2430843_2431341_-	lysozyme	NA	Q3HQU9	Burkholderia_phage	92.7	1.9e-82
WP_006495243.1|2431333_2431516_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059234445.1|2431689_2431980_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155627147.1|2432019_2432235_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155627148.1|2432345_2432942_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081051843.1|2432952_2433519_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155627149.1|2433521_2435264_-	hypothetical protein	NA	Q6QI97	Burkholderia_phage	45.3	2.4e-60
WP_059234451.1|2435324_2435987_-	DUF2612 domain-containing protein	NA	A9YX13	Burkholderia_phage	88.2	2.0e-111
WP_059234454.1|2435986_2437168_-	hypothetical protein	NA	A9YX12	Burkholderia_phage	90.8	1.4e-192
WP_059234456.1|2437164_2437518_-	hypothetical protein	NA	A9YX11	Burkholderia_phage	91.5	6.9e-55
WP_059234458.1|2437526_2438279_-	hypothetical protein	NA	A9YX06	Burkholderia_phage	89.6	2.9e-119
WP_059234460.1|2438282_2438660_+	hypothetical protein	NA	A9YX05	Burkholderia_phage	90.4	1.3e-59
WP_059234463.1|2438656_2439625_-	hypothetical protein	NA	A9YX04	Burkholderia_phage	88.3	1.2e-144
WP_059234465.1|2439621_2439939_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059234467.1|2439938_2440514_-	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	38.0	2.4e-20
WP_059234469.1|2440510_2442637_-	hypothetical protein	NA	A0A0M4REK7	Salmonella_phage	35.8	1.6e-37
WP_059234471.1|2442820_2443381_-	hypothetical protein	NA	A0A0N7IRF3	Acinetobacter_phage	35.2	3.7e-18
WP_059234473.1|2443383_2443824_-	DUF3277 family protein	NA	A0A0P0IKY2	Acinetobacter_phage	57.5	1.6e-40
WP_059234474.1|2443839_2445315_-	DUF3383 domain-containing protein	NA	A0A0P0I492	Acinetobacter_phage	48.1	6.3e-110
WP_059234476.1|2445324_2445915_-	hypothetical protein	NA	A9YX29	Burkholderia_phage	91.8	1.4e-100
WP_059234478.1|2445919_2446291_-	hypothetical protein	NA	A9YX28	Burkholderia_phage	91.1	8.8e-61
WP_059234480.1|2446352_2446832_-	hypothetical protein	NA	A9YX26	Burkholderia_phage	94.3	6.7e-77
WP_059234482.1|2446861_2447242_-	DUF4054 domain-containing protein	NA	A9YX25	Burkholderia_phage	92.1	1.1e-58
WP_059236779.1|2447305_2447773_-	hypothetical protein	NA	A9YX24	Burkholderia_phage	90.0	2.8e-27
WP_059234484.1|2447783_2448875_-	DUF2184 domain-containing protein	NA	A9YX23	Burkholderia_phage	96.0	2.1e-155
WP_059234486.1|2448944_2449451_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059234488.1|2449460_2450924_-	DUF2213 domain-containing protein	NA	A9YX03	Burkholderia_phage	82.5	2.2e-195
WP_059234490.1|2451069_2451591_-	hypothetical protein	NA	A9YX01	Burkholderia_phage	92.5	1.8e-88
WP_059234492.1|2451671_2452427_-|head	phage head morphogenesis protein	head	A9YWZ8	Burkholderia_phage	96.8	3.0e-132
WP_059234494.1|2452423_2453890_-	DUF1073 domain-containing protein	NA	A9YWZ7	Burkholderia_phage	94.4	1.1e-263
WP_059234496.1|2453910_2455464_-|terminase	phage terminase large subunit	terminase	H9C0C7	Vibrio_phage	45.0	1.6e-111
WP_059234498.1|2455414_2455894_-	DUF2280 domain-containing protein	NA	A9YWZ5	Burkholderia_phage	77.0	2.9e-56
WP_059234500.1|2455915_2456575_-	hypothetical protein	NA	A9YWZ4	Burkholderia_phage	88.0	1.8e-112
WP_155627150.1|2456718_2456907_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155627151.1|2457039_2457222_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059234502.1|2457467_2458061_-	hypothetical protein	NA	A9YWZ1	Burkholderia_phage	93.2	8.2e-101
WP_059236781.1|2458057_2458351_-	hypothetical protein	NA	A9YWZ0	Burkholderia_phage	86.6	1.4e-40
WP_059234504.1|2458395_2458866_-	RusA family crossover junction endodeoxyribonuclease	NA	A9YWY9	Burkholderia_phage	92.3	3.6e-75
WP_059234506.1|2458862_2459123_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059236783.1|2459119_2459509_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155627152.1|2460396_2461086_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155627153.1|2461318_2461540_-	hypothetical protein	NA	A9YWY0	Burkholderia_phage	84.7	1.5e-28
WP_059234510.1|2461536_2461911_-	hypothetical protein	NA	A9YWX9	Burkholderia_phage	91.9	1.6e-62
WP_059234512.1|2462348_2462741_+	XRE family transcriptional regulator	NA	E5AGE6	Erwinia_phage	50.0	2.4e-08
WP_059236786.1|2463574_2464000_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059234513.1|2464134_2464518_+	hypothetical protein	NA	A9YWW9	Burkholderia_phage	54.0	1.3e-22
WP_059234516.1|2464514_2464937_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059234520.1|2464938_2465289_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059234522.1|2465285_2465531_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059234523.1|2465999_2466299_+	KTSC domain-containing protein	NA	A9YWW2	Burkholderia_phage	83.8	1.8e-40
WP_059234525.1|2466295_2467105_+	hypothetical protein	NA	J7HXJ4	Pseudomonas_phage	60.2	6.1e-91
WP_059236788.1|2467194_2468403_+	hypothetical protein	NA	A0A2I7RZ22	Vibrio_phage	34.6	2.9e-20
WP_059234526.1|2468433_2469318_+	cell division protein FtsK	NA	J7I0T4	Pseudomonas_phage	33.5	1.7e-33
WP_059234529.1|2469314_2471081_+	AAA family ATPase	NA	J7HXJ7	Pseudomonas_phage	36.4	3.3e-73
WP_059234531.1|2471077_2471710_+	hypothetical protein	NA	A9YX18	Burkholderia_phage	98.1	3.1e-21
WP_059236790.1|2471793_2472234_+	hypothetical protein	NA	A9YX19	Burkholderia_phage	89.9	4.4e-75
WP_059234533.1|2472243_2472879_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155627154.1|2473107_2473734_-	hypothetical protein	NA	Q8W6Q5	Burkholderia_virus	52.0	2.6e-36
>prophage 6
NZ_CP013730	Burkholderia cepacia JBK9 chromosome 1, complete sequence	3790084	3078423	3086706	3790084		Tanapox_virus(16.67%)	8	NA	NA
WP_059235469.1|3078423_3079344_+	alpha/beta hydrolase	NA	A7XCB7	Tanapox_virus	26.5	1.3e-20
WP_059235472.1|3079369_3080293_-	histone deacetylase family protein	NA	A0A2K9KZC4	Tupanvirus	34.9	6.7e-41
WP_081051863.1|3080336_3081680_+	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_059235476.1|3081756_3082659_-	cysteine synthase CysM	NA	A0A1X9I5F1	Streptococcus_phage	39.5	4.8e-52
WP_059235478.1|3082872_3083217_-	competence protein ComE	NA	NA	NA	NA	NA
WP_059235479.1|3083290_3084283_-	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	31.2	3.1e-28
WP_155627164.1|3084347_3085298_-	D-glycero-beta-D-manno-heptose-7-phosphate kinase	NA	A0A2H4N7X4	Lake_Baikal_phage	27.2	1.7e-15
WP_059235484.1|3085305_3086706_-	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	38.3	1.3e-75
>prophage 7
NZ_CP013730	Burkholderia cepacia JBK9 chromosome 1, complete sequence	3790084	3267125	3275218	3790084		Enterobacteria_phage(42.86%)	8	NA	NA
WP_059235769.1|3267125_3268430_-	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	36.3	1.6e-11
WP_059235771.1|3268416_3269562_-	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	A0A2K9L0G1	Tupanvirus	25.3	3.7e-17
WP_059235773.1|3269639_3270953_-	ABC transporter ATP-binding protein	NA	M1HV27	Acanthocystis_turfacea_Chlorella_virus	28.4	1.7e-05
WP_059235775.1|3270942_3271749_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_059235777.1|3271825_3272722_-	dTDP-4-dehydrorhamnose reductase	NA	I7HXC9	Enterobacteria_phage	34.0	9.4e-24
WP_059235779.1|3272718_3273267_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	47.5	7.7e-45
WP_059235781.1|3273251_3274145_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	K7QKA7	Escherichia_phage	60.8	5.7e-98
WP_059235783.1|3274156_3275218_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	48.3	6.6e-85
>prophage 1
NZ_CP013731	Burkholderia cepacia JBK9 chromosome 2, complete sequence	3400736	3062683	3143198	3400736	plate,protease,transposase	uncultured_Caudovirales_phage(18.18%)	56	NA	NA
WP_059240496.1|3062683_3064657_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	E5EQU5	Bathycoccus_sp._RCC1105_virus	42.3	2.9e-102
WP_059240497.1|3064742_3065210_+	OsmC family protein	NA	NA	NA	NA	NA
WP_059240498.1|3065225_3066632_-	alpha,alpha-trehalose-phosphate synthase (UDP-forming)	NA	NA	NA	NA	NA
WP_081052035.1|3067264_3068884_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	31.0	2.4e-25
WP_059240501.1|3069350_3071381_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_059240502.1|3072022_3072529_+	6,7-dimethyl-8-ribityllumazine synthase	NA	NA	NA	NA	NA
WP_059240503.1|3072634_3073066_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_059240504.1|3073062_3073980_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_059240988.1|3074281_3075247_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_059240505.1|3075299_3076394_+	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_059240506.1|3076464_3077397_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_081052036.1|3077431_3079234_-	amino acid ABC transporter permease/ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.3	3.6e-30
WP_059240507.1|3079295_3080648_-	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_059240508.1|3080655_3081705_-	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_059240509.1|3081757_3082705_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_059240510.1|3082763_3083324_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_059240511.1|3083803_3084727_-	recombination-associated protein RdgC	NA	A0A218M310	Acidovorax_phage	40.3	7.3e-56
WP_081052037.1|3085160_3086231_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059240991.1|3086495_3086972_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_059240512.1|3087098_3088133_-	deacylase	NA	NA	NA	NA	NA
WP_059240513.1|3088229_3089135_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_059240514.1|3089253_3089835_+	flavodoxin family protein	NA	NA	NA	NA	NA
WP_059240515.1|3089918_3090974_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_081052073.1|3091254_3091713_+	MEKHLA domain-containing protein	NA	NA	NA	NA	NA
WP_059240517.1|3091884_3092268_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_059240518.1|3092437_3092713_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059240519.1|3092976_3094527_-	sensor domain-containing diguanylate cyclase	NA	G3MA91	Bacillus_virus	38.0	4.4e-21
WP_059240520.1|3095017_3097897_+	xanthine dehydrogenase family protein molybdopterin-binding subunit	NA	NA	NA	NA	NA
WP_059240521.1|3097893_3098598_+	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
WP_059240522.1|3098594_3099854_+	cytochrome c	NA	NA	NA	NA	NA
WP_059240523.1|3100933_3101425_-	peptidoglycan-associated lipoprotein Pal	NA	NA	NA	NA	NA
WP_059240524.1|3101835_3103047_-	porin	NA	NA	NA	NA	NA
WP_059240525.1|3103270_3103849_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059240526.1|3104145_3105234_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059240527.1|3105254_3106670_-	HAMP domain-containing protein	NA	Q6XM27	Feldmannia_irregularis_virus	31.1	4.1e-05
WP_059240528.1|3106669_3107383_-	response regulator	NA	W8CYM9	Bacillus_phage	31.0	5.0e-28
WP_059240529.1|3107540_3108746_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_059240992.1|3108742_3109837_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_059240530.1|3109833_3110661_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.3	6.4e-11
WP_059240531.1|3110697_3113067_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_059240532.1|3113108_3113789_+	Fe2+-dependent dioxygenase	NA	A0A0E3G1Q6	Synechococcus_phage	32.7	1.7e-09
WP_081052074.1|3115514_3117464_+	Xaa-Pro dipeptidyl-peptidase	NA	NA	NA	NA	NA
WP_155627307.1|3117715_3119359_+	peptidase	NA	NA	NA	NA	NA
WP_059240535.1|3119372_3119774_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155627286.1|3119952_3122871_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059234118.1|3123901_3125392_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_059240538.1|3125596_3127087_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_155627287.1|3127391_3128189_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059240539.1|3128188_3132763_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059240540.1|3132759_3134058_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059240541.1|3134074_3134698_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059240542.1|3134754_3137028_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	26.4	1.6e-27
WP_059240543.1|3137024_3139673_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	29.3	2.6e-77
WP_059240993.1|3139685_3140777_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_059240544.1|3140773_3142645_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_059240545.1|3142649_3143198_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
