The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP004858	Bacillus thuringiensis serovar kurstaki str. YBT-1520, complete genome	5602565	229725	369791	5602565	transposase,tRNA,protease,portal,head,capsid,tail,integrase,terminase,holin	Bacillus_phage(54.84%)	140	298103:298137	322140:322174
WP_000908522.1|229725_230298_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_000583417.1|230391_230751_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_002100659.1|230907_231858_+	outer membrane lipoprotein carrier protein LolA	NA	NA	NA	NA	NA
WP_000390616.1|231975_233145_+	alanine racemase	NA	NA	NA	NA	NA
WP_000004570.1|233453_233741_+	antitoxin EndoAI	NA	NA	NA	NA	NA
WP_000635965.1|233745_234096_+	type II toxin-antitoxin system endoribonuclease NdoA	NA	A0A2P0ZKX3	Lactobacillus_phage	37.7	1.7e-13
WP_000426236.1|234163_236332_+	RNA-binding transcriptional accessory protein	NA	NA	NA	NA	NA
WP_001143642.1|236390_236507_-	cortex morphogenetic protein CmpA	NA	NA	NA	NA	NA
WP_000344239.1|236702_237161_+	SprT family protein	NA	NA	NA	NA	NA
WP_000049649.1|243654_244128_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_000865756.1|244108_244801_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_000367190.1|244814_245258_+	ribosomal-protein-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_000414585.1|245257_246274_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	43.4	1.9e-68
WP_001987845.1|246758_248738_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	29.9	2.8e-52
WP_000372699.1|248871_249501_+	redox-sensing transcriptional repressor Rex	NA	NA	NA	NA	NA
WP_001246200.1|249530_249722_-	YdiK family protein	NA	NA	NA	NA	NA
WP_000745326.1|249718_250468_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000917311.1|250859_251144_+	co-chaperone GroES	NA	A0A221S3C8	uncultured_virus	54.8	1.2e-20
WP_001029993.1|251182_252817_+	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	58.0	1.5e-157
WP_016090299.1|252895_254074_-|integrase	site-specific integrase	integrase	S6C485	Thermus_phage	62.9	8.0e-140
WP_016090298.1|254122_254707_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016090297.1|254929_255199_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016090295.1|255501_255828_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016090294.1|255929_258359_+	DUF927 domain-containing protein	NA	Q4ZE73	Staphylococcus_phage	32.6	2.2e-83
WP_016090293.1|258690_258918_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016090291.1|259071_260268_+|portal	phage portal protein	portal	A0A1L2BY94	Clostridium_phage	35.9	5.0e-65
WP_016090290.1|260264_260843_+|head,protease	HK97 family phage prohead protease	head,protease	Q8SBP9	Clostridium_phage	30.2	2.6e-11
WP_016090289.1|260847_262110_+|capsid	phage major capsid protein	capsid	NA	NA	NA	NA
WP_016090288.1|262176_262464_+|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
WP_016090287.1|262456_262747_+	HNH endonuclease	NA	R9TNN2	Paenibacillus_phage	53.2	1.6e-25
WP_016090286.1|262873_263221_+	hypothetical protein	NA	A0A290GJQ7	Caldibacillus_phage	43.9	3.9e-18
WP_044157420.1|263273_264866_+|terminase	terminase large subunit	terminase	A0A290GJW3	Caldibacillus_phage	52.6	2.8e-156
WP_016090284.1|264882_265212_+|head	phage head closure protein	head	NA	NA	NA	NA
WP_016090283.1|265224_265434_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000743906.1|266153_267692_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	31.7	8.8e-22
WP_021729274.1|267757_268825_-|integrase	site-specific integrase	integrase	A0A0S2MV79	Bacillus_phage	100.0	1.5e-201
WP_021729275.1|268851_269292_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A0S2MV59	Bacillus_phage	100.0	1.8e-81
WP_038413181.1|269305_269785_-	helix-turn-helix transcriptional regulator	NA	A0A0S2MVI1	Bacillus_phage	98.7	7.6e-81
WP_001042666.1|269970_270225_+	DUF739 family protein	NA	A0A0S2MVA3	Bacillus_phage	98.8	5.5e-38
WP_000383685.1|270238_270427_+	hypothetical protein	NA	A0A0S2MV91	Bacillus_phage	100.0	4.5e-29
WP_038413182.1|270651_271467_+	antirepressor	NA	A0A0S2MV65	Bacillus_phage	83.3	1.8e-122
WP_001187283.1|271478_271667_+	hypothetical protein	NA	A0A2H4J4V8	uncultured_Caudovirales_phage	62.9	2.6e-13
WP_038413183.1|271693_272128_+	hypothetical protein	NA	A0A0S2MVA8	Bacillus_phage	97.9	1.5e-72
WP_000178946.1|272145_272859_+	hypothetical protein	NA	A0A0S2MV99	Bacillus_phage	99.6	1.9e-128
WP_038413184.1|272858_273074_+	hypothetical protein	NA	A0A1C8E9A6	Bacillus_phage	94.4	3.6e-30
WP_038413186.1|273006_273345_+	hypothetical protein	NA	A0A0S2MVH7	Bacillus_phage	98.2	7.5e-51
WP_038413188.1|273438_274392_+	DnaD domain protein	NA	A0A0S2MVA0	Bacillus_phage	90.2	4.9e-148
WP_038413190.1|274403_274883_+	hypothetical protein	NA	A0A1C8E9A8	Bacillus_phage	96.9	1.4e-82
WP_038413192.1|274875_275106_+	hypothetical protein	NA	A0A1C8E9C2	Bacillus_phage	97.4	1.7e-33
WP_001245737.1|275129_275687_+	hypothetical protein	NA	A0A1B1P7A6	Bacillus_phage	70.8	2.0e-64
WP_038413194.1|275725_276160_+	hypothetical protein	NA	A0A2H4JBD8	uncultured_Caudovirales_phage	95.8	2.3e-76
WP_038413196.1|276218_276509_+	hypothetical protein	NA	A0A1C8EA94	Bacillus_phage	95.8	1.7e-51
WP_001093039.1|276655_277447_+	prohibitin family protein	NA	A0A1C8E9A9	Bacillus_phage	100.0	6.8e-143
WP_038413198.1|277529_277889_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000540089.1|277927_278455_+	Holliday junction resolvase RecU	NA	A0A1C8E9C3	Bacillus_phage	98.9	8.3e-97
WP_038413201.1|278451_278778_+	hypothetical protein	NA	A0A1C8E9C1	Bacillus_phage	97.2	1.4e-57
WP_038413911.1|278815_279217_+	hypothetical protein	NA	A0A1C8E9D1	Bacillus_phage	97.7	5.2e-67
WP_038413203.1|279602_280028_-	pilus assembly protein HicB	NA	A0A2H4J4X8	uncultured_Caudovirales_phage	78.7	2.5e-59
WP_071686481.1|280079_280262_-	type II toxin-antitoxin system HicA family toxin	NA	A0A0U4KLG1	Pseudomonas_phage	67.2	9.4e-16
WP_038413205.1|280439_280661_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038413207.1|280677_280980_+	HNH endonuclease	NA	A0A1S5SD32	Streptococcus_phage	46.6	2.4e-08
WP_038413209.1|280982_281378_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038413211.1|281470_281833_+	hypothetical protein	NA	A0A290GJQ7	Caldibacillus_phage	43.5	2.4e-18
WP_038413214.1|281829_283530_+|terminase	terminase large subunit	terminase	A0A290GJW3	Caldibacillus_phage	72.5	2.6e-248
WP_038413216.1|283543_284767_+|portal	phage portal protein	portal	A0A0A8WJ25	Clostridium_phage	61.3	1.3e-140
WP_000361708.1|284723_285308_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2I7SBY1	Paenibacillus_phage	44.6	2.7e-32
WP_038413218.1|285324_286509_+|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	23.1	7.3e-08
WP_001016250.1|286524_286782_+	hypothetical protein	NA	A6XMJ7	Bacillus_virus	43.2	1.1e-06
WP_038413220.1|286778_287051_+	DNA-packaging protein	NA	R9TMB7	Paenibacillus_phage	55.1	3.6e-19
WP_038413222.1|287047_287347_+|head	phage head closure protein	head	NA	NA	NA	NA
WP_038413224.1|287339_287696_+	HK97 gp10 family phage protein	NA	D2XR21	Bacillus_phage	59.0	2.0e-33
WP_038413227.1|287692_288022_+	hypothetical protein	NA	A0A2H4JAG4	uncultured_Caudovirales_phage	85.3	1.2e-48
WP_001004921.1|288022_288616_+|tail	phage tail protein	tail	A0A2H4JDV4	uncultured_Caudovirales_phage	93.3	6.7e-103
WP_038413229.1|288622_288985_+	hypothetical protein	NA	A0A2H4JAG8	uncultured_Caudovirales_phage	69.2	1.2e-41
WP_140161228.1|290319_290433_-	TRASH domain-containing protein	NA	NA	NA	NA	NA
WP_151152591.1|290466_292860_+	hypothetical protein	NA	A0A2H4JC82	uncultured_Caudovirales_phage	41.4	4.3e-39
WP_038413233.1|292901_294371_+|tail	phage tail protein	tail	A0A0S2MV63	Bacillus_phage	78.7	3.2e-231
298103:298137	attL	GGTTTAGGTACTGTCAACGAGTTGCGTGATGCTAA	NA	NA	NA	NA
WP_023901837.1|299943_300321_+	hypothetical protein	NA	A0A0S2MVE0	Bacillus_phage	64.5	2.7e-41
WP_031310537.1|300351_300603_+	peptidase	NA	A0A1B1P7E0	Bacillus_phage	72.5	7.3e-27
WP_038413236.1|301128_302403_+	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_021729298.1|302501_302732_+|holin	phage holin	holin	A0A0S2MVE8	Bacillus_phage	96.1	2.8e-33
WP_038413238.1|302749_303682_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A0S2MVR5	Bacillus_phage	84.6	7.2e-160
WP_021729103.1|304294_304495_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049866899.1|304748_305432_+	antirepressor	NA	A0A0S2MV65	Bacillus_phage	80.0	9.8e-98
WP_000665325.1|305444_305642_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000235015.1|306881_307757_+	ATP-binding protein	NA	Q2I8C8	Bacillus_phage	47.2	4.3e-66
WP_000337986.1|307772_307967_+	hypothetical protein	NA	A0A0U3K3J8	Bacillus_phage	76.6	1.0e-20
WP_000805170.1|307992_308166_+	DUF3954 domain-containing protein	NA	A0A1B1P7U5	Bacillus_phage	91.2	2.6e-23
WP_000811696.1|308180_308435_+	hypothetical protein	NA	A0A1B0T6B9	Bacillus_phage	88.1	1.4e-36
WP_038413245.1|308443_308908_+	hypothetical protein	NA	A0A2H4J8I5	uncultured_Caudovirales_phage	35.4	5.7e-17
WP_000665841.1|308934_309147_+	hypothetical protein	NA	A0A1B0T6B5	Bacillus_phage	93.5	1.5e-25
WP_002134037.1|309191_309377_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000387671.1|309428_309827_+	hypothetical protein	NA	A0A068ELY9	Bacillus_phage	79.1	2.8e-57
WP_000805074.1|309851_310274_+	hypothetical protein	NA	A0A1B1P7B4	Bacillus_phage	82.9	2.3e-65
WP_000397931.1|310449_310716_+	hypothetical protein	NA	D2XR50	Bacillus_phage	42.7	2.2e-13
WP_000404182.1|310753_311152_+	hypothetical protein	NA	W8CYU3	Bacillus_phage	75.0	1.2e-52
WP_000365653.1|311438_311657_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000234108.1|311843_312026_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000525861.1|312524_312806_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049866900.1|312921_313266_+	hypothetical protein	NA	A0A0S2GLJ9	Bacillus_phage	91.7	6.1e-24
WP_001012113.1|313265_313808_+|integrase	site-specific integrase	integrase	W8CYP1	Bacillus_phage	92.2	1.3e-89
WP_000124642.1|314483_314744_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000336221.1|314885_315290_+	hypothetical protein	NA	Q2I8B8	Bacillus_phage	75.0	2.7e-47
WP_038413249.1|315286_315622_+	HNH endonuclease	NA	D2XR61	Bacillus_phage	91.0	6.8e-52
WP_038413251.1|315772_316108_+	hypothetical protein	NA	A0A1B1P762	Bacillus_phage	31.5	2.3e-07
WP_000615714.1|316104_317763_+|terminase	terminase large subunit	terminase	A0A2H4JHE9	uncultured_Caudovirales_phage	79.3	1.0e-257
WP_044157418.1|317828_318935_+|portal	phage portal protein	portal	A0A2H4JAJ1	uncultured_Caudovirales_phage	89.9	2.4e-186
WP_038413253.1|318918_319695_+|protease	Clp protease ClpP	protease	A0A0A7RWX3	Clostridium_phage	57.7	4.3e-57
WP_038413255.1|319715_320879_+	hypothetical protein	NA	A0A2H4JH29	uncultured_Caudovirales_phage	96.1	1.6e-209
WP_001243199.1|320891_321188_+	hypothetical protein	NA	A0A2H4JF26	uncultured_Caudovirales_phage	87.8	1.6e-41
WP_000818829.1|321551_321989_+	hypothetical protein	NA	A0A2H4JBV5	uncultured_Caudovirales_phage	93.1	7.4e-75
WP_038413259.1|326821_327187_+	hypothetical protein	NA	A0A0S2MVE0	Bacillus_phage	55.7	5.0e-32
322140:322174	attR	GGTTTAGGTACTGTCAACGAGTTGCGTGATGCTAA	NA	NA	NA	NA
WP_038413261.1|327313_327538_+	hypothetical protein	NA	A0A1B1P780	Bacillus_phage	86.5	1.2e-25
WP_038413263.1|327613_328039_+|holin	phage holin family protein	holin	A0A1B1P787	Bacillus_phage	94.3	1.0e-68
WP_000403436.1|328038_328977_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A0S2MV84	Bacillus_phage	94.7	3.3e-136
WP_080703592.1|329428_330679_+|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	41.6	3.0e-68
WP_000956437.1|331682_331949_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002134199.1|331964_332156_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000741567.1|332497_333574_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	86.6	1.2e-171
WP_038413265.1|335062_335329_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031310119.1|335344_335536_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038413267.1|335877_336096_+	hypothetical protein	NA	A0A1C8E991	Bacillus_phage	90.3	1.0e-29
WP_021729050.1|336120_336417_+	hypothetical protein	NA	A0A2H4J3A2	uncultured_Caudovirales_phage	82.5	7.6e-39
WP_038413270.1|336505_337390_-	cytosolic protein	NA	A0A0S2MVF4	Bacillus_phage	81.2	2.6e-119
WP_000833096.1|338104_339430_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	29.4	4.1e-44
WP_000929880.1|339573_340275_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.0	9.5e-40
WP_000719210.1|340258_341764_+	aminopeptidase AmpS	NA	W8CYF6	Bacillus_phage	30.0	7.8e-31
WP_000723976.1|347109_348069_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000687949.1|348268_349000_+	DsbA family oxidoreductase	NA	NA	NA	NA	NA
WP_001072418.1|354188_354647_-	ASCH domain-containing protein	NA	NA	NA	NA	NA
WP_001279960.1|355009_355807_-	undecaprenyl-diphosphate phosphatase UppP	NA	NA	NA	NA	NA
WP_000247716.1|355824_356562_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000074580.1|356554_357484_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	44.2	2.3e-41
WP_000845334.1|357552_358566_-	HAMP domain-containing histidine kinase	NA	A0A2K9L4R6	Tupanvirus	21.6	3.1e-07
WP_000651991.1|358555_359269_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	38.1	3.4e-37
WP_000690999.1|364551_365628_-	glycosyl transferase	NA	NA	NA	NA	NA
WP_001058693.1|365851_366724_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000405117.1|366751_367474_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_002134075.1|367693_368461_-	RNA methyltransferase	NA	A0A288WG17	Bacillus_phage	51.9	7.4e-62
WP_038413276.1|368495_369791_+|transposase	IS21-like element IS232 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	28.8	5.3e-12
>prophage 2
NZ_CP004858	Bacillus thuringiensis serovar kurstaki str. YBT-1520, complete genome	5602565	389599	397975	5602565		Synechococcus_phage(50.0%)	8	NA	NA
WP_000625682.1|389599_390907_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	25.3	4.9e-21
WP_001170544.1|390995_391715_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	G8EYA2	Synechococcus_phage	44.3	4.0e-49
WP_000278823.1|391707_391962_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_000666789.1|391958_392642_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_000055562.1|392625_394845_+	phosphoribosylformylglycinamidine synthase II	NA	A6N228	Microbacterium_phage	41.2	2.6e-163
WP_000879025.1|394829_396245_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	35.4	3.3e-55
WP_001262439.1|396350_397391_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	45.9	1.2e-67
WP_000088589.1|397387_397975_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	37.4	9.1e-28
>prophage 3
NZ_CP004858	Bacillus thuringiensis serovar kurstaki str. YBT-1520, complete genome	5602565	754416	813208	5602565	portal,protease,head,capsid,tail,integrase,terminase,transposase	Bacillus_phage(91.84%)	60	764164:764182	810574:810592
WP_001252962.1|754416_756816_+|protease	M6 family metalloprotease domain-containing protein	protease	NA	NA	NA	NA
WP_000658667.1|757134_757476_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000964468.1|757497_757923_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000873276.1|757843_758998_-	MFS transporter	NA	NA	NA	NA	NA
WP_000645827.1|759223_760276_+	(R,R)-butanediol dehydrogenase	NA	E3SJ82	Synechococcus_phage	27.6	3.9e-21
WP_000948209.1|760395_760740_+	two pore domain potassium channel family protein	NA	NA	NA	NA	NA
WP_087970930.1|760783_761943_-|transposase	IS3-like element ISBth8 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	42.0	2.5e-37
WP_000730997.1|762284_763136_+	phospholipase C	NA	NA	NA	NA	NA
WP_038413299.1|763212_764259_+	sphingomyelin phosphodiesterase	NA	A0A1P8L6H7	Staphylococcus_phage	59.0	1.1e-87
764164:764182	attL	AATGATTACTCTGATCATT	NA	NA	NA	NA
WP_000262047.1|764197_765298_-|integrase	site-specific integrase	integrase	A0A0S2GLI2	Bacillus_phage	100.0	8.6e-205
WP_000466636.1|765815_767054_+	hypothetical protein	NA	I7J4K0	Bacillus_phage	100.0	8.2e-236
WP_000511082.1|767453_767798_-	helix-turn-helix transcriptional regulator	NA	I7J6V3	Bacillus_phage	100.0	4.2e-57
WP_000813892.1|767977_768214_+	helix-turn-helix transcriptional regulator	NA	A0A0S2GLE0	Bacillus_phage	100.0	8.7e-38
WP_000549466.1|768246_768435_+	helix-turn-helix transcriptional regulator	NA	A0A0S2GLE9	Bacillus_phage	100.0	3.2e-27
WP_038413302.1|769459_770557_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0E3M2X0	Bacillus_phage	23.4	2.1e-09
WP_001028065.1|770553_772563_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_000247457.1|772555_772960_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000349585.1|773028_773820_-	glyoxalase	NA	A0A288WG17	Bacillus_phage	68.4	6.8e-103
WP_000027993.1|773860_774634_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_000794364.1|774722_775511_-	hypothetical protein	NA	A0A288WG17	Bacillus_phage	51.4	2.8e-64
WP_002133890.1|775557_775866_+	YolD-like family protein	NA	NA	NA	NA	NA
WP_038413304.1|775910_776729_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A0S2GLD4	Bacillus_phage	92.6	2.0e-153
WP_000159646.1|776728_776935_-	hypothetical protein	NA	D2XR32	Bacillus_phage	97.1	1.3e-32
WP_000215408.1|776937_777219_-	hypothetical protein	NA	A0A0S2GM64	Bacillus_phage	81.7	2.4e-34
WP_038413306.1|777255_777633_-	hypothetical protein	NA	A0A0S2MVE0	Bacillus_phage	56.8	8.7e-32
WP_155266935.1|781022_781460_+	hypothetical protein	NA	A0A0S2MV63	Bacillus_phage	91.0	1.5e-72
WP_038413308.1|781456_781846_+	hypothetical protein	NA	A0A0S2MVB4	Bacillus_phage	85.3	4.3e-58
WP_080703593.1|781950_782370_+	hypothetical protein	NA	A0A0A7AQG2	Bacillus_phage	84.4	7.9e-58
WP_015382178.1|782799_783045_+	hypothetical protein	NA	A0A0S2GLK0	Bacillus_phage	100.0	9.0e-38
WP_000792998.1|783416_783599_+	hypothetical protein	NA	A0A0S2GLH0	Bacillus_phage	100.0	3.1e-27
WP_001050326.1|783680_784547_+	hypothetical protein	NA	A0A0S2GLF7	Bacillus_phage	100.0	2.8e-166
WP_000443964.1|784595_784781_+	hypothetical protein	NA	A0A0S2GLH7	Bacillus_phage	100.0	8.6e-25
WP_000002720.1|784809_785049_+	hypothetical protein	NA	A0A0S2GLE8	Bacillus_phage	98.7	5.2e-22
WP_001198493.1|785413_785668_+	hypothetical protein	NA	A0A0S2GLL6	Bacillus_phage	100.0	3.9e-44
WP_001139459.1|785657_786035_+	HNH endonuclease	NA	A0A0S2GLI5	Bacillus_phage	100.0	6.8e-69
WP_000233388.1|786163_786667_+|terminase	phage terminase small subunit P27 family	terminase	A0A0S2GLF2	Bacillus_phage	100.0	8.0e-89
WP_015382179.1|786668_788363_+|terminase	terminase large subunit	terminase	A0A0S2GLF0	Bacillus_phage	100.0	0.0e+00
WP_015382180.1|788551_789805_+|portal	phage portal protein	portal	A0A0S2GLJ4	Bacillus_phage	99.8	3.5e-242
WP_015382181.1|789791_790502_+|protease	Clp protease ClpP	protease	A0A0S2GLD5	Bacillus_phage	100.0	5.5e-128
WP_015382182.1|790539_791706_+|capsid	phage major capsid protein	capsid	A0A0S2GLG0	Bacillus_phage	100.0	3.3e-210
WP_000244586.1|791726_792014_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0S2GLH6	Bacillus_phage	100.0	1.8e-45
WP_001068030.1|792000_792324_+|head	phage head closure protein	head	H0USW8	Bacillus_phage	100.0	1.1e-56
WP_000763223.1|792316_792754_+	HK97 gp10 family phage protein	NA	A0A0S2GLH3	Bacillus_phage	100.0	7.9e-77
WP_000609197.1|792750_793110_+	DUF3168 domain-containing protein	NA	A0A0S2GLE3	Bacillus_phage	100.0	3.5e-62
WP_000896661.1|793110_793716_+|tail	tail protein	tail	A0A0S2GLI0	Bacillus_phage	100.0	9.2e-100
WP_000779042.1|793762_794080_+	hypothetical protein	NA	A0A0S2GLH2	Bacillus_phage	100.0	8.9e-54
WP_038413316.1|794300_798227_+|tail	phage tail tape measure protein	tail	A0A0S2GLG8	Bacillus_phage	100.0	0.0e+00
WP_000232880.1|798238_799723_+|tail	phage tail protein	tail	A0A0S2GLF9	Bacillus_phage	100.0	9.9e-297
WP_015382189.1|799719_803745_+	minor structural protein	NA	A0A0S2GLH1	Bacillus_phage	100.0	0.0e+00
WP_000822820.1|803841_804801_+|integrase	site-specific integrase	integrase	A0A0S2GLC8	Bacillus_phage	99.7	3.1e-182
WP_000151530.1|804814_805096_+	hypothetical protein	NA	A0A0S2GM64	Bacillus_phage	100.0	9.1e-42
WP_000542506.1|805311_806130_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A0S2GLD4	Bacillus_phage	100.0	3.2e-164
WP_000423300.1|806170_806500_-	hypothetical protein	NA	A0A0S2GLG3	Bacillus_phage	100.0	2.4e-54
WP_000467327.1|806568_806790_-	helix-turn-helix transcriptional regulator	NA	A0A0S2GLH4	Bacillus_phage	100.0	2.9e-35
WP_000495118.1|807252_807573_+	hypothetical protein	NA	A0A0S2GLK1	Bacillus_phage	100.0	1.9e-51
WP_000511371.1|807583_808750_+	DNA translocase FtsK	NA	A0A0S2GLG9	Bacillus_phage	100.0	9.4e-226
WP_000842173.1|808739_809348_+	hypothetical protein	NA	A0A0S2GLL8	Bacillus_phage	100.0	3.3e-113
WP_000730127.1|809352_810234_-	HTH domain-containing protein	NA	I7ILW0	Bacillus_phage	100.0	1.5e-159
WP_000373746.1|810731_811904_+	amino acid deaminase/aldolase	NA	NA	NA	NA	NA
810574:810592	attR	AATGATTACTCTGATCATT	NA	NA	NA	NA
WP_000948949.1|811891_813208_+	FAD-binding protein	NA	A0A2K9L0J9	Tupanvirus	22.1	5.3e-07
>prophage 4
NZ_CP004858	Bacillus thuringiensis serovar kurstaki str. YBT-1520, complete genome	5602565	1283501	1314811	5602565	portal,protease,head,capsid,tail,terminase,transposase	Bacillus_phage(42.11%)	43	NA	NA
WP_000333967.1|1283501_1285280_+	asparagine synthase (glutamine-hydrolyzing)	NA	A0A1V0SGM7	Hokovirus	27.3	1.6e-22
WP_000650392.1|1285310_1286714_-	recombinase family protein	NA	A0A2I7SDG6	Paenibacillus_phage	44.8	1.5e-113
WP_000289677.1|1286857_1287076_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000130922.1|1287091_1287775_-	LexA family transcriptional regulator	NA	D7RWF2	Brochothrix_phage	34.2	1.3e-22
WP_000385074.1|1287924_1288197_+	helix-turn-helix transcriptional regulator	NA	A0A141E0W0	Streptococcus_phage	50.0	3.0e-10
WP_000372563.1|1288679_1289432_+	phage regulatory protein	NA	A0A2H4JBC7	uncultured_Caudovirales_phage	81.0	4.8e-106
WP_001186272.1|1289443_1289632_+	hypothetical protein	NA	A0A2H4J4V8	uncultured_Caudovirales_phage	96.8	6.1e-26
WP_000453494.1|1289658_1290093_+	hypothetical protein	NA	A0A0S2MVA8	Bacillus_phage	99.3	1.1e-73
WP_000178947.1|1290111_1290825_+	hypothetical protein	NA	A0A0S2MV99	Bacillus_phage	98.3	1.0e-126
WP_015382226.1|1290824_1291040_+	hypothetical protein	NA	A0A1C8E9A6	Bacillus_phage	97.2	5.5e-31
WP_038413358.1|1290972_1291311_+	hypothetical protein	NA	A0A0S2MVH7	Bacillus_phage	96.4	2.6e-51
WP_000510888.1|1291404_1292358_+	DnaD domain protein	NA	A0A0S2MVA0	Bacillus_phage	90.2	6.4e-148
WP_000933912.1|1292369_1292849_+	hypothetical protein	NA	A0A2H4J396	uncultured_Caudovirales_phage	93.7	1.3e-80
WP_000139235.1|1292841_1293072_+	hypothetical protein	NA	A0A1C8E9C2	Bacillus_phage	100.0	2.5e-34
WP_015382228.1|1293095_1293653_+	hypothetical protein	NA	A0A1B1P7A6	Bacillus_phage	71.4	4.0e-65
WP_001010921.1|1293691_1294126_+	hypothetical protein	NA	A0A1C8E9B0	Bacillus_phage	95.1	1.3e-76
WP_001268033.1|1294184_1294475_+	hypothetical protein	NA	A0A1C8EA94	Bacillus_phage	94.8	8.4e-51
WP_000356654.1|1295498_1295681_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000389429.1|1295840_1296245_+	hypothetical protein	NA	I6TG10	Staphylococcus_virus	37.1	7.7e-10
WP_000590880.1|1296478_1296790_+	hypothetical protein	NA	A0A0A7AR06	Bacillus_phage	83.5	2.9e-41
WP_000540088.1|1296825_1297353_+	Holliday junction resolvase RecU	NA	A0A1C8E9C3	Bacillus_phage	98.3	5.4e-96
WP_038413362.1|1297349_1297676_+	hypothetical protein	NA	A0A1C8E9C1	Bacillus_phage	97.2	2.3e-57
WP_033676375.1|1297713_1298115_+	hypothetical protein	NA	A0A1C8E9D1	Bacillus_phage	98.5	1.8e-67
WP_000711196.1|1298497_1298917_-	HicB family protein	NA	A0A2H4J4X8	uncultured_Caudovirales_phage	79.9	7.6e-61
WP_071686481.1|1298968_1299151_-	type II toxin-antitoxin system HicA family toxin	NA	A0A0U4KLG1	Pseudomonas_phage	67.2	9.4e-16
WP_000196707.1|1299329_1299530_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001051281.1|1299546_1299849_+	HNH endonuclease	NA	A0A1B0YEC6	Lactobacillus_phage	48.5	1.5e-18
WP_001149928.1|1299851_1300247_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001282601.1|1300339_1300702_+	hypothetical protein	NA	A0A290GJQ7	Caldibacillus_phage	43.5	2.4e-18
WP_033676369.1|1300710_1302399_+|terminase	terminase large subunit	terminase	A0A290GJW3	Caldibacillus_phage	72.6	3.9e-249
WP_000522435.1|1302412_1303591_+|portal	phage portal protein	portal	A0A0A8WJ25	Clostridium_phage	61.6	5.5e-141
WP_000499523.1|1303685_1304879_-|transposase	IS110-like element ISBth13 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	26.1	1.1e-24
WP_000361708.1|1305175_1305760_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2I7SBY1	Paenibacillus_phage	44.6	2.7e-32
WP_001031425.1|1305776_1306961_+|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	24.4	5.1e-09
WP_001016250.1|1306976_1307234_+	hypothetical protein	NA	A6XMJ7	Bacillus_virus	43.2	1.1e-06
WP_000600950.1|1307230_1307503_+	DNA-packaging protein	NA	R9TMB7	Paenibacillus_phage	53.9	3.0e-18
WP_000998123.1|1307499_1307799_+|head	phage head closure protein	head	NA	NA	NA	NA
WP_001273706.1|1307791_1308148_+	HK97 gp10 family phage protein	NA	D2XR21	Bacillus_phage	60.7	3.0e-34
WP_000172080.1|1308144_1308474_+	hypothetical protein	NA	A0A2H4JAG4	uncultured_Caudovirales_phage	83.5	2.9e-47
WP_001004921.1|1308474_1309068_+|tail	phage tail protein	tail	A0A2H4JDV4	uncultured_Caudovirales_phage	93.3	6.7e-103
WP_000415929.1|1309074_1309437_+	hypothetical protein	NA	A0A2H4JAG8	uncultured_Caudovirales_phage	70.0	6.8e-42
WP_015382231.1|1309667_1313300_+	hypothetical protein	NA	A0A2H4JAI2	uncultured_Caudovirales_phage	84.1	2.4e-182
WP_000094123.1|1313341_1314811_+|tail	phage tail protein	tail	A0A0S2MV63	Bacillus_phage	79.6	2.8e-235
>prophage 5
NZ_CP004858	Bacillus thuringiensis serovar kurstaki str. YBT-1520, complete genome	5602565	1319666	1326656	5602565	holin	Bacillus_phage(50.0%)	9	NA	NA
WP_038413365.1|1319666_1320041_+	hypothetical protein	NA	A0A0S2MVE0	Bacillus_phage	97.6	1.0e-64
WP_000373898.1|1320078_1320504_+|holin	phage holin family protein	holin	A0A0S2MVC4	Bacillus_phage	100.0	2.6e-72
WP_000405773.1|1320503_1321436_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A0S2MVR5	Bacillus_phage	84.2	3.3e-157
WP_000742862.1|1321601_1322168_-	hypothetical protein	NA	A6XML2	Bacillus_virus	45.7	5.9e-24
WP_001016122.1|1322307_1322526_+	hypothetical protein	NA	A0A2H4JC50	uncultured_Caudovirales_phage	90.3	3.6e-30
WP_000100788.1|1322550_1322841_+	hypothetical protein	NA	A0A1C8E992	Bacillus_phage	90.7	9.3e-42
WP_000730207.1|1322858_1323692_-	hypothetical protein	NA	A0A2H4J6G7	uncultured_Caudovirales_phage	81.9	2.6e-121
WP_000163133.1|1324170_1325130_+	ferrochelatase	NA	NA	NA	NA	NA
WP_038413367.1|1325189_1326656_+	catalase	NA	A0A2K9L572	Tupanvirus	47.2	2.2e-123
>prophage 6
NZ_CP004858	Bacillus thuringiensis serovar kurstaki str. YBT-1520, complete genome	5602565	2019769	2027920	5602565		Bacillus_phage(66.67%)	7	NA	NA
WP_000755525.1|2019769_2021050_+	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	31.5	3.4e-11
WP_001194306.1|2021149_2021914_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000453861.1|2022154_2023915_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	98.0	2.4e-273
WP_000612414.1|2024000_2024678_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	99.1	1.1e-122
WP_001231621.1|2024674_2025748_+	HAMP domain-containing sensor histidine kinase	NA	W8CYF6	Bacillus_phage	98.0	6.1e-187
WP_000818979.1|2026037_2026757_+	3-ketoacyl-ACP reductase	NA	W8CYX9	Bacillus_phage	100.0	5.9e-61
WP_001258538.1|2027047_2027920_+	aminoglycoside 6-adenylyltransferase	NA	A0A1X9I6F2	Streptococcus_phage	44.7	2.1e-65
>prophage 7
NZ_CP004858	Bacillus thuringiensis serovar kurstaki str. YBT-1520, complete genome	5602565	2046297	2104443	5602565	protease,transposase,coat	Bacillus_phage(25.0%)	56	NA	NA
WP_000710470.1|2046297_2047455_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q331V1	Clostridium_botulinum_C_phage	59.0	1.8e-123
WP_001163356.1|2047611_2049420_+	Petrobactin biosynthesis protein AsbA	NA	NA	NA	NA	NA
WP_000798699.1|2050146_2050899_-	AAA family ATPase	NA	A0A059NT77	Lactococcus_phage	47.3	7.0e-57
WP_000275580.1|2050888_2052184_-|transposase	IS21-like element IS232 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	28.8	5.3e-12
WP_000909581.1|2053494_2054733_+	AMP-binding protein	NA	NA	NA	NA	NA
WP_001250558.1|2054729_2054996_+	petrobactin biosynthesis protein AsbD	NA	NA	NA	NA	NA
WP_000200704.1|2055019_2056003_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000877670.1|2056040_2056883_+	sugar phosphate isomerase/epimerase	NA	NA	NA	NA	NA
WP_000113545.1|2057007_2057214_+	alpha/beta-type small acid-soluble spore protein	NA	Q77YX0	Bacillus_phage	63.1	3.4e-14
WP_033667350.1|2057449_2058679_+	MFS transporter	NA	NA	NA	NA	NA
WP_001287305.1|2058732_2059347_-	amino acid transporter	NA	NA	NA	NA	NA
WP_000439399.1|2059465_2060908_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_000816391.1|2060920_2061088_+	DUF3933 domain-containing protein	NA	NA	NA	NA	NA
WP_000686789.1|2061201_2062167_-	patatin-like phospholipase family protein	NA	A0A1V0SKV5	Klosneuvirus	31.2	1.1e-25
WP_000540423.1|2062254_2062395_-	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_001034835.1|2062618_2063371_+	DUF1963 domain-containing protein	NA	NA	NA	NA	NA
WP_000024999.1|2065016_2065478_+	NUDIX hydrolase	NA	A0A2I6PFL2	Proteus_phage	35.1	8.5e-05
WP_000174901.1|2065527_2066346_-	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	63.3	1.7e-93
WP_001026002.1|2066621_2068502_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000648325.1|2068617_2068905_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A2I7SC16	Paenibacillus_phage	56.5	1.2e-12
WP_000099756.1|2069179_2070127_+|protease	serine protease	protease	A0A127AWU5	Bacillus_phage	57.4	1.4e-94
WP_001259906.1|2070168_2070477_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000874082.1|2070583_2071519_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_001082497.1|2071566_2072742_+	MFS transporter	NA	NA	NA	NA	NA
WP_001101741.1|2072790_2072997_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001198794.1|2073140_2073503_+	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_000162602.1|2073702_2073927_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000426317.1|2074011_2074359_-	DUF4257 domain-containing protein	NA	NA	NA	NA	NA
WP_001073075.1|2075264_2076317_+	ribosome small subunit-dependent GTPase A	NA	NA	NA	NA	NA
WP_000517294.1|2076517_2078500_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	31.0	3.5e-23
WP_000539571.1|2078696_2079002_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000965059.1|2079324_2079690_+	DUF3979 domain-containing protein	NA	NA	NA	NA	NA
WP_000370203.1|2079724_2080765_-	membrane protein	NA	NA	NA	NA	NA
WP_000105199.1|2081005_2081449_+	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	62.1	6.2e-45
WP_000488206.1|2081551_2082007_+	DUF3939 domain-containing protein	NA	NA	NA	NA	NA
WP_000798320.1|2082222_2083167_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087942833.1|2083227_2084570_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	37.3	6.3e-32
WP_000594031.1|2084682_2085684_-	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000683357.1|2085788_2085980_-	DUF3896 domain-containing protein	NA	NA	NA	NA	NA
WP_001168116.1|2086157_2087621_+	flavin monoamine oxidase family protein	NA	A0A2K9L022	Tupanvirus	22.3	1.2e-15
WP_001068749.1|2087705_2088290_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000376357.1|2088314_2089217_-	aldo/keto reductase family oxidoreductase	NA	NA	NA	NA	NA
WP_001040871.1|2089478_2090948_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	G3MB42	Bacillus_virus	41.7	2.7e-68
WP_000613420.1|2091045_2091996_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_001048676.1|2092108_2092579_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001126151.1|2092717_2093668_-	zinc ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002132987.1|2093932_2094154_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001042736.1|2095865_2096525_+	oxidoreductase	NA	NA	NA	NA	NA
WP_001083648.1|2096554_2097592_-	NADPH dehydrogenase NamA	NA	NA	NA	NA	NA
WP_000283913.1|2097725_2098178_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	41.0	1.1e-25
WP_002098546.1|2098203_2099190_+	DUF2628 domain-containing protein	NA	NA	NA	NA	NA
WP_000824280.1|2099274_2100936_+	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000943769.1|2100995_2101412_+	FosB/FosD family fosfomycin resistance bacillithiol transferase	NA	Q2LI91	Bacillus_phage	64.8	1.3e-39
WP_000858822.1|2101984_2102596_+	phosphoserine phosphatase 1	NA	NA	NA	NA	NA
WP_000817485.1|2102642_2103185_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000937997.1|2103366_2104443_+|coat	spore coat protein CotH	coat	NA	NA	NA	NA
>prophage 8
NZ_CP004858	Bacillus thuringiensis serovar kurstaki str. YBT-1520, complete genome	5602565	2134044	2150269	5602565	bacteriocin,integrase,tail	Bacillus_phage(75.0%)	12	2132959:2133018	2150613:2151033
2132959:2133018	attL	ATGGTCACAGTGTTTCTTACTTTACAGAAGAATTTGCAATGAATAATATTGCTTCCAAAG	NA	NA	NA	NA
WP_038413464.1|2134044_2137893_+|tail	phage tail tape measure protein	tail	A0A288WG88	Bacillus_phage	88.7	0.0e+00
WP_038413466.1|2137904_2139389_+|tail	phage tail protein	tail	A0A0S2GLF9	Bacillus_phage	99.4	1.9e-295
WP_038413468.1|2139385_2143411_+	phage minor structural protein	NA	A0A0S2GLH1	Bacillus_phage	89.9	0.0e+00
WP_000822831.1|2143512_2144472_+|integrase	site-specific integrase	integrase	A0A0U3B271	Bacillus_phage	94.4	1.2e-173
WP_000389067.1|2144524_2144755_+|bacteriocin	bacteriocin biosynthesis protein	bacteriocin	A0A1B1P7Q9	Bacillus_phage	93.4	5.3e-32
WP_000751888.1|2144751_2145816_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A2H4JAS1	uncultured_Caudovirales_phage	93.8	5.4e-196
WP_000669561.1|2145885_2146689_-	hypothetical protein	NA	A6M971	Geobacillus_virus	41.3	5.4e-23
WP_000941958.1|2146688_2146895_-	helix-turn-helix transcriptional regulator	NA	A0A288WG80	Bacillus_phage	41.5	4.1e-07
WP_001257568.1|2147083_2147398_+	hypothetical protein	NA	H0USY0	Bacillus_phage	96.2	7.7e-50
WP_000170790.1|2147394_2147577_+	hypothetical protein	NA	A0A288WGN6	Bacillus_phage	90.0	1.1e-21
WP_000891545.1|2147692_2148874_+	cell division protein FtsK	NA	H0USY1	Bacillus_phage	93.4	1.9e-213
WP_000730123.1|2149444_2150269_-	helix-turn-helix domain-containing protein	NA	A0A2H4J969	uncultured_Caudovirales_phage	66.9	2.1e-99
2150613:2151033	attR	ATGGTCACAGTGTTTCTTACTTTACAGAAGAATTTGCAATGAATAATATTGCTTCCAAAGATGAACGTGTCATGCGAGCGTTAAATGAAACTTTAAATTTAGAGCGGTATCCTGACAAAGTTAGAAACTTATCAGATGAGATGTATTGCATATGTCTGTATGCTGATGATACAGAAGCTCAAAAATTCATTGAAAGATATCCAGCACTTACGTTTGAGCGTTTTCATGGTTACGTTATAAATGTATTGGAAGATAGTAAAGTATCGAAGCTAACTGCAATTCAAAAAGTATTGGAACATTTAAACATTAGTAAATTAGAAGCCATTGCTTTTGGCGATGGTGGAAATGATATTGAGATGTTGCAGTATGTAGGATTAGGAGTTGCGATGGGAAATGGTGGAGAGGAGTTGAAGAGAAGGGC	NA	NA	NA	NA
>prophage 9
NZ_CP004858	Bacillus thuringiensis serovar kurstaki str. YBT-1520, complete genome	5602565	4593125	4600811	5602565		Bacillus_phage(33.33%)	9	NA	NA
WP_000221066.1|4593125_4594049_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	43.5	1.5e-45
WP_000609140.1|4594174_4595110_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	24.8	9.2e-22
WP_000018029.1|4595111_4595804_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	38.2	3.7e-36
WP_001014310.1|4596146_4596341_+	YwbE family protein	NA	NA	NA	NA	NA
WP_001255971.1|4596379_4597579_-	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	41.2	1.6e-71
WP_000587826.1|4597874_4598198_+	heme oxygenase	NA	NA	NA	NA	NA
WP_001086121.1|4598270_4599035_-	class B sortase	NA	NA	NA	NA	NA
WP_000403760.1|4599067_4599838_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	28.6	7.6e-14
WP_001036847.1|4599827_4600811_-	iron ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	27.2	2.5e-17
>prophage 10
NZ_CP004858	Bacillus thuringiensis serovar kurstaki str. YBT-1520, complete genome	5602565	4950683	5047183	5602565	transposase,tRNA,protease,portal,head,capsid,tail,integrase,terminase,holin,coat	Bacillus_phage(77.42%)	100	4945210:4945229	5034603:5034622
4945210:4945229	attL	TTTTGTCGGTAAATCGATAT	NA	NA	NA	NA
WP_000287147.1|4950683_4952060_+|tRNA	glycine--tRNA ligase	tRNA	A0A1V0SIF1	Klosneuvirus	27.9	5.8e-49
WP_087942833.1|4952173_4953515_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	37.3	6.3e-32
WP_001140612.1|4953570_4953954_-	hotdog fold thioesterase	NA	NA	NA	NA	NA
WP_000810336.1|4954049_4954793_+	DUF3298 and DUF4163 domain-containing protein	NA	NA	NA	NA	NA
WP_001252163.1|4954843_4955437_+	biotin transporter BioY	NA	NA	NA	NA	NA
WP_002097988.1|4955482_4956370_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	54.1	7.0e-80
WP_001104221.1|4956477_4958202_-	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	53.5	1.6e-176
WP_000545253.1|4958345_4958951_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000487942.1|4959125_4960610_-	cytosol aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	36.9	8.7e-59
WP_000920098.1|4960769_4961396_-	hypothetical protein	NA	A0A0H3UZG2	Geobacillus_virus	42.1	6.1e-14
WP_000027016.1|4961482_4961800_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000415321.1|4961796_4962303_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_000856612.1|4962426_4963635_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000829788.1|4964096_4965086_+	NAD(P)/FAD-dependent oxidoreductase	NA	Q9JRK7	Streptococcus_phage	52.4	3.0e-31
WP_000815771.1|4965198_4975170_-	DUF11 domain-containing protein	NA	NA	NA	NA	NA
WP_000902159.1|4975640_4976120_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000391942.1|4976285_4977533_+	MFS transporter	NA	NA	NA	NA	NA
WP_000535259.1|4977550_4978432_-	decarboxylase	NA	NA	NA	NA	NA
WP_000635484.1|4978511_4978973_+	DUF523 domain-containing protein	NA	NA	NA	NA	NA
WP_000710530.1|4979295_4980123_+	hypothetical protein	NA	A0A2H4J6G7	uncultured_Caudovirales_phage	69.5	1.8e-101
WP_000551103.1|4980132_4980753_-	hypothetical protein	NA	H0USY2	Bacillus_phage	93.2	6.5e-109
WP_000891535.1|4980694_4981876_-	cell division protein FtsK	NA	H0USY1	Bacillus_phage	94.4	9.0e-216
WP_000170777.1|4981991_4982174_-	hypothetical protein	NA	Q2I8E2	Bacillus_phage	90.0	1.4e-22
WP_001257569.1|4982170_4982488_-	hypothetical protein	NA	H0USY0	Bacillus_phage	98.1	6.4e-52
WP_000649833.1|4982670_4982868_+	helix-turn-helix transcriptional regulator	NA	A0A288WG80	Bacillus_phage	76.2	3.4e-19
WP_001137905.1|4982876_4983056_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000043398.1|4983061_4983640_+	hypothetical protein	NA	H0USX9	Bacillus_phage	88.5	2.2e-95
WP_000119484.1|4983693_4984032_+	hypothetical protein	NA	A0A1B1P7R0	Bacillus_phage	92.9	4.6e-48
WP_000405777.1|4986008_4986710_-	N-acetylmuramoyl-L-alanine amidase	NA	W8CZ46	Bacillus_phage	89.8	6.4e-121
WP_000373903.1|4986709_4987135_-|holin	phage holin family protein	holin	H0USX7	Bacillus_phage	97.2	7.0e-70
WP_001260185.1|4987559_4991585_-	hypothetical protein	NA	H0USX5	Bacillus_phage	93.6	0.0e+00
WP_000517105.1|4991581_4993063_-|tail	phage tail protein	tail	W8CYY9	Bacillus_phage	99.6	5.4e-295
WP_000108316.1|4995628_4997434_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	28.1	5.5e-31
WP_000344049.1|4999621_4999798_-	hypothetical protein	NA	W8CYG0	Bacillus_phage	100.0	6.7e-27
WP_015382489.1|4999827_5000145_-	hypothetical protein	NA	W8CYN3	Bacillus_phage	97.1	4.9e-52
WP_000896769.1|5000191_5000800_-|tail	tail protein	tail	W8CYT6	Bacillus_phage	94.1	1.3e-98
WP_000609194.1|5000800_5001160_-	DUF3168 domain-containing protein	NA	H0USX0	Bacillus_phage	96.6	2.5e-60
WP_000763219.1|5001156_5001591_-	HK97 gp10 family phage protein	NA	H0USW9	Bacillus_phage	100.0	1.8e-76
WP_015382490.1|5001583_5001907_-|head	phage head closure protein	head	H0USW8	Bacillus_phage	99.1	3.3e-56
WP_000244586.1|5001893_5002181_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0S2GLH6	Bacillus_phage	100.0	1.8e-45
WP_038413786.1|5002201_5003368_-|capsid	phage major capsid protein	capsid	W8CYN2	Bacillus_phage	96.4	7.5e-207
WP_001259159.1|5003405_5004116_-|protease	Clp protease ClpP	protease	W8CYT5	Bacillus_phage	95.8	2.4e-123
WP_000577489.1|5004102_5005356_-|portal	phage portal protein	portal	A0A0S2GLJ4	Bacillus_phage	99.3	1.7e-241
WP_000621131.1|5005544_5007239_-|terminase	terminase large subunit	terminase	A0A0S2GLF0	Bacillus_phage	99.6	0.0e+00
WP_000233390.1|5007240_5007744_-|terminase	phage terminase small subunit P27 family	terminase	A0A0S2GLF2	Bacillus_phage	99.4	1.0e-88
WP_001139454.1|5007873_5008251_-	HNH endonuclease	NA	A0A0S2GLI5	Bacillus_phage	94.4	2.1e-65
WP_000773601.1|5008629_5008842_-	hypothetical protein	NA	H0USV9	Bacillus_phage	97.1	1.0e-29
WP_000002725.1|5008858_5009098_-	hypothetical protein	NA	W8CZ42	Bacillus_phage	93.7	1.1e-16
WP_000443965.1|5009132_5009312_-	hypothetical protein	NA	W8CYF7	Bacillus_phage	98.3	6.0e-23
WP_000464752.1|5009357_5009585_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000017440.1|5009621_5009909_-	hypothetical protein	NA	H0USV6	Bacillus_phage	91.6	1.7e-43
WP_015382276.1|5010311_5010557_-	hypothetical protein	NA	W8CYG8	Bacillus_phage	97.5	6.5e-36
WP_001012176.1|5010763_5011306_-|integrase	site-specific integrase	integrase	A0A0S2GLG4	Bacillus_phage	100.0	3.3e-96
WP_000166155.1|5011302_5011788_-	ArpU family transcriptional regulator	NA	A0A0S2GLJ9	Bacillus_phage	99.4	1.8e-85
WP_000965619.1|5012145_5012427_-	hypothetical protein	NA	A0A0S2GLD3	Bacillus_phage	100.0	8.7e-45
WP_000404184.1|5013835_5014243_-	hypothetical protein	NA	A0A0S2GLF8	Bacillus_phage	100.0	4.9e-73
WP_038413787.1|5014596_5014896_-	hypothetical protein	NA	A0A0S2GLL5	Bacillus_phage	99.0	1.8e-51
WP_000705118.1|5015046_5015346_+	hypothetical protein	NA	A0A0S2GLD6	Bacillus_phage	100.0	1.9e-50
WP_001025406.1|5015342_5015558_-	hypothetical protein	NA	A0A0S2GLC6	Bacillus_phage	100.0	8.7e-37
WP_000817807.1|5015575_5015740_-	DUF3954 domain-containing protein	NA	A0A0S2GLF5	Bacillus_phage	100.0	1.0e-24
WP_000436951.1|5015811_5016078_-	hypothetical protein	NA	A0A0S2GLK4	Bacillus_phage	100.0	7.7e-43
WP_002133989.1|5016119_5016932_-	hypothetical protein	NA	A0A0S2GLK2	Bacillus_phage	100.0	1.2e-155
WP_015382176.1|5016894_5017911_-	hypothetical protein	NA	A0A0S2GLI6	Bacillus_phage	100.0	2.8e-189
WP_015382495.1|5018134_5018782_-	sigma-70 family RNA polymerase sigma factor	NA	A0A0S2GLJ1	Bacillus_phage	99.5	8.9e-117
WP_000218620.1|5019056_5019371_-	hypothetical protein	NA	A0A0S2GLB6	Bacillus_phage	100.0	1.1e-51
WP_000960416.1|5019532_5020249_-	hypothetical protein	NA	Q3HL19	Bacillus_phage	78.2	6.4e-100
WP_000277643.1|5020566_5020755_-	helix-turn-helix domain-containing protein	NA	A0A1B2APY7	Phage_Wrath	80.6	2.6e-21
WP_000368216.1|5020899_5021145_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000005253.1|5021392_5021722_+	helix-turn-helix transcriptional regulator	NA	H0UST7	Bacillus_phage	97.2	5.6e-51
WP_001164934.1|5022124_5023255_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000896931.1|5023422_5023653_-	hypothetical protein	NA	H0UST5	Bacillus_phage	90.8	8.5e-30
WP_000237487.1|5024615_5025677_+|integrase	site-specific integrase	integrase	A0A1B2AQ00	Phage_Wrath	83.9	3.5e-171
WP_000833145.1|5025765_5026119_-	YxeA family protein	NA	A0A0K2CYS5	Paenibacillus_phage	39.7	4.5e-14
WP_000834606.1|5026742_5027507_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087942842.1|5027932_5029277_+|transposase	IS3-like element ISBth10 family transposase	transposase	A0A1B1P773	Bacillus_phage	74.4	3.6e-112
WP_000573825.1|5029359_5029713_-	iron-sulfur cluster assembly accessory protein	NA	A0A2H4N7M3	Lake_Baikal_phage	43.3	3.7e-16
WP_000077397.1|5029754_5030621_-	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_000595026.1|5030889_5031129_-	YuzB family protein	NA	NA	NA	NA	NA
WP_000682077.1|5031475_5032546_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_001054089.1|5032779_5032953_+	aspartyl-phosphate phosphatase Spo0E family protein	NA	NA	NA	NA	NA
WP_000470265.1|5033008_5033668_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.7	1.3e-22
WP_000679246.1|5033651_5034449_+	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_000212737.1|5034669_5035011_-	alkylphosphonate utilization operon protein PhnA	NA	NA	NA	NA	NA
5034603:5034622	attR	ATATCGATTTACCGACAAAA	NA	NA	NA	NA
WP_000622258.1|5035170_5035452_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003285671.1|5035521_5036319_-	DUF2628 domain-containing protein	NA	NA	NA	NA	NA
WP_000607080.1|5036607_5036991_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000383681.1|5037027_5037282_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000843107.1|5037371_5037842_+	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_002101500.1|5037828_5038467_+	DUF4304 domain-containing protein	NA	NA	NA	NA	NA
WP_000049707.1|5038517_5039186_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002101505.1|5039308_5040103_-	DUF4111 domain-containing protein	NA	NA	NA	NA	NA
WP_000248588.1|5040155_5040464_-	YuzD family protein	NA	NA	NA	NA	NA
WP_000431159.1|5040659_5040896_+	NifU family protein	NA	Q58MC7	Prochlorococcus_phage	46.6	2.0e-10
WP_001125494.1|5041090_5041306_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000614218.1|5041367_5042369_-|coat	spore coat protein CotS	coat	NA	NA	NA	NA
WP_000665094.1|5042489_5042981_+	phosphatidylglycerophosphatase A	NA	G3MBC5	Bacillus_virus	53.8	3.5e-41
WP_000351147.1|5043004_5043508_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001106091.1|5043670_5044774_+	HpcH/HpaI aldolase/citrate lyase family protein	NA	NA	NA	NA	NA
WP_000856300.1|5044718_5046065_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000241505.1|5046070_5047183_+|protease	cysteine protease StiP family protein	protease	NA	NA	NA	NA
>prophage 11
NZ_CP004858	Bacillus thuringiensis serovar kurstaki str. YBT-1520, complete genome	5602565	5151509	5248491	5602565	tRNA,protease,portal,head,capsid,tail,integrase,terminase,holin	Bacillus_phage(36.21%)	112	5196279:5196299	5232203:5232223
WP_001021098.1|5151509_5152769_-|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	42.4	9.0e-89
WP_001057102.1|5153138_5154056_-	UDP-N-acetylmuramate dehydrogenase	NA	NA	NA	NA	NA
WP_000573649.1|5154438_5154834_-	SET domain-containing protein	NA	NA	NA	NA	NA
WP_000455078.1|5155042_5156545_-	DUF4077 domain-containing protein	NA	NA	NA	NA	NA
WP_000714051.1|5156577_5157636_-	endonuclease	NA	NA	NA	NA	NA
WP_001986875.1|5157952_5158387_+	fluoride efflux transporter CrcB	NA	NA	NA	NA	NA
WP_000568580.1|5158383_5158740_+	fluoride efflux transporter CrcB	NA	NA	NA	NA	NA
WP_000980954.1|5158768_5159008_-	DUF3947 family protein	NA	NA	NA	NA	NA
WP_000792610.1|5159074_5159287_-	DUF3955 domain-containing protein	NA	NA	NA	NA	NA
WP_001293750.1|5159467_5160661_-	MFS transporter	NA	A0A2K5B2B5	Erysipelothrix_phage	32.6	2.0e-42
WP_000054869.1|5160666_5162214_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	29.2	6.7e-54
WP_001071092.1|5162651_5163167_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000834708.1|5163309_5163714_-	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
WP_000635745.1|5163763_5164726_-	NERD domain-containing protein	NA	NA	NA	NA	NA
WP_001036620.1|5165187_5166153_+	DUF4822 domain-containing protein	NA	NA	NA	NA	NA
WP_000576729.1|5166359_5167898_-	anthrolysin O/cereolysin O family cholesterol-dependent cytolysin	NA	NA	NA	NA	NA
WP_000590071.1|5168346_5169099_-	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_000631245.1|5169095_5170160_-	iron chelate uptake ABC transporter family permease subunit	NA	NA	NA	NA	NA
WP_000042063.1|5170156_5171173_-	iron chelate uptake ABC transporter family permease subunit	NA	A0A2H4IY97	uncultured_Caudovirales_phage	37.1	6.0e-59
WP_000749436.1|5171192_5172209_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000815809.1|5172536_5173214_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_002101540.1|5174464_5174785_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000169371.1|5175528_5176836_-	group II intron reverse transcriptase/maturase	NA	H7BV92	unidentified_phage	24.2	1.7e-10
WP_001100112.1|5177009_5177189_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000915084.1|5178742_5179675_+|holin	choline-binding protein A	holin	NA	NA	NA	NA
WP_001123919.1|5180482_5180950_-	SsrA-binding protein	NA	W5RAM5	Staphylococcus_phage	63.2	5.4e-47
WP_000391097.1|5181076_5183515_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	40.6	1.7e-91
WP_000976870.1|5183657_5184401_-	carboxylesterase	NA	NA	NA	NA	NA
WP_000557264.1|5184559_5184793_-	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_000078304.1|5184887_5185580_-	LrgB family protein	NA	NA	NA	NA	NA
WP_000673222.1|5185576_5185945_-|holin	CidA/LrgA family holin-like protein	holin	NA	NA	NA	NA
WP_001125064.1|5186297_5187248_+	nucleoside hydrolase	NA	NA	NA	NA	NA
WP_000103951.1|5187299_5188595_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	75.4	1.1e-182
WP_001231158.1|5188625_5190155_-	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_038413800.1|5190151_5190907_-	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_001036350.1|5190939_5192124_-	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_000161236.1|5192263_5193268_-	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_038413802.1|5193314_5194322_-	gapA transcriptional regulator CggR	NA	NA	NA	NA	NA
WP_000869730.1|5194457_5194703_-	glutaredoxin family protein	NA	NA	NA	NA	NA
WP_000647955.1|5194712_5196020_-	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
5196279:5196299	attL	CGCGCCCAGAGGGATTCGAAC	NA	NA	NA	NA
WP_038413978.1|5196586_5197420_+	hypothetical protein	NA	A0A2H4J6G7	uncultured_Caudovirales_phage	82.2	3.8e-120
WP_038413806.1|5197733_5197982_+	hypothetical protein	NA	A0A1B1P7Q5	Bacillus_phage	95.1	2.7e-37
WP_038413808.1|5198060_5198393_+	hypothetical protein	NA	A0A2H4J846	uncultured_Caudovirales_phage	70.0	1.5e-32
WP_038413809.1|5198571_5199624_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1C8E990	Bacillus_phage	93.1	6.4e-189
WP_038413810.1|5199620_5199824_-	hypothetical protein	NA	A0A1B1P886	Bacillus_phage	95.3	8.8e-31
WP_038413980.1|5199825_5200035_-	hypothetical protein	NA	A0A1B2APY8	Phage_Wrath	84.8	7.0e-23
WP_038413811.1|5200084_5201365_-	DUF2479 domain-containing protein	NA	A0A1C8E978	Bacillus_phage	77.5	3.1e-190
WP_038413812.1|5201379_5203722_-	endopeptidase	NA	A0A1B1P7P0	Bacillus_phage	97.8	0.0e+00
WP_038413814.1|5203718_5204402_-	hypothetical protein	NA	A0A1B1P7Q0	Bacillus_phage	97.8	9.1e-128
WP_038413816.1|5204403_5207925_-|tail	phage tail tape measure protein	tail	A0A1B1P7P9	Bacillus_phage	84.9	1.6e-284
WP_000113342.1|5208168_5208555_-	hypothetical protein	NA	A0A1C8E984	Bacillus_phage	100.0	7.3e-66
WP_038413819.1|5208566_5209202_-|tail	phi13 family phage major tail protein	tail	A0A1C8E980	Bacillus_phage	96.2	3.8e-112
WP_038413820.1|5209213_5209591_-	HK97 gp10 family phage protein	NA	A0A1C8E995	Bacillus_phage	99.2	5.1e-64
WP_038413822.1|5209590_5209920_-	hypothetical protein	NA	A0A1B0T6B7	Bacillus_phage	96.3	4.4e-56
WP_038413824.1|5209909_5210245_-	phage protein	NA	A0A1B0T691	Bacillus_phage	97.2	7.2e-54
WP_038413826.1|5210219_5210480_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1C8E967	Bacillus_phage	94.2	1.7e-39
WP_038413828.1|5210481_5211849_-|capsid	phage major capsid protein	capsid	A0A1B2APY9	Phage_Wrath	79.3	7.8e-155
WP_038413830.1|5211850_5212429_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4J6Z9	uncultured_Caudovirales_phage	81.5	1.4e-84
WP_038413832.1|5212397_5213603_-|portal	phage portal protein	portal	A0A1B2APW5	Phage_Wrath	91.0	1.3e-209
WP_038413833.1|5213618_5215346_-|terminase	terminase large subunit	terminase	A0A2H4JDG5	uncultured_Caudovirales_phage	97.7	0.0e+00
WP_038413835.1|5215342_5215780_-|terminase	terminase small subunit	terminase	A0A1B1P7N7	Bacillus_phage	90.3	2.0e-67
WP_038413837.1|5215864_5216257_-	HNH endonuclease	NA	A0A1B1P7N1	Bacillus_phage	96.9	9.6e-74
WP_038413839.1|5216253_5216577_-	phage protein	NA	A0A1C8EAA0	Bacillus_phage	57.4	4.5e-21
WP_038413841.1|5216573_5216795_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038413982.1|5216840_5217038_-	hypothetical protein	NA	A0A1C8E9B9	Bacillus_phage	80.0	2.1e-21
WP_038413842.1|5217661_5218051_-	DUF3942 domain-containing protein	NA	NA	NA	NA	NA
WP_038413844.1|5218250_5218637_-	phage protein	NA	A0A2H4JFW6	uncultured_Caudovirales_phage	74.4	4.4e-47
WP_140159945.1|5218678_5218867_-	hypothetical protein	NA	S5MC27	Brevibacillus_phage	62.3	1.1e-11
WP_038413846.1|5219025_5219325_-	hypothetical protein	NA	Q3HKX6	Bacillus_phage	74.7	7.9e-36
WP_001216580.1|5219360_5219624_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000169951.1|5219693_5220131_-	hypothetical protein	NA	A0A2H4JBP0	uncultured_Caudovirales_phage	82.1	6.1e-61
WP_000331834.1|5220182_5220455_-	hypothetical protein	NA	A0A0H3V0M3	Geobacillus_virus	53.4	3.4e-17
WP_000617754.1|5220456_5220996_-	hypothetical protein	NA	A0A0S2SXQ1	Bacillus_phage	51.4	7.6e-45
WP_080703607.1|5220992_5221367_-	hypothetical protein	NA	H0USU9	Bacillus_phage	55.6	1.5e-28
WP_038413852.1|5221369_5221798_-	hypothetical protein	NA	A0A2H4JFQ6	uncultured_Caudovirales_phage	86.6	4.9e-71
WP_038413854.1|5222063_5224418_-	DNA primase	NA	A0A2H4J990	uncultured_Caudovirales_phage	87.0	0.0e+00
WP_038413856.1|5224414_5224795_-	hypothetical protein	NA	A8E2Q7	Enterococcus_phage	48.8	2.2e-27
WP_038413858.1|5224861_5225341_-	DUF669 domain-containing protein	NA	A0A2H4J986	uncultured_Caudovirales_phage	43.8	1.4e-29
WP_038413860.1|5225340_5226033_-	AAA family ATPase	NA	A0A2H4J9A0	uncultured_Caudovirales_phage	95.9	1.6e-119
WP_038413862.1|5226048_5226645_-	hypothetical protein	NA	A0A1B2AQ10	Phage_Wrath	88.4	1.0e-90
WP_038413864.1|5226647_5227199_-	hypothetical protein	NA	A0A2H4JFX2	uncultured_Caudovirales_phage	92.3	6.7e-89
WP_038413866.1|5227176_5227458_-	hypothetical protein	NA	A0A1B2AQ09	Phage_Wrath	82.8	9.4e-39
WP_038413868.1|5227457_5227661_-	hypothetical protein	NA	A0A2H4J979	uncultured_Caudovirales_phage	85.1	2.3e-23
WP_003280171.1|5227894_5228542_-	sigma-70 family RNA polymerase sigma factor	NA	H0USU1	Bacillus_phage	78.1	9.9e-92
WP_001209506.1|5228562_5228913_-	hypothetical protein	NA	A0A1B2AQ59	Phage_Wrath	66.4	3.2e-36
WP_038413873.1|5228913_5229141_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023523446.1|5229367_5229601_-	DUF771 domain-containing protein	NA	Q9MBW7	Lactococcus_phage	43.5	5.6e-05
WP_000216290.1|5229635_5229866_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_023523448.1|5230030_5230423_+	helix-turn-helix transcriptional regulator	NA	A0A1Q1PVX8	Staphylococcus_phage	58.5	2.5e-13
WP_038413877.1|5230433_5230901_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038413879.1|5230931_5232068_+|integrase	site-specific integrase	integrase	A8ATX2	Listeria_phage	48.0	4.0e-96
WP_000216166.1|5232482_5232689_+	DUF1657 domain-containing protein	NA	NA	NA	NA	NA
5232203:5232223	attR	CGCGCCCAGAGGGATTCGAAC	NA	NA	NA	NA
WP_001226064.1|5232782_5233271_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000095408.1|5233300_5233777_+	stage V sporulation protein AC	NA	NA	NA	NA	NA
WP_000938972.1|5233777_5234794_+	stage V sporulation protein AD	NA	NA	NA	NA	NA
WP_000575919.1|5234790_5235141_+	stage V sporulation protein AE	NA	NA	NA	NA	NA
WP_000215909.1|5235152_5235359_+	DUF1657 domain-containing protein	NA	NA	NA	NA	NA
WP_000018924.1|5235379_5236249_+	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_001049162.1|5236489_5237071_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	56.5	1.3e-55
WP_000250307.1|5237398_5237647_-	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_000006560.1|5237670_5238621_-	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	38.4	1.7e-52
WP_000712186.1|5238709_5239663_-	YvcK family protein	NA	A1IMD5	Streptococcus_phage	42.8	1.7e-63
WP_000138459.1|5239666_5240548_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.9	4.6e-07
WP_001190080.1|5240568_5241027_-	8-oxo-dGTP diphosphatase	NA	NA	NA	NA	NA
WP_000455200.1|5241256_5242063_-	DUF368 domain-containing protein	NA	NA	NA	NA	NA
WP_001288079.1|5242228_5243185_-	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	53.6	4.0e-89
WP_000517720.1|5243270_5244782_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_001255073.1|5244921_5245434_-	acyltransferase	NA	NA	NA	NA	NA
WP_002097946.1|5245467_5246118_-	pyrophosphatase PpaX	NA	NA	NA	NA	NA
WP_000922850.1|5246185_5246998_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_001127250.1|5247024_5247954_-	HPr(Ser) kinase/phosphatase	NA	NA	NA	NA	NA
WP_001267308.1|5248110_5248491_-|holin	phage holin family protein	holin	NA	NA	NA	NA
>prophage 1
NZ_CP004861	Bacillus thuringiensis serovar kurstaki str. YBT-1520 plasmid pBMB293, complete sequence	293574	2986	63099	293574	integrase,protease,transposase	Bacillus_phage(53.33%)	55	11798:11857	29468:30433
WP_001021539.1|2986_4030_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0E3T6D9	Bacillus_phage	23.1	1.2e-09
WP_000019020.1|4243_4570_+	helix-turn-helix transcriptional regulator	NA	A0A0A7AQV8	Bacillus_phage	51.0	2.4e-22
WP_001001083.1|5051_6275_-	hypothetical protein	NA	A0A1B1P895	Bacillus_phage	66.1	6.1e-151
WP_016090374.1|6481_8125_-	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000843046.1|8826_9105_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A2I7SC16	Paenibacillus_phage	59.0	2.3e-13
WP_014481865.1|9171_9312_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031303430.1|9586_9781_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040120021.1|10027_10300_+	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	67.8	9.7e-25
WP_000914524.1|10789_11305_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040120022.1|11445_12672_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
11798:11857	attL	TGTTCCTCTGTTAATCGGTAGATAATTACTCTTGTAAATAATCTTTGATTCTTGCCAATA	NA	NA	NA	NA
WP_000272577.1|13444_14710_+	Y-family DNA polymerase	NA	O64031	Bacillus_phage	46.7	4.2e-102
WP_000477499.1|14890_15988_+|integrase	tyrosine-type recombinase/integrase	integrase	S5W9T9	Leptospira_phage	30.3	6.5e-11
WP_001028065.1|15984_17994_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_000247457.1|17986_18391_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000349585.1|18459_19251_-	glyoxalase	NA	A0A288WG17	Bacillus_phage	68.4	6.8e-103
WP_000027993.1|19291_20065_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_000794364.1|20153_20942_-	hypothetical protein	NA	A0A288WG17	Bacillus_phage	51.4	2.8e-64
WP_000238290.1|21238_21547_+	YolD-like family protein	NA	NA	NA	NA	NA
WP_001154608.1|21595_21970_+	hypothetical protein	NA	D2XQ01	Bacillus_virus	52.5	4.8e-30
WP_000417392.1|22188_22440_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000898260.1|22492_22732_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000955500.1|23274_23805_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_000650425.1|23808_24783_+	DUF4179 domain-containing protein	NA	NA	NA	NA	NA
WP_016090335.1|25211_26141_-	DMT family transporter	NA	NA	NA	NA	NA
WP_000020440.1|26155_26743_-	flavodoxin family protein	NA	NA	NA	NA	NA
WP_000351941.1|26865_27765_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001053969.1|28652_30089_+|transposase	IS4-like element IS231C family transposase	transposase	NA	NA	NA	NA
WP_000888766.1|30386_30638_+	YolD-like family protein	NA	NA	NA	NA	NA
29468:30433	attR	TATTGGCAAGAATCAAAGATTATTTACAAGAGTAATTATCTACCGATTAACAGAGGAACAAATACTGGAACGTAGAAAAAAACAAAGCTATACCGAAAGTAAAAAGGGGATTACATTTTCAGAAAAGAGTAAACGATTAACGGGTATCAACATATATGTTACGAATACGCCTTGGGAAGTGGTTCCGATGGAACAAATTCATGATTTTTACTCCCTCCGCTGGCAGATCGAAATCATATTTAAAACGTGGAAATCTCTATTTCAAATTCATCATTGGCAAACTATCAAACAAGAGCGATTAGAATGCCATGTGTATGGAAAACTCATTGCCATTTTTATATGTTCTTCCACGATGTTTAAGATGCGCCAACTTCTGTTGCAAAAGCACAAAAGAGAACTAAGCGAATATAAAGCAATTGGGATGATTCAAGATCATCTATCCCTGTTATATCAAGCGATACAGAGAAACACCCGTATAATAACAAAGGTTTTAATCCGCCTGTTTACCCTACTAAAGAAAAATGGCCGGAAATCCCATCGATATGAGAAGAAAACTATCTTTGATATTATGGGTGTTGTCTATGAGTATAATGGATTGAGAAAACAAAAGAAAGCTGCATAAGAAAAAAATGAAACCCGTTAGGGTTTATTTCGTATGCTCATTTTTAAGAGGATTATACTGTTTAAAAGTTTGTTCATTTCAATTAATGGAAAACCGTAGAGTTTCTATCCTTAAGTTGATGGGCATGTGATACTACCCCTACTACTATTTTTTGAGGCAAGTTTATGAGTTAATAAAAGATTTATGGCAATGTAATGCTTCAAATATTACAAGGATGTTCTCTAAAAACTATGCTTTCGGGCAATATTATGGTTCAAATTGTGGCGGACTTATAATTCAAATCACAAAATAAATCGGATGCTAGAAGACCAAAATAAAGTTAATAGACCAATACTCACTGATGA	NA	NA	NA	NA
WP_000802626.1|31617_33108_-	DUF2075 domain-containing protein	NA	NA	NA	NA	NA
WP_001102776.1|33357_34431_+	hypothetical protein	NA	A0A2H4J8G3	uncultured_Caudovirales_phage	44.2	1.8e-77
WP_000025329.1|34743_35172_-	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_000523962.1|35171_36518_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000725572.1|37128_37611_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_001186844.1|37651_38797_+	DUF418 domain-containing protein	NA	NA	NA	NA	NA
WP_001065855.1|39253_39937_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000342852.1|40268_40514_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000343609.1|40564_41290_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000659905.1|41329_41638_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000104242.1|41766_42066_-	DUF2325 domain-containing protein	NA	NA	NA	NA	NA
WP_001242518.1|42062_42446_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000757464.1|42607_43183_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014481869.1|43199_44075_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A7KUS1	Bacillus_phage	38.3	3.5e-15
WP_001149932.1|44234_46058_-	maturase	NA	A0A0U4J920	Pseudomonas_phage	33.3	5.6e-23
WP_000043048.1|46633_46825_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003275463.1|46893_48690_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	27.1	6.9e-34
WP_000108316.1|49745_51551_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	28.1	5.5e-31
WP_000890337.1|53216_57236_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016090237.1|57266_59375_-	DUF87 domain-containing protein	NA	NA	NA	NA	NA
WP_000892000.1|59377_60292_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001233517.1|60292_60643_-	PrgI family protein	NA	NA	NA	NA	NA
WP_001216652.1|60709_61129_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001180021.1|61245_61431_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000869334.1|61487_61691_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000502626.1|61804_62074_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001098031.1|62163_63099_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP004861	Bacillus thuringiensis serovar kurstaki str. YBT-1520 plasmid pBMB293, complete sequence	293574	178638	252317	293574	holin,transposase	Bacillus_phage(33.33%)	41	NA	NA
WP_087942375.1|178638_180200_-|transposase	IS3 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	57.6	4.9e-68
WP_000762722.1|180612_181017_+|transposase	IS200/IS605 family transposase	transposase	A0A286QN76	Streptococcus_phage	67.6	6.5e-41
WP_000929144.1|182265_182562_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015406625.1|183678_184797_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	S6AND0	Bacillus_phage	81.5	3.0e-173
WP_000701098.1|186153_187227_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000369347.1|187338_188250_+	DMT family transporter	NA	NA	NA	NA	NA
WP_033679397.1|188927_190049_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	S6AND0	Bacillus_phage	80.4	1.9e-170
WP_000790998.1|190806_192126_+	HBL/NHE enterotoxin family protein	NA	NA	NA	NA	NA
WP_000975321.1|192188_193418_+	alpha-helical pore-forming toxin family protein	NA	NA	NA	NA	NA
WP_001063469.1|193449_194583_+	alpha-helical pore-forming toxin family protein	NA	NA	NA	NA	NA
WP_015406629.1|198117_199113_+	DUF4046 domain-containing protein	NA	NA	NA	NA	NA
WP_000998670.1|199995_200265_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001227945.1|200264_200867_+	SdpI family protein	NA	NA	NA	NA	NA
WP_000827070.1|201311_201842_+	SdpA family antimicrobial peptide system protein	NA	NA	NA	NA	NA
WP_000473523.1|201826_202777_+	membrane protein	NA	NA	NA	NA	NA
WP_000724589.1|202820_203441_+	sporulation delaying protein family toxin	NA	NA	NA	NA	NA
WP_000526840.1|203630_204023_+	thiol-disulfide oxidoreductase DCC family protein	NA	NA	NA	NA	NA
WP_000730548.1|204342_205659_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_015406631.1|206294_206828_-	YitT family protein	NA	M1Q1P6	Streptococcus_phage	29.9	7.3e-16
WP_078405493.1|206890_207091_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000423181.1|207312_208203_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000864460.1|210217_210670_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000275580.1|212329_213625_+|transposase	IS21-like element IS232 family transposase	transposase	A0A059NT83	Lactococcus_phage	31.0	1.0e-42
WP_000798699.1|213614_214367_+	AAA family ATPase	NA	A0A059NT77	Lactococcus_phage	47.3	7.0e-57
WP_000357137.1|215593_217009_+	HTH domain-containing protein	NA	NA	NA	NA	NA
WP_001039073.1|219473_221843_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001089638.1|224580_226482_+	pesticidal protein Cry2Ab	NA	NA	NA	NA	NA
WP_016090221.1|228404_230135_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.6	1.6e-16
WP_001026061.1|230971_231466_+	cation:proton antiporter regulatory subunit	NA	NA	NA	NA	NA
WP_000380161.1|231470_232670_+	cation:proton antiporter	NA	NA	NA	NA	NA
WP_000215668.1|233080_234037_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A0S2MV84	Bacillus_phage	40.1	4.8e-50
WP_000369823.1|234326_237857_+	pesticidal crystal protein cry1Aa	NA	NA	NA	NA	NA
WP_000769223.1|238363_240523_+	pesticidal crystal protein cry1Ia	NA	NA	NA	NA	NA
WP_014481901.1|240737_241844_-	tyrosine recombinase XerS	NA	A0A1B1IQT7	uncultured_Mediterranean_phage	28.4	2.0e-07
WP_000591046.1|242009_243035_-	macro domain-containing protein	NA	A0A0B4N0V6	Escherichia_phage	40.4	9.1e-23
WP_000555978.1|243049_243682_-	DUF4433 domain-containing protein	NA	NA	NA	NA	NA
WP_001067062.1|245742_247644_-	pesticidal protein Cry2Ab	NA	NA	NA	NA	NA
WP_000922362.1|247733_248492_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000545193.1|248658_249162_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033679389.1|251282_251534_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000892197.1|251894_252317_-|holin	phage holin family protein	holin	A0A0S2MVC4	Bacillus_phage	77.3	1.3e-52
>prophage 1
NZ_CP004860	Bacillus thuringiensis serovar kurstaki str. YBT-1520 plasmid pBMB422, complete sequence	422692	92340	162840	422692	transposase	Bacillus_phage(31.25%)	57	NA	NA
WP_144406502.1|92340_93682_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	37.3	6.3e-32
WP_016090591.1|93770_94445_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087971388.1|95232_95358_-	Phr family secreted Rap phosphatase inhibitor	NA	NA	NA	NA	NA
WP_000219740.1|95511_95808_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001236345.1|96158_97388_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	49.4	4.5e-85
WP_016090592.1|98738_100355_+	SH3 domain-containing protein	NA	A0A1J0MS59	Bacillus_phage	54.3	4.3e-43
WP_016090593.1|101363_102290_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000582601.1|103926_104559_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016090594.1|104555_105191_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016090595.1|105487_105871_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016090596.1|105887_106526_+	NERD domain-containing protein	NA	A0A2R2ZH57	Clostridioides_phage	35.1	2.8e-22
WP_016090597.1|106817_107561_+	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_016090598.1|108336_109734_-	S8 family serine peptidase	NA	A0A2H4PQH1	Staphylococcus_phage	43.6	2.2e-88
WP_000906771.1|109954_110602_-	ABC-2 transporter permease	NA	NA	NA	NA	NA
WP_001103609.1|110591_111458_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.6	1.6e-20
WP_000706800.1|111454_111838_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_033679607.1|112892_114281_+	radical SAM/SPASM domain-containing protein	NA	NA	NA	NA	NA
WP_016090599.1|114445_116155_+	ABC transporter ATP-binding protein	NA	F2Y302	Organic_Lake_phycodnavirus	30.1	6.0e-19
WP_016090600.1|116189_116477_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016090601.1|116842_117628_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	33.5	3.0e-26
WP_016090602.1|117644_118502_-	glucose uptake protein glcU	NA	NA	NA	NA	NA
WP_016090603.1|119290_119887_+	thermonuclease family protein	NA	NA	NA	NA	NA
WP_001004894.1|119938_120142_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000084567.1|120214_120427_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000210390.1|121055_121349_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001206759.1|121895_122309_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071686443.1|122851_123031_-	RNA-binding protein Hfq	NA	NA	NA	NA	NA
WP_000762752.1|123221_123620_+|transposase	IS200/IS605 family transposase	transposase	A0A286QN76	Streptococcus_phage	68.9	3.1e-51
WP_016097410.1|123631_124744_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A288TXV8	Enterococcus_phage	47.9	1.1e-79
WP_016090607.1|125026_125158_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033679611.1|125154_126264_-	tetratricopeptide repeat protein	NA	A0A2H4J8G3	uncultured_Caudovirales_phage	46.1	5.8e-92
WP_016090610.1|129040_129241_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000958635.1|129633_129927_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016090611.1|131708_132044_+	hypothetical protein	NA	NA	NA	NA	NA
WP_130055941.1|132586_132787_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016097411.1|133055_133490_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_155266942.1|134331_135677_-|transposase	IS3-like element ISBth10 family transposase	transposase	A0A1B1P773	Bacillus_phage	74.1	1.8e-111
WP_016090613.1|135731_136577_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016090614.1|136716_137421_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016090615.1|138065_138326_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016090616.1|139404_140637_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	25.1	2.8e-18
WP_016090617.1|140641_141334_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_016090618.1|142035_142836_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016090619.1|142857_143571_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.1	3.0e-33
WP_016090620.1|143567_146036_+	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_016090621.1|146503_146824_-	TM2 domain-containing protein	NA	A0A127AZ85	Bacillus_phage	40.9	1.6e-10
WP_016090622.1|147478_148060_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001187351.1|148170_149424_-	MFS transporter	NA	NA	NA	NA	NA
WP_016090623.1|150378_152463_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016090625.1|153983_155072_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016090626.1|155236_155554_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016090627.1|155592_156945_+	long-chain fatty acid--CoA ligase	NA	NA	NA	NA	NA
WP_074628990.1|157127_157550_-	DoxX family protein	NA	NA	NA	NA	NA
WP_016090629.1|157660_158422_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016090630.1|159696_159888_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016090632.1|160622_161510_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000275580.1|161544_162840_+|transposase	IS21-like element IS232 family transposase	transposase	A0A059NT83	Lactococcus_phage	31.0	1.0e-42
>prophage 2
NZ_CP004860	Bacillus thuringiensis serovar kurstaki str. YBT-1520 plasmid pBMB422, complete sequence	422692	174024	231431	422692	transposase	uncultured_Caudovirales_phage(18.18%)	39	NA	NA
WP_044157304.1|174024_174624_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.1	1.8e-34
WP_000647561.1|174931_175378_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000169374.1|175711_177019_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	29.7	8.6e-26
WP_001100112.1|177192_177372_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016097421.1|178173_178716_-	recombinase family protein	NA	A0A219YA40	Aeromonas_phage	31.5	3.4e-13
WP_016097422.1|178896_180360_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	57.2	8.1e-142
WP_016090463.1|180382_180802_+	universal stress protein	NA	NA	NA	NA	NA
WP_016090464.1|180888_182556_+	ribonuclease J	NA	NA	NA	NA	NA
WP_140159901.1|182914_183844_-	collagen-like protein	NA	NA	NA	NA	NA
WP_016090232.1|185384_185981_+	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_016090231.1|186259_186670_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_016090230.1|186799_187561_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_016090229.1|187688_188075_-	DUF202 domain-containing protein	NA	NA	NA	NA	NA
WP_016090228.1|188107_188920_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_016090227.1|189236_189782_+	recombinase family protein	NA	M9Q1K0	Clostridium_phage	41.0	1.1e-30
WP_040120008.1|189824_192773_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	26.7	1.4e-79
WP_016090640.1|193635_194556_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_000116992.1|194891_196322_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_000364215.1|196470_196881_-	DUF1878 family protein	NA	NA	NA	NA	NA
WP_016090641.1|197168_197540_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001053969.1|197726_199163_+|transposase	IS4-like element IS231C family transposase	transposase	NA	NA	NA	NA
WP_016090564.1|199965_207564_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	28.3	4.2e-165
WP_016090563.1|207929_208856_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_016090562.1|209342_210887_+	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_001019438.1|211098_211743_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016090561.1|212052_212463_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001105580.1|212589_212808_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016090560.1|212953_213280_+	helix-turn-helix transcriptional regulator	NA	A0A059T669	Listeria_phage	36.8	1.3e-10
WP_033679622.1|213990_214557_-	acyltransferase	NA	NA	NA	NA	NA
WP_001053969.1|214696_216133_-|transposase	IS4-like element IS231C family transposase	transposase	NA	NA	NA	NA
WP_016090558.1|216110_216728_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016090557.1|216737_217163_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016090556.1|217601_223241_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033679605.1|223516_223729_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016090555.1|224206_225298_+	tetratricopeptide repeat protein	NA	A0A2H4J8G3	uncultured_Caudovirales_phage	46.1	8.6e-88
WP_016090553.1|226317_226659_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153580446.1|226987_227143_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016090552.1|227792_229850_-	ATP-dependent helicase	NA	S5MMD7	Bacillus_phage	25.6	1.3e-41
WP_000275580.1|230135_231431_+|transposase	IS21-like element IS232 family transposase	transposase	A0A059NT83	Lactococcus_phage	31.0	1.0e-42
>prophage 3
NZ_CP004860	Bacillus thuringiensis serovar kurstaki str. YBT-1520 plasmid pBMB422, complete sequence	422692	258803	317222	422692	transposase	Bacillus_phage(65.52%)	57	NA	NA
WP_040120033.1|258803_259922_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	S6AND0	Bacillus_phage	80.9	8.9e-173
WP_000500291.1|260276_260555_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000725639.1|260690_260849_-	Phr family secreted Rap phosphatase inhibitor	NA	NA	NA	NA	NA
WP_001102657.1|260848_261940_-	hypothetical protein	NA	A0A2H4J8G3	uncultured_Caudovirales_phage	49.9	8.6e-96
WP_016090531.1|262523_263036_+	hypothetical protein	NA	O64031	Bacillus_phage	45.6	4.8e-33
WP_001158653.1|263085_263460_+	hypothetical protein	NA	D2XQ01	Bacillus_virus	46.6	1.9e-26
WP_000491768.1|263906_264302_+	DUF3221 domain-containing protein	NA	NA	NA	NA	NA
WP_016090530.1|264358_265885_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000540371.1|266857_266968_+	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_000301804.1|267057_267357_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033679600.1|267597_268332_-	DUF874 family protein	NA	NA	NA	NA	NA
WP_000240396.1|268677_268896_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000413130.1|269184_269655_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000116660.1|269656_269854_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000369592.1|270393_270882_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016090528.1|272077_272317_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016090527.1|272997_273891_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016097404.1|274072_275899_-	asparagine synthase (glutamine-hydrolyzing)	NA	A0A1V0SGM7	Hokovirus	27.5	2.4e-34
WP_000593069.1|276303_276873_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_040120046.1|277128_278250_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	S6AND0	Bacillus_phage	81.2	2.0e-172
WP_016090522.1|278792_280655_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_016090521.1|280671_281433_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.0	1.3e-34
WP_016090520.1|281678_282755_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	30.6	6.4e-19
WP_016090519.1|282751_283438_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	40.2	1.4e-40
WP_016099961.1|284670_286089_-	S-layer protein/peptidoglycan endo-beta-N-acetylglucosaminidase	NA	G3MAW8	Bacillus_virus	42.3	7.1e-26
WP_016090516.1|286406_286979_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000708212.1|287214_287784_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016090515.1|287817_289440_-	hypothetical protein	NA	A0A2H4J389	uncultured_Caudovirales_phage	33.8	1.4e-25
WP_016090514.1|289436_289799_-	DUF3958 domain-containing protein	NA	NA	NA	NA	NA
WP_103656474.1|290753_291038_+	EndoU domain-containing protein	NA	A0A0A7RVN1	Clostridium_phage	43.3	2.6e-12
WP_016090510.1|291041_291383_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016090508.1|293721_294069_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016090507.1|294401_295211_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_040120032.1|295626_296748_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	S6AND0	Bacillus_phage	80.4	1.1e-170
WP_000914230.1|296997_297330_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087942837.1|298118_299487_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	65.3	2.2e-93
WP_000420168.1|300155_300356_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000895161.1|300423_300612_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016090505.1|300678_301023_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000765882.1|301116_301560_-	DUF5065 family protein	NA	NA	NA	NA	NA
WP_000922179.1|302182_302758_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040120045.1|303104_304226_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	S6AND0	Bacillus_phage	77.2	8.3e-163
WP_016090503.1|304471_305527_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0T6C8	Bacillus_phage	72.1	6.2e-152
WP_000570185.1|305523_305763_-	hypothetical protein	NA	A0A0A7AR38	Bacillus_phage	75.9	2.7e-26
WP_000499523.1|306060_307254_+|transposase	IS110-like element ISBth13 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	26.1	1.1e-24
WP_016090502.1|307348_307582_-	XpaF1 protein	NA	A0A2H4J382	uncultured_Caudovirales_phage	83.8	8.1e-12
WP_000405795.1|307772_308657_-	N-acetylmuramoyl-L-alanine amidase family protein	NA	A0A0S2MVR5	Bacillus_phage	52.4	4.2e-77
WP_001051379.1|308929_309751_-	M23 family metallopeptidase	NA	A0A218KCJ1	Bacillus_phage	43.8	4.9e-27
WP_016099955.1|309892_310861_-	lysozyme family protein	NA	A0A223LKM8	Bacillus_phage	41.7	4.5e-32
WP_000460733.1|311098_311485_-	hypothetical protein	NA	A0A288WG73	Bacillus_phage	69.8	2.6e-47
WP_016090275.1|311587_312514_-	DnaD domain protein	NA	A0A1C8E9B4	Bacillus_phage	63.5	3.7e-76
WP_000527101.1|312586_312823_-	helix-turn-helix transcriptional regulator	NA	W8CYU0	Bacillus_phage	60.0	9.7e-13
WP_000579788.1|312959_313388_+	helix-turn-helix transcriptional regulator	NA	Q786F1	Bacillus_phage	51.4	9.3e-30
WP_000673778.1|313410_313839_+	ImmA/IrrE family metallo-endopeptidase	NA	Q9T201	Bacillus_phage	55.1	7.3e-35
WP_016090274.1|314103_315315_-	S-layer homology domain-containing protein	NA	NA	NA	NA	NA
WP_000762755.1|315699_316098_+|transposase	IS200/IS605-like element ISBth16 family transposase	transposase	A0A286QN76	Streptococcus_phage	69.7	2.3e-51
WP_016097395.1|316109_317222_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A288TXV8	Enterococcus_phage	48.3	7.9e-81
>prophage 1
NZ_CP004868	Bacillus thuringiensis serovar kurstaki str. YBT-1520 plasmid pBMB94, complete sequence	94568	0	66170	94568	transposase	Lactococcus_phage(36.36%)	59	NA	NA
WP_013555051.1|2496_3942_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_000275580.1|4149_5445_+|transposase	IS21-like element IS232 family transposase	transposase	A0A059NT83	Lactococcus_phage	31.0	1.0e-42
WP_000798699.1|5434_6187_+	AAA family ATPase	NA	A0A059NT77	Lactococcus_phage	47.3	7.0e-57
WP_000749015.1|7381_7870_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001031864.1|8278_8464_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000173533.1|8509_8782_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001265610.1|8794_10198_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000694786.1|10219_10906_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000768556.1|10920_11937_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002083864.1|11950_12208_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000738668.1|12220_12790_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001088572.1|12806_13844_-	conjugation transfer protein	NA	A0A0A8WIF2	Clostridium_phage	30.7	7.3e-28
WP_000877615.1|13859_15734_-	DUF87 domain-containing protein	NA	NA	NA	NA	NA
WP_000572916.1|15749_16787_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000495110.1|16803_17028_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000480048.1|17532_18003_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001236345.1|18418_19648_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	49.4	4.5e-85
WP_000809080.1|20004_20274_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000334981.1|20308_20611_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000005319.1|21339_22560_-	hypothetical protein	NA	A0A1B1P784	Bacillus_phage	46.0	2.2e-28
WP_000085281.1|22943_23345_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000063563.1|23352_24555_-	ParM/StbA family protein	NA	NA	NA	NA	NA
WP_000812484.1|25148_25508_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002134101.1|25641_26874_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000448102.1|26965_27229_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000240013.1|27218_27458_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003275077.1|27646_29716_+	MobA/MobL family protein	NA	NA	NA	NA	NA
WP_000676587.1|29726_31988_+	type IV secretion system DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_003286265.1|32255_32687_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000542404.1|32766_34920_+	type IA DNA topoisomerase	NA	A0A1X9I6W8	Streptococcus_phage	40.0	5.3e-89
WP_000890312.1|34931_35120_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001178926.1|35125_37000_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002134102.1|37267_38557_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000769510.1|38572_39322_+	flagellar protein FlgA	NA	NA	NA	NA	NA
WP_000765660.1|39343_40480_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000109011.1|40502_41948_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000600039.1|41960_42932_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000020776.1|43036_43927_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000477383.1|44431_44962_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001077597.1|44996_45383_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001053969.1|45942_47379_-|transposase	IS4-like element IS231C family transposase	transposase	NA	NA	NA	NA
WP_000382147.1|47715_48570_+	TnP I resolvase	NA	S5M9V8	Brevibacillus_phage	26.4	4.4e-23
WP_040120011.1|48588_51552_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	39.2	5.4e-201
WP_000823706.1|52150_52666_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000686751.1|52758_53283_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000411023.1|53295_53676_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000864768.1|53697_53997_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000878056.1|54030_55110_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000681204.1|55135_57316_+	peptidase	NA	NA	NA	NA	NA
WP_000380666.1|57386_57884_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003274307.1|57946_58852_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000027439.1|59095_60196_+	hypothetical protein	NA	A0A2H4J8G3	uncultured_Caudovirales_phage	43.2	3.1e-85
WP_000590519.1|60195_60354_+	Phr family secreted Rap phosphatase inhibitor	NA	NA	NA	NA	NA
WP_000854242.1|60971_61508_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002134110.1|61509_61773_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003274315.1|62066_62555_+	Uma2 family endonuclease	NA	NA	NA	NA	NA
WP_001175925.1|62570_62924_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000275580.1|64132_65428_+|transposase	IS21-like element IS232 family transposase	transposase	A0A059NT83	Lactococcus_phage	31.0	1.0e-42
WP_000798699.1|65417_66170_+	AAA family ATPase	NA	A0A059NT77	Lactococcus_phage	47.3	7.0e-57
>prophage 2
NZ_CP004868	Bacillus thuringiensis serovar kurstaki str. YBT-1520 plasmid pBMB94, complete sequence	94568	75635	75878	94568		Caldibacillus_phage(100.0%)	1	NA	NA
WP_001104068.1|75635_75878_+	helix-turn-helix domain-containing protein	NA	A0A290FZJ4	Caldibacillus_phage	47.5	2.4e-11
>prophage 3
NZ_CP004868	Bacillus thuringiensis serovar kurstaki str. YBT-1520 plasmid pBMB94, complete sequence	94568	81577	88969	94568	transposase	Enterobacteria_phage(66.67%)	3	NA	NA
WP_040120008.1|81577_84526_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	26.7	1.4e-79
WP_001025593.1|85023_88095_-|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	22.3	4.3e-44
WP_001224533.1|88345_88969_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	33.7	4.4e-12
