The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP007243	Leptospirillum ferriphilum YSK chromosome, complete genome	2330585	2650	14294	2330585	integrase	Bacillus_virus(25.0%)	9	NA	NA
WP_014959781.1|2650_5107_+	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	46.0	1.4e-13
WP_014959782.1|5162_7613_+	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	34.0	2.3e-101
WP_038504111.1|7593_8409_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_014959785.1|8454_9093_+	radical SAM protein	NA	S4TZT1	uncultured_phage	38.2	6.4e-27
WP_051613724.1|9095_9821_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A1B0Z0B4	Vibrio_phage	32.0	2.1e-21
WP_077397464.1|9882_11538_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	35.9	3.6e-45
WP_023524517.1|11600_12092_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	42.4	1.9e-26
WP_081824201.1|12669_13107_+	DUF4102 domain-containing protein	NA	A0A1B0VMI6	Pseudomonas_phage	52.0	3.1e-20
WP_038504122.1|13100_14294_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	55.4	2.0e-122
>prophage 2
NZ_CP007243	Leptospirillum ferriphilum YSK chromosome, complete genome	2330585	689266	697167	2330585		Bacillus_phage(33.33%)	10	NA	NA
WP_101494882.1|689266_690247_+	cysteine synthase A	NA	A0A1W6JIM2	Lactococcus_phage	50.7	1.5e-70
WP_038504826.1|690283_691096_+	molybdopterin-synthase adenylyltransferase MoeB	NA	A0A1V0SAV8	Catovirus	26.3	3.3e-12
WP_014960631.1|691058_692339_+	threonine synthase	NA	NA	NA	NA	NA
WP_014960632.1|692360_692642_+	MoaD/ThiS family protein	NA	NA	NA	NA	NA
WP_014960633.1|692638_692881_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014960634.1|692904_693708_+	molybdopterin-synthase adenylyltransferase MoeB	NA	A0A291ATS8	Pandoravirus	34.6	8.2e-11
WP_014960635.1|693707_694136_+	M67 family metallopeptidase	NA	NA	NA	NA	NA
WP_038504828.1|694135_694831_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	34.5	1.3e-33
WP_051613776.1|694841_696203_+	PAS domain-containing protein	NA	W8CYF6	Bacillus_phage	38.9	6.6e-37
WP_014960638.1|696195_697167_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	37.2	3.2e-46
>prophage 3
NZ_CP007243	Leptospirillum ferriphilum YSK chromosome, complete genome	2330585	982133	1045036	2330585	tRNA,protease,integrase,transposase	uncultured_Mediterranean_phage(27.27%)	42	988040:988088	1027197:1027245
WP_014960898.1|982133_983018_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_077303498.1|983133_984060_+	S-methyl-5'-thioadenosine phosphorylase	NA	NA	NA	NA	NA
WP_148302411.1|984088_985030_+	sugar kinase	NA	NA	NA	NA	NA
WP_101494861.1|985155_985803_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_053764696.1|985855_986878_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014960904.1|986920_987928_+	PEGA domain-containing protein	NA	NA	NA	NA	NA
988040:988088	attL	AGTCGATTCGTAATCGACAGGTCGTCGGTTCAATCCCGACCGCCGGCTC	NA	NA	NA	NA
WP_038505118.1|988176_989235_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158423130.1|989729_989873_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158423131.1|989929_990622_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051613792.1|990614_991925_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038505124.1|992130_992505_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051613793.1|992519_993428_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_038505127.1|993772_994345_-	Uma2 family endonuclease	NA	NA	NA	NA	NA
WP_038505130.1|994749_996654_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_038505133.1|996769_999859_-	ABC transporter	NA	A0A1B1IUG5	uncultured_Mediterranean_phage	33.1	7.7e-09
WP_038505136.1|999906_1003425_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_038505138.1|1003424_1004690_-	DNA repair exonuclease	NA	NA	NA	NA	NA
WP_051613794.1|1005143_1006265_-	AAA family ATPase	NA	A0A0R6PGP8	Moraxella_phage	30.8	8.7e-11
WP_038505143.1|1006416_1006608_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148302412.1|1006830_1008036_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	27.2	7.7e-13
WP_038505145.1|1007813_1008242_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_038505148.1|1008433_1013617_+	DEAD/DEAH box helicase	NA	A0A1B1IUF6	uncultured_Mediterranean_phage	22.8	4.2e-68
WP_038505152.1|1013613_1016511_+	DEAD/DEAH box helicase	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	27.6	3.8e-42
WP_051613796.1|1016507_1020443_+	N-6 DNA methylase	NA	NA	NA	NA	NA
WP_148302413.1|1020451_1022074_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158423132.1|1022070_1022637_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038505163.1|1022633_1024592_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014449431.1|1025135_1025456_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_038505169.1|1025458_1025800_-	addiction module protein	NA	A0A141GEX6	Brucella_phage	38.0	1.9e-09
WP_038505171.1|1026017_1027040_-|integrase	site-specific integrase	integrase	W6MYA3	Pseudomonas_phage	45.9	2.5e-73
WP_038505176.1|1028098_1029511_+	TolC family protein	NA	NA	NA	NA	NA
1027197:1027245	attR	AGTCGATTCGTAATCGACAGGTCGTCGGTTCAATCCCGACCGCCGGCTC	NA	NA	NA	NA
WP_038505178.1|1029500_1030757_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_038505181.1|1030753_1033957_+	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	22.4	1.0e-64
WP_038505184.1|1033953_1034334_+	copper-binding protein	NA	NA	NA	NA	NA
WP_014961492.1|1034358_1034712_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038505190.1|1035074_1035395_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_038505194.1|1035397_1035739_-	addiction module protein	NA	A0A141GEX6	Brucella_phage	38.0	2.5e-09
WP_158423133.1|1037628_1038546_+	DUF1348 family protein	NA	NA	NA	NA	NA
WP_038505196.1|1038918_1039998_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_158423134.1|1041380_1042253_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A292GJG6	Xanthomonas_phage	50.4	1.3e-25
WP_143461257.1|1042249_1042543_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014960908.1|1042594_1045036_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A223W0B1	Agrobacterium_phage	34.7	8.5e-128
>prophage 4
NZ_CP007243	Leptospirillum ferriphilum YSK chromosome, complete genome	2330585	1163543	1173231	2330585	tRNA	Staphylococcus_phage(28.57%)	10	NA	NA
WP_014961032.1|1163543_1165016_+|tRNA	cysteine--tRNA ligase	tRNA	A0A0G2Y344	Acanthamoeba_polyphaga_mimivirus	32.4	3.9e-43
WP_038505275.1|1165030_1165747_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_023525480.1|1165883_1166528_+	TlpA family protein disulfide reductase	NA	A0A1J0GW78	Streptomyces_phage	34.6	1.4e-05
WP_014961035.1|1166524_1168303_+	NAD+ synthase	NA	A0A2L0UZF5	Agrobacterium_phage	30.7	8.0e-75
WP_014961036.1|1168354_1169557_+	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	47.1	9.1e-99
WP_023525479.1|1169575_1170061_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	35.5	2.3e-16
WP_014961038.1|1170057_1170564_+	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_014961039.1|1170560_1171061_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014961040.1|1171147_1172461_+	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	33.0	8.6e-18
WP_014961041.1|1172511_1173231_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3HI61	Synechococcus_phage	39.2	2.7e-42
>prophage 5
NZ_CP007243	Leptospirillum ferriphilum YSK chromosome, complete genome	2330585	1960992	2004547	2330585	transposase,tRNA,integrase,protease	Pseudomonas_phage(33.33%)	47	1969824:1969839	2001512:2001527
WP_038506093.1|1960992_1962261_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_014961837.1|1962274_1963408_-	flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase	NA	NA	NA	NA	NA
WP_014961838.1|1963470_1964535_-|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
WP_038506096.1|1964558_1965740_-	1-deoxy-D-xylulose-5-phosphate reductoisomerase	NA	NA	NA	NA	NA
WP_038506098.1|1965761_1966601_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_081824158.1|1966597_1967398_-	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	42.2	1.4e-23
WP_038506100.1|1967394_1969323_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051613898.1|1969319_1970993_-	formate--tetrahydrofolate ligase	NA	NA	NA	NA	NA
1969824:1969839	attL	GTTCCATTCTTCCGGT	NA	NA	NA	NA
WP_038506104.1|1971137_1971995_-	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_038506107.1|1972084_1972843_-	twin-arginine translocase subunit TatC	NA	NA	NA	NA	NA
WP_014961846.1|1972832_1973132_-	protein translocase TatA	NA	NA	NA	NA	NA
WP_014961847.1|1973134_1973371_-	YdcH family protein	NA	NA	NA	NA	NA
WP_014961848.1|1973461_1974076_-	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_038506110.1|1974056_1974704_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_038506113.1|1974700_1976086_-	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_038506114.1|1976221_1976965_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038506116.1|1976977_1977622_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014961854.1|1977618_1978977_-|protease	Zn-dependent protease	protease	NA	NA	NA	NA
WP_038507513.1|1978973_1980404_-|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_148302450.1|1980611_1981670_+	serine hydrolase	NA	NA	NA	NA	NA
WP_038506119.1|1981627_1982581_-	squalene/phytoene synthase family protein	NA	NA	NA	NA	NA
WP_014961858.1|1982577_1984053_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_023524784.1|1984045_1985008_-	squalene/phytoene synthase family protein	NA	NA	NA	NA	NA
WP_023524783.1|1985130_1985886_+	creatininase family protein	NA	NA	NA	NA	NA
WP_038507519.1|1985902_1986529_+	AAA family ATPase	NA	A2I303	Vibrio_virus	36.3	9.4e-31
WP_038506122.1|1986531_1986801_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051613901.1|1986767_1987727_+	LD-carboxypeptidase	NA	NA	NA	NA	NA
WP_143461176.1|1987731_1989285_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014961866.1|1989474_1989930_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148302451.1|1989937_1990366_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077303616.1|1990588_1991281_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_038506131.1|1991253_1991820_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038506133.1|1991997_1992654_+	DUF4912 domain-containing protein	NA	NA	NA	NA	NA
WP_014961871.1|1992696_1993374_+	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_038506135.1|1993373_1994645_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038506137.1|1994644_1995724_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158423177.1|1995819_1996302_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081824160.1|1996709_1997090_+|integrase	site-specific integrase	integrase	B5WZU7	Pseudomonas_phage	51.9	1.1e-21
WP_148302452.1|1997145_1998388_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	51.8	2.8e-66
WP_038506146.1|1998502_1999147_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038506148.1|1999406_2000159_+	TIGR04255 family protein	NA	NA	NA	NA	NA
WP_038506150.1|2000155_2000749_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158423178.1|2000745_2001165_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148302453.1|2001307_2003257_-	AAA family ATPase	NA	A0A1P8DII4	Virus_Rctr197k	27.7	1.2e-10
2001512:2001527	attR	GTTCCATTCTTCCGGT	NA	NA	NA	NA
WP_038506154.1|2003513_2003852_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038506157.1|2003848_2004136_+	XRE family transcriptional regulator	NA	A0A2D1GR59	Pseudomonas_phage	50.0	1.1e-10
WP_158423179.1|2004400_2004547_-|transposase	transposase	transposase	NA	NA	NA	NA
