The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP007136	Escherichia coli O145:H28 str. RM12581 chromosome, complete genome	5585611	551357	626283	5585611	capsid,holin,lysis,portal,protease,head,tail,integrase,terminase,transposase	Enterobacteria_phage(50.0%)	69	554282:554297	606181:606196
WP_000336726.1|551357_552176_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.2	1.2e-65
WP_000088311.1|552211_552514_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_001307618.1|552635_553817_-	cyanate transporter CynX	NA	NA	NA	NA	NA
WP_000616241.1|553822_554293_-	cyanase	NA	NA	NA	NA	NA
554282:554297	attL	TGACTGAATCATGGTG	NA	NA	NA	NA
WP_025404245.1|554323_554983_-	carbonic anhydrase CynT	NA	NA	NA	NA	NA
WP_022581475.1|555092_555992_+	transcriptional regulator CynR	NA	A0A2P0ZL89	Lactobacillus_phage	27.0	9.4e-16
WP_001299008.1|556124_557408_-	cytosine/isoguanine deaminase	NA	NA	NA	NA	NA
WP_025404246.1|557397_558657_-	cytosine permease	NA	NA	NA	NA	NA
WP_025404247.1|558892_560779_-	propionate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	29.4	1.8e-53
WP_001275899.1|560818_562270_-	2-methylcitrate dehydratase	NA	NA	NA	NA	NA
WP_001205750.1|562303_563473_-	2-methylcitrate synthase	NA	NA	NA	NA	NA
WP_000052173.1|563517_564408_-	methylisocitrate lyase	NA	NA	NA	NA	NA
WP_000941050.1|564646_566233_+	propionate catabolism operon regulatory protein PrpR	NA	NA	NA	NA	NA
WP_000691953.1|566330_566606_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_000976987.1|566752_567424_+	LysE family transporter	NA	NA	NA	NA	NA
WP_000290614.1|567440_567686_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024221672.1|568098_568914_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000692736.1|569156_570206_-	NADPH-dependent aldehyde reductase YahK	NA	A0A2K9L339	Tupanvirus	45.2	1.7e-72
WP_000662404.1|570582_571965_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_000661625.1|571974_572925_-	carbamate kinase family protein	NA	NA	NA	NA	NA
WP_134889244.1|572956_573283_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000083465.1|573254_574673_-	DUF1116 domain-containing protein	NA	NA	NA	NA	NA
WP_000111816.1|574672_576220_-	acyl-CoA synthetase FdrA	NA	NA	NA	NA	NA
WP_024221671.1|576209_577073_-	DUF2877 domain-containing protein	NA	NA	NA	NA	NA
WP_022581412.1|577467_577842_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_001013899.1|578099_578597_+	DUF1097 domain-containing protein	NA	NA	NA	NA	NA
WP_001089563.1|578688_579621_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000146391.1|579662_580751_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_072095750.1|580892_584876_-	autotransporter adhesin EhaA	NA	A0A2L1IV18	Escherichia_phage	38.0	5.5e-124
WP_000131059.1|585448_587482_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	1.7e-20
WP_001301903.1|587610_588198_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_000089079.1|588211_589684_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001159144.1|589697_591368_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.2	1.0e-60
WP_157832602.1|592064_592199_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072095745.1|592407_592995_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	52.2	1.5e-51
WP_001362383.1|593324_594119_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001213049.1|594272_595034_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025404248.1|595075_595642_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001135277.1|597058_597556_+	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	97.0	5.4e-90
WP_001228695.1|597772_597955_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_000738421.1|598045_598339_-	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	90.7	5.9e-44
WP_001307652.1|598699_598894_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.8	9.7e-27
WP_000453587.1|599283_599829_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
WP_001027269.1|599803_601729_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.5	0.0e+00
WP_000198149.1|601725_601932_+|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001358553.1|601928_603530_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.4	2.9e-310
WP_025404250.1|603510_604830_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.4	2.0e-232
WP_001358225.1|604839_605172_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	98.2	2.5e-54
WP_000063244.1|605227_606253_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.7	1.8e-188
606181:606196	attR	CACCATGATTCAGTCA	NA	NA	NA	NA
WP_000158866.1|606294_606690_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	96.2	5.2e-59
WP_000785282.1|606701_607055_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	97.4	6.4e-61
WP_000975081.1|607066_607645_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.5	5.9e-80
WP_000683105.1|607641_608037_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_001342267.1|608044_608785_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	98.0	1.0e-129
WP_000479169.1|608800_609223_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	3.1e-70
WP_000459457.1|609204_609639_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_025404251.1|609631_612211_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	97.4	0.0e+00
WP_000847347.1|612207_612537_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	99.1	3.6e-58
WP_001152619.1|612536_613235_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	99.1	7.3e-133
WP_025404252.1|613240_613984_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.0	2.1e-146
WP_000090891.1|613920_614553_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	2.2e-96
WP_025404253.1|614613_618111_+	host specificity protein J	NA	A5LH43	Enterobacteria_phage	97.2	0.0e+00
WP_001233090.1|618181_618781_+	Ail/Lom family protein	NA	A5LH44	Enterobacteria_phage	97.5	8.2e-109
WP_025404254.1|618845_621806_+	membrane protein	NA	A0A2D1UII2	Escherichia_phage	98.3	3.0e-58
WP_000885574.1|621805_622390_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.8	1.2e-101
WP_000239881.1|622444_623113_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000937502.1|623169_623475_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	2.8e-12
WP_001226384.1|623658_625143_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001201825.1|625329_626283_-|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
>prophage 2
NZ_CP007136	Escherichia coli O145:H28 str. RM12581 chromosome, complete genome	5585611	838554	870762	5585611	capsid,holin,lysis,portal,head,tail,integrase,terminase,transposase	Enterobacteria_phage(45.45%)	40	831894:831953	855652:856342
831894:831953	attL	AGTGGCCAGATGCACTGTGGCACGTCTCATGGCGGTTATGGGACTTGCCGGTGTTCTCCG	NA	NA	NA	NA
WP_032162118.1|838554_839610_-|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	97.1	4.9e-189
WP_000088311.1|839625_839928_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000336726.1|839963_840782_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.2	1.2e-65
WP_001303849.1|840869_841088_-	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000545728.1|841127_841295_-	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	98.2	1.3e-27
WP_085961182.1|841418_842631_+|transposase	IS3-like element IS629 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.7	4.9e-169
WP_000411802.1|843076_843283_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.4e-31
WP_085947772.1|843605_844818_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	57.1	8.3e-100
WP_001358663.1|846466_847663_+|transposase	IS110-like element ISEc20 family transposase	transposase	NA	NA	NA	NA
WP_025404260.1|847641_848292_-	SASA family carbohydrate esterase	NA	H6WZJ9	Escherichia_phage	92.1	3.1e-109
WP_000499454.1|848590_848749_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_001302581.1|848834_849578_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001097238.1|849762_850452_-	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
WP_032160865.1|850466_850589_-	YlcG family protein	NA	NA	NA	NA	NA
WP_000750155.1|850926_851886_+	lipid A deacylase LpxR family protein	NA	NA	NA	NA	NA
WP_001028841.1|852097_852763_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	96.4	4.4e-127
WP_001108038.1|852759_853371_-	recombination protein NinG	NA	Q716C3	Shigella_phage	99.5	6.0e-99
WP_000566868.1|853363_853534_-	protein ninF	NA	Q8H9Z5	Enterobacteria_phage	98.2	1.2e-25
WP_001254222.1|853530_853713_-	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	100.0	1.9e-29
WP_000153262.1|853709_854237_-	phage N-6-adenine-methyltransferase	NA	Q8H9Z7	Enterobacteria_phage	99.4	3.6e-100
WP_000736898.1|854233_854674_-	recombination protein NinB	NA	Q8H9Z8	Enterobacteria_phage	100.0	4.1e-81
WP_029594380.1|854747_855020_-	protein ren	NA	A0A1I9LJP5	Stx_converting_phage	98.9	1.0e-42
WP_064758453.1|854962_855097_-	hypothetical protein	NA	A0A0N7BTS3	Escherichia_phage	96.2	1.0e-06
WP_085961182.1|855062_856276_-|transposase	IS3-like element IS629 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.7	4.9e-169
WP_000092318.1|856424_856862_+|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	100.0	2.0e-72
855652:856342	attR	CGGAGAACACCGGCAAGTCCCATAACCGCCATGAGACGTGCCACAGTGCATCTGGCCACTCTGATACCTTCCCGTAACAACTGACGCCAGACTTTACGCACACCGTATACCTTGTGATTTTCATCGTATACGCGCTGTATCTCTTTCTTCAGCCAGTCATCGCGCTGCGCACGGGCACTGCGTTTATCCGGATGATGTCGCTGTTGCTGACAGTGGTAATACGTTGACGGGGCAATATGCAGTTCGCTGCATAGCGGTCCGACCCCGTACTGCTCACGCAGCTTATCCAGCAGTGGCATCATTTTTTCCAGAGGCGGTCGAACTCCGCCTTCGCAAAATAAGCGGAAGCCTGGCGAAGGATATCGTTACTGCGGCGCAGTTCACGATTTTCACGCTCCAGCTCTTTCAGACGCTGACGTTCAGCGGTGGTGAGCCCTCCATCACCGCCCCCGGTATCCCGCTCATGCTGGCGAACCCAGACACGCAGAGTCTCCGGCGTACAGCCAATCTTTGGAGCAATGGAACAAATTGTCGCCCATTGTGAGTCATATTCGCCCTGACTTTCCAGAACCATACGGACTGCCCGTTGACGGACTTCAGGGGAAAAACGAGTATTTTTAGTCATCCTGTTTACCTCTTTCTCAGGAAGTTTAGTCTCCAGGATTCCCGGGGCGGTTCAAGCTACGGCGCT	NA	NA	NA	NA
WP_000881338.1|857011_857629_+	hypothetical protein	NA	A0A1R3Y613	Salmonella_virus	85.4	1.2e-91
WP_001307652.1|857816_858011_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.8	9.7e-27
WP_000235436.1|858405_858915_+|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_000259002.1|860797_861004_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_025404261.1|861000_862593_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.1	1.9e-184
WP_024239710.1|862582_864088_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
WP_000256846.1|864124_864472_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	55.9	9.9e-22
WP_000522623.1|864529_865558_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.9	5.0e-114
WP_000201512.1|865609_865993_+	DNA-packaging protein FI	NA	NA	NA	NA	NA
WP_025380275.1|865985_866435_+	host specificity protein J	NA	Q9LA64	Enterobacterial_phage	98.1	2.3e-55
WP_025404262.1|866502_867075_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	93.5	2.3e-100
WP_025404263.1|867139_868453_+|tail	tail fiber protein	tail	A0A0P0ZD68	Stx2-converting_phage	99.1	3.3e-78
WP_001023459.1|868454_868724_+|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	96.6	4.6e-43
WP_000950982.1|868829_869711_+	hypothetical protein	NA	A5LH48	Enterobacteria_phage	90.4	3.9e-147
WP_000652081.1|869934_870762_+	type III secretion system effector Cif	NA	A5LH49	Enterobacteria_phage	98.2	3.1e-154
>prophage 3
NZ_CP007136	Escherichia coli O145:H28 str. RM12581 chromosome, complete genome	5585611	1102064	1173646	5585611	capsid,holin,protease,portal,head,tail,integrase,terminase,transposase	Enterobacteria_phage(37.25%)	81	1117160:1117219	1168910:1168974
WP_000156509.1|1102064_1103825_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000877161.1|1104010_1104463_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_000750414.1|1104537_1105593_-	porin OmpA	NA	NA	NA	NA	NA
WP_000288710.1|1105949_1106459_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_000839153.1|1106677_1107307_+	CRP-S regulon transcriptional coactivator Sxy	NA	NA	NA	NA	NA
WP_000875041.1|1107269_1109432_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001261235.1|1109441_1109888_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000420536.1|1110010_1112065_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	1.0e-20
WP_000424181.1|1112096_1112555_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000847791.1|1112650_1113313_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000665217.1|1113485_1113899_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_001295356.1|1113943_1114261_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000116291.1|1114318_1115509_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000048228.1|1115603_1115882_+	acylphosphatase	NA	NA	NA	NA	NA
WP_000904442.1|1115878_1116208_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000375136.1|1116298_1116958_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	4.0e-48
1117160:1117219	attL	TTATTTGGCGGAAGCGCAGAGATTCGAACTCTGGAACCCTTTCGGGTCGCCGGTTTTCAA	NA	NA	NA	NA
WP_001299351.1|1117365_1118385_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	49.7	1.3e-85
WP_000273151.1|1118362_1118605_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_025404266.1|1118672_1121144_-	exonuclease	NA	K7PLW7	Enterobacteria_phage	60.3	1.5e-58
WP_001098307.1|1121237_1121429_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000413705.1|1121425_1121614_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001133037.1|1122187_1122397_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394548.1|1122397_1123036_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	2.5e-07
WP_000379552.1|1123047_1123200_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	6.0e-08
WP_001416688.1|1123492_1123831_-	peptidase S24	NA	H9C160	Pectobacterium_phage	30.1	1.9e-06
WP_000747948.1|1124222_1124465_+	hypothetical protein	NA	H9C161	Pectobacterium_phage	55.8	4.8e-07
WP_000693858.1|1124448_1124874_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025404268.1|1124945_1126052_+	hypothetical protein	NA	A0A088CD36	Shigella_phage	65.7	1.8e-64
WP_000788742.1|1126058_1126805_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	84.6	5.6e-115
WP_000451007.1|1126826_1127597_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	1.6e-80
WP_001151233.1|1127612_1128026_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	89.1	9.8e-61
WP_000160654.1|1128377_1129151_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000955173.1|1129516_1129654_-	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	96.6	5.4e-08
WP_001013636.1|1129698_1129911_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	96.9	8.9e-26
WP_001341388.1|1130078_1130357_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001265141.1|1130358_1131408_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.5e-110
WP_001217436.1|1131420_1131792_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	1.3e-35
WP_000090265.1|1131781_1132153_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	84.0	1.0e-53
WP_000265267.1|1132304_1133123_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000917737.1|1133409_1133607_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	2.6e-27
WP_113706616.1|1133744_1134458_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001368722.1|1134907_1135339_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	96.5	1.6e-66
WP_025404270.1|1135817_1137653_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.0	0.0e+00
WP_085961182.1|1137678_1138891_+|transposase	IS3-like element IS629 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.7	4.9e-169
WP_000411809.1|1140840_1141047_+|holin	holin	holin	Q6H9V8	Enterobacteria_phage	100.0	2.4e-31
WP_000731192.1|1141051_1141396_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	98.2	6.5e-58
WP_000992157.1|1141446_1141980_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	95.5	3.1e-99
WP_001303555.1|1142135_1142318_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001280929.1|1142330_1142462_+	hypothetical protein	NA	A0A0N7BYT9	Escherichia_phage	88.4	9.4e-10
WP_012816791.1|1142689_1142875_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_001303878.1|1143402_1143717_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001300236.1|1143798_1144023_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	88.7	2.9e-19
WP_000235436.1|1144424_1144934_+|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_025404272.1|1144905_1146834_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.9	1.8e-261
WP_000259002.1|1146817_1147024_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000831765.1|1147020_1148613_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.9	3.2e-184
WP_051627312.1|1148602_1150576_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	4.7e-100
WP_000256809.1|1150612_1150960_+|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_000522615.1|1151017_1152046_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	60.7	3.9e-114
WP_000201523.1|1152097_1152472_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204549.1|1152464_1152818_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	8.7e-42
WP_000975046.1|1152833_1153367_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	65.1	2.2e-57
WP_000683066.1|1153363_1153759_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	83.2	3.9e-59
WP_001357739.1|1153766_1154519_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	1.6e-133
WP_000479105.1|1154532_1154964_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.8	3.7e-42
WP_000533423.1|1154990_1155404_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	2.7e-42
WP_025404276.1|1157961_1158291_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	94.5	2.2e-55
WP_025380437.1|1158290_1158989_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	99.6	5.6e-133
WP_025404277.1|1158999_1159743_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	97.2	1.1e-147
WP_148294918.1|1159688_1160321_+|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	98.1	3.4e-105
WP_000649829.1|1160511_1161039_-	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	60.5	1.8e-59
WP_025404279.1|1161172_1164646_+	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	97.1	0.0e+00
WP_025404280.1|1164713_1165313_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	98.5	2.6e-110
WP_025404281.1|1165377_1166691_+|tail	tail fiber protein	tail	A0A0P0ZD68	Stx2-converting_phage	99.1	3.3e-78
WP_001023408.1|1166692_1166962_+	hypothetical protein	NA	H6WZN0	Escherichia_phage	97.8	1.9e-44
WP_038426800.1|1167088_1167982_-	Tir-cytoskeleton coupling protein TccP2	NA	NA	NA	NA	NA
WP_001443410.1|1168427_1168811_-	hypothetical protein	NA	Q6H9S1	Enterobacteria_phage	84.3	4.4e-55
WP_001058323.1|1169427_1170546_+	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
1168910:1168974	attR	TTATTTGGCGGAAGCGCAGAGATTCGAACTCTGGAACCCTTTCGGGTCGCCGGTTTTCAAGACCG	NA	NA	NA	NA
WP_000107384.1|1170542_1172336_+	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
WP_001186424.1|1172354_1173062_+	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000003670.1|1173058_1173646_+|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
>prophage 4
NZ_CP007136	Escherichia coli O145:H28 str. RM12581 chromosome, complete genome	5585611	1407946	1478921	5585611	capsid,tRNA,head,tail,integrase,terminase,transposase	Stx2-converting_phage(27.27%)	78	1422324:1422339	1473210:1473225
WP_022581747.1|1407946_1409065_-|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	44.2	3.5e-84
WP_000003742.1|1409033_1409303_-	excisionase	NA	NA	NA	NA	NA
WP_025404296.1|1409364_1411836_-	exonuclease	NA	K7PLW7	Enterobacteria_phage	60.3	8.5e-59
WP_000199480.1|1411931_1412120_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449172.1|1412116_1412305_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_001342117.1|1412704_1412872_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000920491.1|1412865_1413099_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394552.1|1413076_1413484_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	37.8	7.0e-11
WP_001171903.1|1413506_1413725_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001240336.1|1413797_1414097_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000787428.1|1414361_1414769_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
WP_000705622.1|1415055_1415607_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000020557.1|1415578_1416619_+	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	86.7	3.9e-90
WP_157832601.1|1416530_1417073_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.7	1.5e-85
WP_000450692.1|1417106_1417841_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	84.7	7.7e-109
WP_001505071.1|1417837_1418002_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032162026.1|1418699_1419458_+	AcfC family adhesin Paa	NA	NA	NA	NA	NA
WP_000961821.1|1419735_1419948_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	72.9	1.3e-16
WP_025404298.1|1420168_1420429_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038426828.1|1420495_1420774_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.2e-11
WP_001265289.1|1420775_1421831_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	47.6	2.9e-88
WP_000140002.1|1421831_1422197_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	1.6e-38
WP_001059384.1|1422193_1422883_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	4.0e-59
1422324:1422339	attL	GAAAAAAAATCCGGTA	NA	NA	NA	NA
WP_025404299.1|1423681_1424245_+|terminase	terminase small subunit	terminase	A0A0N7KZJ8	Stx2-converting_phage	94.7	2.1e-82
WP_025404300.1|1424241_1425903_+|terminase	terminase large subunit	terminase	H6WZK9	Escherichia_phage	98.4	0.0e+00
WP_025404301.1|1425966_1427904_+|capsid	phage major capsid protein	capsid	A0A0P0ZCT9	Stx2-converting_phage	98.3	0.0e+00
WP_001063027.1|1427948_1428170_+	hypothetical protein	NA	H6WZL1	Escherichia_phage	98.6	9.9e-36
WP_000125968.1|1430695_1431022_+|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	98.1	2.7e-53
WP_001007905.1|1431032_1431383_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573374.1|1431379_1431826_+	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_000133391.1|1431822_1432167_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	99.1	9.4e-57
WP_001275505.1|1432225_1432942_+	hypothetical protein	NA	A0A0P0ZD29	Stx2-converting_phage	97.5	5.2e-126
WP_001453698.1|1433416_1433626_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_077697708.1|1434611_1436915_+|tail	phage tail tape measure protein	tail	B6ETF7	Enterobacteria_phage	99.6	0.0e+00
WP_000807940.1|1436907_1437249_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	97.3	4.7e-61
WP_025404305.1|1437248_1437947_+|tail	phage minor tail protein L	tail	B6DZB1	Enterobacteria_phage	96.1	4.9e-129
WP_000194723.1|1437957_1438701_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.0	5.0e-148
WP_148294919.1|1438646_1439276_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	96.2	1.8e-106
WP_025404307.1|1439516_1442993_+	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	97.2	0.0e+00
WP_025404308.1|1443059_1443659_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZBV0	Stx2-converting_phage	99.0	2.0e-110
WP_023307795.1|1443723_1445037_+	hypothetical protein	NA	A0A0P0ZD68	Stx2-converting_phage	99.1	3.3e-78
WP_025404309.1|1445038_1445308_+|tail	phage tail protein	tail	A0A1U9AJC2	Stx1_converting_phage	98.9	3.2e-44
WP_115801847.1|1445414_1445504_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001453949.1|1445523_1447872_+	type III secretion system effector E3 ubiquitin ligase NleL	NA	NA	NA	NA	NA
WP_001301984.1|1448462_1451864_+	type III secretion system effector EspN	NA	A0A0N7KZG3	Stx2-converting_phage	39.2	1.7e-219
WP_148294915.1|1452406_1453483_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	97.7	2.7e-174
WP_001301834.1|1455280_1455406_+	hypothetical protein	NA	Q8HAB2	Salmonella_phage	58.3	8.7e-05
WP_001303921.1|1455485_1455761_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000938118.1|1455821_1457183_-	type III secretion system effector EspK	NA	Q9MBM1	Phage_Gifsy-1	29.2	1.4e-50
WP_000799400.1|1457546_1458410_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000531594.1|1458393_1459530_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_000359446.1|1459779_1461006_+	peptidase T	NA	NA	NA	NA	NA
WP_001295435.1|1461054_1462176_-	[50S ribosomal protein L16]-arginine 3-hydroxylase	NA	NA	NA	NA	NA
WP_000085256.1|1462424_1463654_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	56.1	3.8e-132
WP_000953272.1|1464018_1464207_+	AlpA family transcriptional regulator	NA	A0A2H4JB58	uncultured_Caudovirales_phage	66.0	2.0e-13
WP_125090562.1|1464256_1464583_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000106745.1|1464707_1464881_-	hypothetical protein	NA	A0A2H4JB52	uncultured_Caudovirales_phage	51.2	8.4e-06
WP_000226782.1|1465011_1465209_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_000609225.1|1465201_1465414_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000551675.1|1465403_1465868_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204985.1|1465860_1466094_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000770178.1|1466099_1466399_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000833618.1|1466395_1467796_+	AAA family ATPase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	49.6	9.6e-116
WP_000192401.1|1467996_1468248_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000126687.1|1468244_1468655_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_000233304.1|1468665_1468938_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001132079.1|1469064_1469289_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000796958.1|1469540_1469747_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025404312.1|1469746_1470802_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	44.0	9.2e-71
WP_000380886.1|1470814_1471150_+|head	head decoration protein	head	NA	NA	NA	NA
WP_000224599.1|1471162_1471576_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000835281.1|1471781_1472324_+|terminase	terminase	terminase	O64316	Escherichia_phage	44.2	1.8e-33
WP_000133424.1|1472580_1472862_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000735412.1|1473463_1474924_-	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
1473210:1473225	attR	GAAAAAAAATCCGGTA	NA	NA	NA	NA
WP_001265481.1|1474923_1475595_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000423742.1|1475763_1477134_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	1.2e-107
WP_001297479.1|1477137_1477779_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_001353282.1|1477814_1478921_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 5
NZ_CP007136	Escherichia coli O145:H28 str. RM12581 chromosome, complete genome	5585611	1591322	1649514	5585611	capsid,protease,head,tail,integrase,terminase	Stx2-converting_phage(30.3%)	61	1591159:1591186	1633671:1633698
1591159:1591186	attL	CAGTGTGGTACATGGATATCGATACCAC	NA	NA	NA	NA
WP_000113674.1|1591322_1592453_-|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	51.4	3.4e-103
WP_000113189.1|1592430_1592679_-	excisionase	NA	NA	NA	NA	NA
WP_025404315.1|1592743_1595215_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.2	1.1e-58
WP_000199480.1|1595310_1595499_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449172.1|1595495_1595684_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_001342117.1|1596083_1596251_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000920491.1|1596244_1596478_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394552.1|1596455_1596863_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	37.8	7.0e-11
WP_001171903.1|1596885_1597104_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001240336.1|1597176_1597476_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000787428.1|1597740_1598148_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
WP_000912298.1|1598224_1598452_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000705622.1|1598435_1598987_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000020557.1|1598958_1599999_+	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	86.7	3.9e-90
WP_157832601.1|1599910_1600453_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.7	1.5e-85
WP_000450692.1|1600486_1601221_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	84.7	7.7e-109
WP_001505071.1|1601217_1601382_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032162026.1|1602079_1602838_+	AcfC family adhesin Paa	NA	NA	NA	NA	NA
WP_000961821.1|1603116_1603329_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	72.9	1.3e-16
WP_001217394.1|1603549_1603807_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010917803.1|1603876_1604155_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.2e-11
WP_001265289.1|1604156_1605212_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	47.6	2.9e-88
WP_000140002.1|1605212_1605578_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	1.6e-38
WP_001059384.1|1605574_1606264_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	4.0e-59
WP_025404316.1|1607062_1607626_+|terminase	terminase small subunit	terminase	B6DZ97	Enterobacteria_phage	93.0	1.4e-81
WP_025404317.1|1607622_1609284_+|terminase	terminase large subunit	terminase	H6WZK9	Escherichia_phage	98.2	0.0e+00
WP_025404318.1|1609348_1611286_+|capsid	phage major capsid protein	capsid	A0A0P0ZCT9	Stx2-converting_phage	98.4	0.0e+00
WP_001074112.1|1611330_1611552_+	hypothetical protein	NA	H6WZL1	Escherichia_phage	95.9	3.2e-34
WP_000125988.1|1614240_1614567_+|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_001007889.1|1614577_1614928_+|head	phage head closure protein	head	A0A0P0ZDP7	Stx2-converting_phage	100.0	2.7e-59
WP_000573391.1|1614924_1615371_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_000133393.1|1615367_1615712_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	99.1	9.4e-57
WP_022581165.1|1615779_1616496_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	97.1	1.2e-125
WP_001030063.1|1616501_1616876_+|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001453698.1|1616971_1617181_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_000807954.1|1620466_1620808_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_025404322.1|1620807_1621506_+|tail	phage minor tail protein L	tail	A0A0P0ZD44	Stx2-converting_phage	96.6	3.4e-130
WP_000194723.1|1621516_1622260_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.0	5.0e-148
WP_050439450.1|1622205_1622838_+|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	97.1	3.9e-101
WP_025404323.1|1623180_1626654_+	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	89.9	0.0e+00
WP_001303943.1|1627955_1628234_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001414184.1|1628661_1628808_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001401309.1|1628944_1629592_-	T3SS effector E3 ubiquitin-protein ligase NleG	NA	B6ETE1	Enterobacteria_phage	41.6	1.9e-42
WP_001144877.1|1629775_1630366_+	T3SS effector guanine nucleotide exchange factor EspM1	NA	NA	NA	NA	NA
WP_000147167.1|1633128_1633347_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001079499.1|1633848_1634355_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
1633671:1633698	attR	CAGTGTGGTACATGGATATCGATACCAC	NA	NA	NA	NA
WP_001056550.1|1634400_1634901_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000807658.1|1634986_1635166_-	general stress protein	NA	NA	NA	NA	NA
WP_000443065.1|1635546_1636353_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000209513.1|1636352_1637546_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_024221648.1|1637557_1638916_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	41.2	3.9e-37
WP_000763498.1|1638919_1640515_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
WP_001194605.1|1640514_1642077_-	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_001386774.1|1642168_1642213_-	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001285684.1|1642350_1643232_+	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001295575.1|1643228_1643849_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_022581766.1|1643876_1645772_+	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001291215.1|1645984_1646860_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001278904.1|1646899_1647490_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_000559268.1|1647486_1648245_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	6.7e-07
WP_000422045.1|1648464_1649514_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
>prophage 6
NZ_CP007136	Escherichia coli O145:H28 str. RM12581 chromosome, complete genome	5585611	1733153	1791805	5585611	capsid,tRNA,holin,portal,head,tail,integrase,terminase,transposase	Escherichia_phage(51.52%)	72	1732787:1732802	1788628:1788643
1732787:1732802	attL	TGCTGGATAAGCTGCG	NA	NA	NA	NA
WP_001401302.1|1733153_1734386_-	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	1.8e-17
WP_000387388.1|1734640_1735624_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000123735.1|1736101_1737475_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	34.4	6.6e-53
WP_001157377.1|1737603_1738539_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	100.0	2.8e-148
WP_000040838.1|1738591_1739827_-|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	99.3	1.1e-240
WP_000079604.1|1739828_1740044_-	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_001298826.1|1740143_1740332_-	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	98.4	5.5e-27
WP_021500490.1|1740324_1740519_-	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	100.0	9.0e-33
WP_001004423.1|1740582_1741635_-	recombinase RecT	NA	A0A0U2S5Y9	Escherichia_phage	63.3	1.4e-116
WP_025404324.1|1741646_1744772_-	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	82.7	0.0e+00
WP_001519830.1|1744873_1745149_-	phage protein	NA	A0A0U2QW85	Escherichia_phage	92.3	4.9e-40
WP_000245528.1|1745223_1745400_-	hypothetical protein	NA	A0A0U2SHB5	Escherichia_phage	93.1	9.7e-26
WP_000560227.1|1745393_1745615_-	cell division protein FtsZ	NA	A0A0U2RTC4	Escherichia_phage	95.9	1.2e-36
WP_032102321.1|1746210_1746393_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025404325.1|1746393_1747032_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	43.0	8.8e-08
WP_000379546.1|1747043_1747196_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	1.3e-07
WP_000410105.1|1747501_1747921_-	helix-turn-helix domain-containing protein	NA	K7PH71	Enterobacterial_phage	60.6	3.1e-14
WP_001033914.1|1748017_1748260_+	helix-turn-helix transcriptional regulator	NA	K7PKH4	Enterobacteria_phage	62.1	2.3e-17
WP_000702023.1|1748256_1748679_+	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	95.0	5.3e-70
WP_000899742.1|1748691_1749561_+	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	94.3	2.2e-78
WP_025404326.1|1749567_1750314_+	ATP-binding protein	NA	V5UQI5	Shigella_phage	80.5	1.8e-113
WP_025404327.1|1750335_1751106_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	67.2	6.3e-85
WP_001118155.1|1751121_1751517_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.4	1.0e-30
WP_000761449.1|1751517_1751931_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	95.8	6.6e-57
WP_000063625.1|1751979_1752192_+	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	87.1	1.4e-31
WP_029594466.1|1752255_1752600_+	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	93.5	2.0e-46
WP_000610382.1|1752596_1752950_+	DUF551 domain-containing protein	NA	Q9EY98	Enterobacteria_phage	65.8	3.2e-36
WP_001278450.1|1753065_1753170_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000967410.1|1753358_1753571_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	97.1	2.8e-27
WP_071525388.1|1753807_1754059_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000940348.1|1754130_1754730_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	91.0	1.6e-104
WP_000228019.1|1754729_1755020_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	88.5	5.7e-47
WP_000640148.1|1755016_1755571_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	71.6	7.5e-72
WP_000211416.1|1755844_1756426_+	ORF6N domain-containing protein	NA	Q8VNP5	Enterobacteria_phage	97.6	8.7e-63
WP_000917763.1|1756669_1756867_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	8.9e-28
WP_000301789.1|1757001_1757715_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000466957.1|1758165_1758597_+	tellurite resistance TerB family protein	NA	H6WZJ6	Escherichia_phage	97.2	3.3e-67
WP_024247920.1|1759168_1761019_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	99.4	0.0e+00
WP_000411802.1|1761463_1761670_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.4e-31
WP_000731241.1|1761674_1762019_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000992148.1|1762069_1762603_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	99.4	3.0e-102
WP_001056806.1|1762873_1763443_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539795.1|1763442_1763589_+	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	87.0	1.1e-11
WP_001208680.1|1763811_1763997_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001302717.1|1764522_1764837_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001303940.1|1764918_1765143_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	90.6	1.7e-19
WP_000453587.1|1765531_1766077_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
WP_001027330.1|1766051_1767977_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.1	0.0e+00
WP_000198153.1|1767973_1768180_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001443752.1|1768176_1769778_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	3.6e-308
WP_025404328.1|1769758_1771078_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	97.9	1.7e-231
WP_001295978.1|1771087_1771420_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000063258.1|1771475_1772501_+|capsid	major capsid protein	capsid	A0A2I6TCE5	Escherichia_phage	98.8	5.1e-191
WP_000158897.1|1772542_1772938_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	93.9	2.4e-56
WP_000752994.1|1772949_1773303_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	100.0	9.0e-63
WP_000975099.1|1773314_1773893_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	1.3e-79
WP_000683138.1|1773889_1774285_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	99.2	5.0e-70
WP_001342267.1|1774292_1775033_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	98.0	1.0e-129
WP_000479169.1|1775048_1775471_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	3.1e-70
WP_000459457.1|1775452_1775887_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_025404251.1|1775879_1778459_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	97.4	0.0e+00
WP_000847347.1|1778455_1778785_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	99.1	3.6e-58
WP_001152619.1|1778784_1779483_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	99.1	7.3e-133
WP_000194780.1|1779488_1780232_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.8	2.5e-147
WP_000090891.1|1780168_1780801_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	2.2e-96
WP_001585354.1|1784428_1785028_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	99.5	5.2e-111
WP_038426835.1|1785092_1786406_+|tail	tail fiber protein	tail	Q6H9S9	Enterobacteria_phage	98.9	2.2e-77
WP_001023407.1|1786407_1786677_+|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
WP_016241229.1|1787045_1787360_-	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_085961182.1|1787762_1788976_-|transposase	IS3-like element IS629 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.7	4.9e-169
1788628:1788643	attR	CGCAGCTTATCCAGCA	NA	NA	NA	NA
WP_000527802.1|1790105_1791566_+	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	29.7	5.1e-43
WP_000214712.1|1791601_1791805_-	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
>prophage 7
NZ_CP007136	Escherichia coli O145:H28 str. RM12581 chromosome, complete genome	5585611	1983155	2038350	5585611	holin,tail,integrase,terminase,transposase	Enterobacteria_phage(34.04%)	58	2008997:2009014	2045030:2045047
WP_001023435.1|1983155_1983425_-|tail	phage tail protein	tail	Q9EYE9	Enterobacteria_phage	97.8	2.4e-44
WP_025404333.1|1983426_1984740_-|tail	tail fiber protein	tail	A0A0P0ZD68	Stx2-converting_phage	99.1	8.8e-79
WP_038426836.1|1984804_1985407_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZBV0	Stx2-converting_phage	98.5	2.4e-108
WP_141069701.1|1989285_1989915_-|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	98.6	2.1e-102
WP_000194729.1|1989860_1990604_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	96.4	8.9e-145
WP_025404337.1|1990614_1991313_-|tail	phage minor tail protein L	tail	A0A0P0ZD44	Stx2-converting_phage	98.3	1.1e-131
WP_000847298.1|1991312_1991642_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_000081788.1|1991638_1994251_-|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	96.1	0.0e+00
WP_000533440.1|1994231_1994645_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
WP_000479051.1|1994671_1995094_-|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	97.9	2.4e-70
WP_000235090.1|1995107_1995860_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000682716.1|1995867_1996266_-|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
WP_000974966.1|1996278_1996902_-	hypothetical protein	NA	Q9EYD6	Enterobacteria_phage	100.0	6.6e-101
WP_001097065.1|1997177_1997504_-	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_000102415.1|2001060_2001273_-	hypothetical protein	NA	S5MBY8	Escherichia_phage	98.6	3.0e-29
WP_001077625.1|2001269_2003393_-|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	100.0	0.0e+00
WP_000373407.1|2003389_2003866_-	DUF1441 family protein	NA	Q8VNN8	Enterobacteria_phage	100.0	3.3e-84
WP_012816791.1|2004340_2004526_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_001092872.1|2005044_2005578_-	lysozyme	NA	Q08J98	Stx2-converting_phage	96.0	6.2e-100
WP_001041949.1|2006089_2006881_-	DUF1327 domain-containing protein	NA	Q08JA0	Stx2-converting_phage	85.5	5.7e-33
WP_000284518.1|2006884_2007100_-|holin	holin	holin	Q6H9V8	Enterobacteria_phage	100.0	2.0e-33
WP_001290230.1|2007177_2007423_-	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_000143458.1|2007463_2007643_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_025404338.1|2007780_2009727_-	DUF1737 domain-containing protein	NA	A0A075M342	Escherichia_Stx1-converting_recombinant_phage	98.1	0.0e+00
2008997:2009014	attL	AACAGCACATTTTTCGGG	NA	NA	NA	NA
WP_000024315.1|2010230_2011289_-	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	99.1	1.8e-207
WP_000917756.1|2011439_2011637_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	6.8e-28
WP_001204809.1|2011852_2012233_-	antitermination protein Q	NA	S5M7R9	Escherichia_phage	99.2	1.4e-66
WP_025404339.1|2012251_2013301_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	58.2	1.4e-116
WP_000191872.1|2013302_2013575_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	53.0	1.1e-12
WP_000756596.1|2013696_2014041_-	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	99.1	6.1e-56
WP_000967410.1|2014160_2014373_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	97.1	2.8e-27
WP_000373318.1|2014726_2015521_+	protein kinase	NA	A0A1S5V1U4	Saudi_moumouvirus	29.7	7.3e-12
WP_000789359.1|2015504_2016221_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000761428.1|2016748_2017162_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	99.2	1.6e-58
WP_001118156.1|2017177_2017558_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.5	4.1e-29
WP_000450846.1|2017573_2018344_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	66.4	1.4e-84
WP_000139445.1|2018377_2018839_-	hypothetical protein	NA	A0A0U2JGJ0	Escherichia_phage	94.1	1.7e-82
WP_001435286.1|2018831_2019869_-	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	69.1	5.8e-86
WP_000693921.1|2019937_2020363_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001261756.1|2020359_2020587_-	cell division protein	NA	NA	NA	NA	NA
WP_000444611.1|2020686_2021331_+	LexA family transcriptional regulator	NA	A0A1P8DTH0	Proteus_phage	25.9	6.1e-09
WP_000380316.1|2021604_2021757_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	5.1e-07
WP_000394548.1|2021768_2022407_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	2.5e-07
WP_001133037.1|2022407_2022617_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000413705.1|2023183_2023372_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001098307.1|2023368_2023560_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_025404340.1|2023653_2026125_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.0	3.2e-58
WP_001368608.1|2026209_2026446_+	excisionase family protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
WP_001206148.1|2026465_2027761_+|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.3	2.5e-155
WP_072095801.1|2027780_2027891_-	transporter	NA	NA	NA	NA	NA
WP_000836060.1|2027948_2028968_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.7	1.0e-18
WP_001295394.1|2028979_2030194_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000705197.1|2030860_2031202_+	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001138582.1|2031236_2031797_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_001321287.1|2031799_2032510_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001295396.1|2032617_2032923_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_072095802.1|2035610_2037134_+	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	50.7	7.4e-130
WP_085961182.1|2037136_2038350_-|transposase	IS3-like element IS629 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.7	4.9e-169
2045030:2045047	attR	AACAGCACATTTTTCGGG	NA	NA	NA	NA
>prophage 8
NZ_CP007136	Escherichia coli O145:H28 str. RM12581 chromosome, complete genome	5585611	2327127	2408052	5585611	capsid,tRNA,plate,holin,portal,head,tail,terminase,transposase	Enterobacteria_phage(71.05%)	79	NA	NA
WP_001258668.1|2327127_2328900_-|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000891626.1|2329209_2329776_+	hydrolase	NA	NA	NA	NA	NA
WP_000639274.1|2329772_2330591_+	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	99.2	6.5e-72
WP_000252980.1|2330643_2331039_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000019617.1|2331079_2331823_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	3.5e-24
WP_000564736.1|2331819_2332791_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_000176856.1|2332955_2335385_-	trimethylamine N-oxide reductase TorZ	NA	NA	NA	NA	NA
WP_001214304.1|2335409_2336510_-	cytochrome c	NA	NA	NA	NA	NA
WP_001185723.1|2336897_2337644_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_001295504.1|2337657_2338224_-	VOC family protein	NA	NA	NA	NA	NA
WP_001025326.1|2338439_2340173_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	8.8e-87
WP_001307852.1|2340349_2340838_+	lysozyme inhibitor LprI family protein	NA	NA	NA	NA	NA
WP_001259594.1|2340959_2341352_-	flagellar protein FlhE	NA	NA	NA	NA	NA
WP_000066966.1|2341351_2343430_-	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_001278936.1|2343422_2344571_-	flagellar type III secretion system protein FlhB	NA	NA	NA	NA	NA
WP_000983609.1|2344772_2345417_-	protein phosphatase CheZ	NA	NA	NA	NA	NA
WP_000763865.1|2345427_2345817_-	chemotaxis protein CheY	NA	A0A2K9L4R0	Tupanvirus	32.0	1.3e-06
WP_000036371.1|2345831_2346881_-	protein-glutamate methylesterase/protein glutamine deamidase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
WP_000204337.1|2346883_2347744_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_001297437.1|2349409_2351071_-	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.3	1.7e-10
WP_000147302.1|2351215_2351719_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_001406772.1|2351739_2353704_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_000795622.1|2353708_2354635_-	flagellar motor protein MotB	NA	NA	NA	NA	NA
WP_000906336.1|2354631_2355519_-	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
WP_001291603.1|2355645_2356224_-	flagellar transcriptional regulator FlhC	NA	NA	NA	NA	NA
WP_001295647.1|2356226_2356577_-	flagellar transcriptional regulator FlhD	NA	NA	NA	NA	NA
WP_000122432.1|2357357_2357786_+	universal stress protein UspC	NA	NA	NA	NA	NA
WP_001295646.1|2357792_2359217_-	alpha,alpha-trehalose-phosphate synthase	NA	NA	NA	NA	NA
WP_001302045.1|2359191_2359992_-	trehalose-phosphatase	NA	NA	NA	NA	NA
WP_000987895.1|2360158_2361148_-	arabinose ABC transporter permease AraH	NA	NA	NA	NA	NA
WP_001187819.1|2361159_2362674_-	arabinose ABC transporter ATP binding protein AraG	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	4.3e-13
WP_000548675.1|2362743_2363733_-	arabinose ABC transporter substrate-binding protein AraF	NA	NA	NA	NA	NA
WP_000179469.1|2364529_2365033_+	non-heme ferritin-like protein	NA	NA	NA	NA	NA
WP_000082127.1|2365111_2365363_-	DUF2766 domain-containing protein	NA	NA	NA	NA	NA
WP_010723106.1|2365478_2365565_-	stress response protein AzuC	NA	NA	NA	NA	NA
WP_024262403.1|2365827_2366151_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001400592.1|2366321_2366819_+	non-heme ferritin	NA	NA	NA	NA	NA
WP_000377223.1|2366856_2367096_-	YecH family protein	NA	NA	NA	NA	NA
WP_000797567.1|2367287_2368499_+	tyrosine transporter TyrP	NA	NA	NA	NA	NA
WP_000847882.1|2368560_2369226_-	UPF0149 family protein YecA	NA	NA	NA	NA	NA
WP_000687352.1|2369824_2371696_-	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_000465340.1|2371753_2372263_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001290574.1|2372314_2373070_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_032212789.1|2373469_2374324_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.4	1.2e-68
WP_000088336.1|2374337_2374625_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_000290304.1|2377686_2379471_-	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_000779012.1|2379493_2380177_-	YecA family protein	NA	NA	NA	NA	NA
WP_101892112.1|2380173_2381331_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_085961182.1|2382747_2383960_+|transposase	IS3-like element IS629 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.7	4.9e-169
WP_000087810.1|2384705_2385752_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	99.7	5.7e-206
WP_000613782.1|2385751_2387503_-|terminase	terminase	terminase	A0A0A7NV54	Enterobacteria_phage	97.8	0.0e+00
WP_001262654.1|2387657_2388494_+|capsid	phage capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	99.3	7.9e-150
WP_001055089.1|2388517_2389570_+|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	97.1	6.6e-194
WP_000632336.1|2389615_2390416_+|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	91.4	1.5e-129
WP_000178988.1|2390519_2391014_+|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	99.4	9.2e-90
WP_000864901.1|2391013_2391214_+|tail	tail protein	tail	A0A0A7NV57	Enterobacteria_phage	100.0	3.5e-32
WP_000104350.1|2391216_2391540_+|holin	holin	holin	A0A0A7NRY9	Enterobacteria_phage	99.1	1.6e-50
WP_000072327.1|2391536_2391929_+	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	100.0	5.8e-71
WP_000780563.1|2391925_2392333_+	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	97.8	1.3e-65
WP_000920594.1|2392470_2392938_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	100.0	2.6e-86
WP_000356339.1|2392930_2393566_+	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	100.0	1.1e-114
WP_001271894.1|2393562_2394144_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	96.9	1.0e-100
WP_000213447.1|2394140_2394491_+|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	100.0	9.2e-60
WP_001111928.1|2394494_2395391_+|plate	phage baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	98.0	1.5e-154
WP_000071720.1|2395383_2395914_+|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	99.4	1.1e-93
WP_025404349.1|2395916_2397902_+|tail	phage tail protein	tail	A0A0A7NV63	Enterobacteria_phage	84.9	2.5e-170
WP_000972142.1|2397904_2398438_+|tail	tail fiber assembly protein	tail	C9DGR0	Escherichia_phage	99.4	1.4e-96
WP_001164120.1|2398466_2398994_-|tail	tail fiber assembly protein	tail	A0A222YWC2	Escherichia_phage	97.7	7.3e-93
WP_032316220.1|2398997_2399702_-	hypothetical protein	NA	Q7Y4D4	Escherichia_virus	93.2	4.8e-124
WP_000905061.1|2399938_2400538_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	98.9	3.8e-98
WP_000979945.1|2400566_2401055_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	99.4	1.4e-85
WP_000853440.1|2401067_2403875_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	96.9	0.0e+00
WP_000333503.1|2403861_2404017_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	96.1	9.7e-22
WP_000651580.1|2404025_2404400_-	hypothetical protein	NA	A0A0A7NPZ0	Enterobacteria_phage	73.2	4.0e-37
WP_000290450.1|2404455_2404968_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	100.0	3.2e-93
WP_000005358.1|2404967_2406152_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	99.2	9.6e-226
WP_000132788.1|2406309_2407419_+	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	94.6	2.8e-195
WP_000488107.1|2407461_2407722_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000078920.1|2407911_2408052_+	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	100.0	7.0e-19
>prophage 9
NZ_CP007136	Escherichia coli O145:H28 str. RM12581 chromosome, complete genome	5585611	2463320	2524751	5585611	capsid,plate,holin,protease,portal,head,tail,integrase,terminase,transposase	Enterobacteria_phage(31.48%)	70	2512232:2512291	2540131:2540235
WP_095111390.1|2463320_2463452_-	hypothetical protein	NA	K7PMH7	Enterobacteria_phage	76.5	1.5e-07
WP_022581903.1|2463798_2464779_-	type III secretion system effector arginine glycosyltransferase NleB2	NA	Q8HAB2	Salmonella_phage	49.2	9.4e-86
WP_001373820.1|2464955_2465204_-|tail	phage tail protein	tail	B6DZB8	Enterobacteria_phage	98.8	4.4e-40
WP_038426877.1|2465225_2466539_-|tail	tail fiber protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.9	2.8e-77
WP_001360257.1|2466603_2467227_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1U8QHD6	Enterobacteria_phage	61.4	1.7e-69
WP_038426878.1|2467295_2470772_-	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	97.4	0.0e+00
WP_000649829.1|2470905_2471433_+	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	60.5	1.8e-59
WP_052915903.1|2471623_2472256_-|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	96.2	7.1e-103
WP_025404352.1|2472201_2472945_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	98.0	5.9e-149
WP_001357740.1|2472950_2473649_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.7	8.1e-132
WP_025404276.1|2473648_2473978_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	94.5	2.2e-55
WP_025404353.1|2473974_2476554_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	82.0	0.0e+00
WP_000533423.1|2476534_2476948_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	2.7e-42
WP_000479105.1|2476974_2477406_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.8	3.7e-42
WP_001357739.1|2477419_2478172_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	1.6e-133
WP_000683066.1|2478179_2478575_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	83.2	3.9e-59
WP_000975046.1|2478571_2479105_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	65.1	2.2e-57
WP_001204549.1|2479120_2479474_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	8.7e-42
WP_000201523.1|2479466_2479841_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000522615.1|2479892_2480921_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	60.7	3.9e-114
WP_000256809.1|2480978_2481326_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_025380298.1|2481362_2482868_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	3.6e-100
WP_000831765.1|2482857_2484450_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.9	3.2e-184
WP_000259002.1|2484446_2484653_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_025404272.1|2484636_2486565_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.9	1.8e-261
WP_000235436.1|2486536_2487046_-|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_001300236.1|2487447_2487672_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	88.7	2.9e-19
WP_001303878.1|2487753_2488068_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_012816791.1|2488595_2488781_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_032162009.1|2489332_2489866_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	97.2	2.1e-100
WP_000138558.1|2490025_2490298_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000411814.1|2490553_2490760_-|holin	holin	holin	Q6H9V8	Enterobacteria_phage	98.5	5.3e-31
WP_000874348.1|2491208_2493059_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.3	0.0e+00
WP_000261909.1|2493826_2494540_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000917737.1|2494677_2494875_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	2.6e-27
WP_000265267.1|2495161_2495980_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_148294920.1|2496131_2496503_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	83.9	4.0e-53
WP_001217447.1|2496505_2496865_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.5	5.0e-37
WP_001265233.1|2496877_2497927_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.3	3.4e-110
WP_000191872.1|2497928_2498201_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	53.0	1.1e-12
WP_000756596.1|2498322_2498667_-	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	99.1	6.1e-56
WP_000935259.1|2498786_2498999_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
WP_000104474.1|2499232_2499790_-	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	41.7	2.8e-34
WP_000683609.1|2499791_2500010_-	DUF4014 family protein	NA	A0A2R2Z311	Escherichia_phage	72.2	2.3e-21
WP_000034815.1|2500137_2500449_-	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	91.3	1.6e-55
WP_000699809.1|2500441_2500669_-	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	49.3	5.1e-11
WP_042353845.1|2500665_2500947_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	72.5	3.9e-29
WP_000450617.1|2500979_2501696_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.6	2.1e-71
WP_000788760.1|2501717_2502464_-	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	83.2	3.6e-114
WP_025404357.1|2502470_2503565_-	hypothetical protein	NA	A0A088CD36	Shigella_phage	65.7	1.7e-64
WP_000693858.1|2503636_2504062_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000747948.1|2504045_2504288_-	hypothetical protein	NA	H9C161	Pectobacterium_phage	55.8	4.8e-07
WP_001416688.1|2504679_2505018_+	peptidase S24	NA	H9C160	Pectobacterium_phage	30.1	1.9e-06
WP_001345283.1|2505310_2505463_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	1.7e-07
WP_000394548.1|2505474_2506113_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	2.5e-07
WP_001133037.1|2506113_2506323_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449192.1|2506893_2507082_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001090200.1|2507078_2507270_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000096346.1|2509893_2510097_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000533625.1|2510096_2511122_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	58.2	4.0e-103
WP_001302302.1|2511357_2512155_+	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
2512232:2512291	attL	TAATATGCGCCCCGTTCACACGATTCCTCTGTAGTTCAGTCGGTAGAACGGCGGACTGTT	NA	NA	NA	NA
WP_000055685.1|2512492_2513755_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	40.3	3.8e-71
WP_157832604.1|2516176_2516317_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001242259.1|2516746_2517019_-	HigA family addiction module antidote protein	NA	NA	NA	NA	NA
WP_000983666.1|2517169_2517424_-	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	56.7	1.0e-12
WP_000235844.1|2517420_2517882_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022581241.1|2518217_2519279_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_022581240.1|2519242_2521102_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_025404358.1|2521406_2523533_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	23.1	2.2e-23
WP_113706114.1|2523538_2524751_+|transposase	IS3-like element IS629 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.3	1.4e-168
2540131:2540235	attR	TAATATGCGCCCCGTTCACACGATTCCTCTGTAGTTCAGTCGGTAGAACGGCGGACTGTTAATCCGTATGTCACTGGTTCGAGTCCAGTCAGAGGAGCCAAATTC	NA	NA	NA	NA
>prophage 10
NZ_CP007136	Escherichia coli O145:H28 str. RM12581 chromosome, complete genome	5585611	2563815	2610387	5585611	capsid,holin,tail,integrase,transposase	Salmonella_phage(36.23%)	71	2587556:2587570	2612331:2612345
WP_001320295.1|2563815_2564982_-	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	98.7	5.5e-226
WP_025404365.1|2565569_2566163_-|tail	phage tail protein	tail	M1SV83	Escherichia_phage	64.3	1.6e-59
WP_025404366.1|2566162_2566957_-	hypothetical protein	NA	K7PH60	Enterobacterial_phage	81.4	1.7e-69
WP_000049950.1|2566956_2567637_-	DUF2612 domain-containing protein	NA	A0A0M5M1K4	Salmonella_phage	78.8	2.6e-103
WP_025404367.1|2567633_2568833_-	hypothetical protein	NA	A0A0M4RD32	Salmonella_phage	83.9	7.5e-186
WP_001270637.1|2568832_2569186_-	hypothetical protein	NA	A0A0M4R339	Salmonella_phage	89.7	6.9e-55
WP_024233996.1|2569185_2569941_-	hypothetical protein	NA	A0A0M5M1K7	Salmonella_phage	87.3	2.8e-114
WP_000466689.1|2570000_2570240_-	DUF4282 domain-containing protein	NA	A0A077KGV8	Edwardsiella_phage	47.5	5.6e-08
WP_032162015.1|2570293_2570635_-	hypothetical protein	NA	A0A0M4RTY3	Salmonella_phage	84.4	2.5e-33
WP_025404368.1|2570638_2571700_-	hypothetical protein	NA	A0A0M4QX01	Salmonella_phage	80.3	2.0e-158
WP_016233440.1|2571702_2572005_-	hypothetical protein	NA	A0A0M4R5B7	Salmonella_phage	90.0	2.4e-48
WP_001420197.1|2572004_2572592_-	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	88.5	6.9e-84
WP_025404369.1|2572591_2574580_-	hypothetical protein	NA	A0A0M4REK7	Salmonella_phage	74.2	4.0e-269
WP_023565715.1|2574757_2575210_-	hypothetical protein	NA	A0A0M4S6U8	Salmonella_phage	72.7	4.7e-56
WP_000109255.1|2575213_2575654_-	DUF3277 family protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	74.7	1.6e-56
WP_000046924.1|2575664_2576810_-	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	73.8	1.8e-160
WP_032162013.1|2576813_2577377_-	hypothetical protein	NA	A0A0M4R331	Salmonella_phage	75.7	7.6e-80
WP_023908474.1|2577351_2577741_-	hypothetical protein	NA	A0A0M3ULK0	Salmonella_phage	96.1	1.1e-66
WP_025404371.1|2577727_2578282_-	hypothetical protein	NA	A0A0M4S631	Salmonella_phage	85.3	1.4e-81
WP_024183605.1|2578278_2578686_-	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	96.3	5.1e-70
WP_025404372.1|2578651_2579020_-	hypothetical protein	NA	A0A0M4RTX5	Salmonella_phage	89.3	1.0e-53
WP_000627483.1|2579060_2580002_-	DUF2184 domain-containing protein	NA	A0A0M3ULD3	Salmonella_phage	87.2	2.9e-156
WP_025404373.1|2580013_2580517_-	hypothetical protein	NA	A0A0M4QWZ6	Salmonella_phage	82.0	8.0e-73
WP_025404374.1|2580521_2581742_-	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	89.0	1.5e-202
WP_086353604.1|2581756_2582494_-|capsid	minor capsid protein	capsid	A0A0M4REK0	Salmonella_phage	95.0	5.0e-108
WP_025404375.1|2582381_2583848_-	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	94.3	3.3e-268
WP_025404376.1|2583847_2585470_-	bacteriophage TerL protein	NA	A0A0M5M1R6	Salmonella_phage	94.8	5.0e-310
WP_025404377.1|2585472_2585946_-	DUF2280 domain-containing protein	NA	H9C190	Pectobacterium_phage	72.8	3.6e-51
WP_025404378.1|2585977_2586598_-	hypothetical protein	NA	I6S676	Salmonella_phage	73.2	7.5e-89
WP_025404379.1|2586654_2586840_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025404380.1|2586983_2587376_-	DUF2570 domain-containing protein	NA	Q8SBD9	Shigella_phage	79.1	2.8e-49
WP_025404381.1|2587359_2587836_-	glycoside hydrolase family protein	NA	K7P890	Enterobacteria_phage	94.9	3.0e-85
2587556:2587570	attL	ACTGCGTCCTGGCTT	NA	NA	NA	NA
WP_001570152.1|2587819_2588143_-|holin	phage holin, lambda family	holin	K7PH31	Enterobacteria_phage	99.1	1.1e-51
WP_001554889.1|2588604_2589123_-	DUF1133 family protein	NA	Q716B8	Shigella_phage	99.4	2.0e-95
WP_025404382.1|2589113_2589785_-	serine/threonine protein phosphatase	NA	K7P721	Enterobacteria_phage	98.6	1.1e-130
WP_000144614.1|2589762_2589969_-	protein ninH	NA	Q716C0	Shigella_phage	100.0	7.3e-33
WP_000861013.1|2589965_2590361_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A220NQY4	Salmonella_phage	91.6	4.4e-66
WP_000002248.1|2590357_2590648_-	DUF1364 domain-containing protein	NA	A0A220NQY2	Salmonella_phage	97.9	4.2e-50
WP_025404383.1|2590647_2591373_-	DNA-binding protein	NA	A0A2I6PIF5	Escherichia_phage	99.2	6.7e-129
WP_000566861.1|2591365_2591536_-	protein ninF	NA	K7P6X0	Enterobacteria_phage	100.0	5.5e-26
WP_001254251.1|2591532_2591715_-	NinE family protein	NA	Q716C5	Shigella_phage	100.0	1.3e-28
WP_032162011.1|2591711_2592239_-	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	99.4	2.8e-100
WP_025404384.1|2592235_2592676_-	recombination protein NinB	NA	A5VW91	Enterobacteria_phage	99.3	2.0e-80
WP_025404385.1|2592950_2594327_-	AAA family ATPase	NA	A0A0P0ZC27	Stx2-converting_phage	99.8	9.7e-254
WP_001608293.1|2594323_2595145_-	replication protein	NA	K7PJZ3	Enterobacterial_phage	99.6	2.0e-153
WP_021544312.1|2595327_2595606_-	transcriptional activator protein C1	NA	K7P7A2	Enterobacteria_phage	97.8	9.0e-42
WP_000620665.1|2595714_2595909_-	hypothetical protein	NA	K7PLQ6	Enterobacteria_phage	100.0	1.8e-28
WP_000428318.1|2596015_2596732_+	helix-turn-helix domain-containing protein	NA	K7PGR7	Enterobacteria_phage	100.0	9.2e-123
WP_000233129.1|2596750_2597119_+	hypothetical protein	NA	K7P6G1	Enterobacteria_phage	98.4	8.5e-56
WP_085947970.1|2597994_2599208_-|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	100.0	2.9e-169
WP_157832612.1|2599328_2599499_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025404388.1|2599700_2599883_+	hypothetical protein	NA	K7PLQ2	Enterobacteria_phage	96.7	3.9e-30
WP_000972063.1|2600117_2600252_+	hypothetical protein	NA	K7PHK2	Enterobacteria_phage	100.0	3.1e-16
WP_025404389.1|2600236_2600389_+	host cell division inhibitory peptide Kil	NA	K7PKW3	Enterobacterial_phage	98.0	1.2e-19
WP_000050554.1|2600464_2600635_+	hypothetical protein	NA	K7PJW0	Enterobacteria_phage	100.0	3.0e-24
WP_000031370.1|2600645_2601251_+	ERF family protein	NA	Q9MCQ9	Enterobacteria_phage	100.0	4.1e-108
WP_025404390.1|2601250_2601634_+	hypothetical protein	NA	K7P7R8	Enterobacteria_phage	97.6	5.5e-66
WP_085961182.1|2601909_2603122_+|transposase	IS3-like element IS629 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.7	4.9e-169
WP_032162002.1|2603274_2603439_+	DUF2737 family protein	NA	A0A2I6PID4	Escherichia_phage	98.1	7.1e-23
WP_025404392.1|2603435_2603897_+	hypothetical protein	NA	A0A2P1MXC5	Escherichia_phage	72.3	3.1e-55
WP_025404393.1|2603893_2604202_+	hypothetical protein	NA	B1GS43	Salmonella_phage	86.2	2.7e-39
WP_025404394.1|2604194_2604839_+	hypothetical protein	NA	Q1MVG0	Enterobacteria_phage	97.2	2.0e-129
WP_000151165.1|2604835_2605489_+	ead/Ea22-like family protein	NA	A5VWB1	Enterobacteria_phage	58.1	2.3e-35
WP_001289898.1|2605485_2606238_+	ead/Ea22-like family protein	NA	Q1MVF9	Enterobacteria_phage	89.0	8.8e-108
WP_000797279.1|2606583_2606772_+	hypothetical protein	NA	A0A1I9LJM4	Stx_converting_phage	98.4	1.4e-30
WP_025404395.1|2607285_2607999_+	DUF551 domain-containing protein	NA	A0A2D1GLX9	Escherichia_phage	60.0	3.0e-65
WP_021549676.1|2607995_2608256_+	hypothetical protein	NA	A0A077SLR0	Escherichia_phage	96.5	3.5e-40
WP_032162000.1|2608255_2608540_+	ASCH domain-containing protein	NA	A0A2D1GLL3	Escherichia_phage	97.9	2.7e-49
WP_025404397.1|2608612_2608957_+	hypothetical protein	NA	K7PJY7	Enterobacterial_phage	97.4	1.7e-58
WP_000132739.1|2609036_2609228_+	AlpA family phage regulatory protein	NA	A0A0P0ZBL0	Stx2-converting_phage	100.0	1.7e-31
WP_025404398.1|2609208_2610387_-|integrase	site-specific integrase	integrase	K7P7J2	Enterobacteria_phage	99.7	1.5e-231
2612331:2612345	attR	AAGCCAGGACGCAGT	NA	NA	NA	NA
>prophage 11
NZ_CP007136	Escherichia coli O145:H28 str. RM12581 chromosome, complete genome	5585611	2696434	2797481	5585611	capsid,tRNA,holin,lysis,head,tail,terminase,transposase	Enterobacteria_phage(33.33%)	87	NA	NA
WP_000476014.1|2696434_2697796_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.7	1.9e-217
WP_001318299.1|2698126_2698444_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000807356.1|2698849_2699749_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.7e-12
WP_000178552.1|2699830_2700610_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000490679.1|2701797_2703153_-	galactitol permease IIC component	NA	NA	NA	NA	NA
WP_000823260.1|2703156_2703441_-	PTS galactitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_000182899.1|2703471_2703924_-	PTS galactitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_000853896.1|2703933_2705196_-	tagatose-bisphosphate aldolase subunit GatZ	NA	NA	NA	NA	NA
WP_001307281.1|2705224_2706079_-	tagatose-bisphosphate aldolase subunit GatY	NA	NA	NA	NA	NA
WP_000129551.1|2706386_2707439_-	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_000858489.1|2707695_2708973_+	MFS transporter	NA	NA	NA	NA	NA
WP_000846214.1|2708969_2709974_+	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	30.0	2.6e-14
WP_000011993.1|2709970_2710936_+	sugar kinase	NA	NA	NA	NA	NA
WP_000434038.1|2710909_2711656_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001351783.1|2711707_2712526_-	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	38.0	1.9e-23
WP_000822274.1|2712590_2713391_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_001195570.1|2713387_2714176_-	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_000019944.1|2714398_2714671_-	Ni(II)/Co(II)-binding transcriptional repressor RcnR	NA	NA	NA	NA	NA
WP_000133660.1|2714791_2715616_+	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
WP_000153074.1|2715834_2716173_+	Ni(II)/Co(II) efflux transporter accessory subunit RcnB	NA	NA	NA	NA	NA
WP_000405695.1|2716254_2717289_-	putative fimbrial-like adhesin protein	NA	NA	NA	NA	NA
WP_000945452.1|2717304_2719785_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_000677393.1|2719800_2720475_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_000830457.1|2720554_2721097_-	fimbrial protein	NA	NA	NA	NA	NA
WP_001324851.1|2721389_2721671_-	YehE family protein	NA	NA	NA	NA	NA
WP_001005448.1|2721933_2723043_-	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_001400694.1|2723174_2725208_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.8e-54
WP_001556120.1|2729152_2732785_+	DUF4132 domain-containing protein	NA	NA	NA	NA	NA
WP_000636925.1|2732845_2733163_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001300974.1|2733469_2734558_+	MoxR family ATPase	NA	NA	NA	NA	NA
WP_001294387.1|2734568_2736848_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001333512.1|2736840_2737977_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	1.9e-162
WP_001400695.1|2737973_2739974_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.0	0.0e+00
WP_001295429.1|2740098_2740560_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_000950409.1|2740599_2741070_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	5.2e-82
WP_000598641.1|2741116_2741836_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|2741832_2743518_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001261971.1|2744032_2744281_+	DinI-like family protein	NA	H6WZN4	Escherichia_phage	100.0	2.4e-38
WP_025404399.1|2744485_2745694_+	hypothetical protein	NA	H6WZN3	Escherichia_phage	99.3	1.7e-230
WP_001025673.1|2746345_2747587_+	type III secretion system effector NleA	NA	H6WZN2	Escherichia_phage	84.7	3.2e-216
WP_024262412.1|2748579_2748849_-|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	97.8	7.1e-44
WP_025404401.1|2748850_2750164_-|tail	tail fiber protein	tail	A0A0P0ZCC1	Stx2-converting_phage	98.6	5.0e-82
WP_001230489.1|2750228_2750828_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	98.5	9.7e-110
WP_097455678.1|2754614_2755244_-|tail	tail assembly protein	tail	A0A0P0ZEN7	Stx2-converting_phage	95.7	3.5e-102
WP_025404403.1|2755189_2755933_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	94.7	3.4e-144
WP_025404404.1|2755938_2756637_-|tail	phage minor tail protein L	tail	S5M7Q4	Escherichia_phage	97.4	8.9e-131
WP_000807964.1|2756636_2756978_-|tail	phage tail protein	tail	A0A0P0ZCS8	Stx2-converting_phage	100.0	8.7e-63
WP_025404405.1|2756970_2760213_-|tail	phage tail tape measure protein	tail	B6ETF7	Enterobacteria_phage	97.7	0.0e+00
WP_001453698.1|2760260_2760470_-	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_001030063.1|2760565_2760940_-|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_022581165.1|2760945_2761662_-|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	97.1	1.2e-125
WP_000133393.1|2761720_2762065_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	99.1	9.4e-57
WP_000573391.1|2762061_2762508_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_001007889.1|2762504_2762855_-|head	phage head closure protein	head	A0A0P0ZDP7	Stx2-converting_phage	100.0	2.7e-59
WP_000125988.1|2762865_2763192_-|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_001074112.1|2765718_2765940_-	hypothetical protein	NA	H6WZL1	Escherichia_phage	95.9	3.2e-34
WP_022581168.1|2765984_2767922_-|capsid	phage major capsid protein	capsid	A0A0P0ZCT9	Stx2-converting_phage	98.1	0.0e+00
WP_025404407.1|2767985_2769647_-|terminase	terminase large subunit	terminase	H6WZK9	Escherichia_phage	99.3	0.0e+00
WP_025404408.1|2769643_2770207_-|terminase	terminase small subunit	terminase	B6DZ97	Enterobacteria_phage	98.9	1.4e-89
WP_000829192.1|2770495_2770861_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	96.7	1.6e-62
WP_000095744.1|2770902_2771103_+	YlcI/YnfO family protein	NA	H6WZK6	Escherichia_phage	97.0	1.3e-29
WP_000828070.1|2771234_2771561_-	TonB family protein	NA	H6WZK5	Escherichia_phage	98.1	6.3e-55
WP_012816791.1|2771961_2772147_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_001280923.1|2772369_2772501_-	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	93.0	3.8e-11
WP_000661708.1|2772595_2773291_-	phage antirepressor protein	NA	Q5MBW0	Stx1-converting_phage	98.7	3.6e-124
WP_000992065.1|2773564_2774098_-	lysozyme	NA	Q6H9V6	Enterobacteria_phage	95.5	6.2e-100
WP_000731192.1|2774148_2774493_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	98.2	6.5e-58
WP_000411809.1|2774497_2774704_-|holin	holin	holin	Q6H9V8	Enterobacteria_phage	100.0	2.4e-31
WP_025404260.1|2777646_2778297_-	SASA family carbohydrate esterase	NA	H6WZJ9	Escherichia_phage	92.1	3.1e-109
WP_025404410.1|2779404_2779593_-	hypothetical protein	NA	K7PJU3	Enterobacteria_phage	66.7	1.8e-17
WP_085961182.1|2779666_2780879_+|transposase	IS3-like element IS629 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.7	4.9e-169
WP_001216963.1|2781422_2781530_+	protein YohO	NA	NA	NA	NA	NA
WP_000783120.1|2781510_2782242_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569315.1|2782246_2783173_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	2.8e-23
WP_000220837.1|2783165_2784323_-	glycine betaine ABC transporter permease YehY	NA	NA	NA	NA	NA
WP_001130308.1|2784329_2785247_-	glycine betaine ABC transporter substrate-binding protein OsmF	NA	NA	NA	NA	NA
WP_000871507.1|2785457_2787755_-	beta-glucosidase BglX	NA	NA	NA	NA	NA
WP_000097402.1|2787950_2789666_+	D-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_001319943.1|2789703_2790636_-	D-alanyl-D-alanine endopeptidase	NA	NA	NA	NA	NA
WP_001295454.1|2790809_2791397_-	YIP1 family protein	NA	NA	NA	NA	NA
WP_001296821.1|2791566_2792145_+	DedA family protein	NA	NA	NA	NA	NA
WP_000079538.1|2792274_2793036_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_001469803.1|2793088_2794615_-	multidrug resistance outer membrane protein MdtQ	NA	NA	NA	NA	NA
WP_000691708.1|2794748_2794832_+	protein YohP	NA	NA	NA	NA	NA
WP_001264861.1|2795204_2796152_-|tRNA	tRNA dihydrouridine(16) synthase DusC	tRNA	NA	NA	NA	NA
WP_001295452.1|2796390_2796789_+	CidA/LrgA family protein	NA	NA	NA	NA	NA
WP_000968208.1|2796785_2797481_+|lysis	CidB/LrgB family autolysis modulator	lysis	NA	NA	NA	NA
>prophage 12
NZ_CP007136	Escherichia coli O145:H28 str. RM12581 chromosome, complete genome	5585611	2989507	3083691	5585611	capsid,tRNA,holin,portal,tail,integrase,terminase,bacteriocin	Escherichia_phage(63.01%)	101	3021219:3021242	3083887:3083910
WP_001283590.1|2989507_2990320_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_001289160.1|2990319_2991333_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000699113.1|2991398_2992535_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.8	5.3e-24
WP_000615820.1|2992633_2993629_+	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
WP_000127796.1|2993625_2994804_-	MFS transporter	NA	NA	NA	NA	NA
WP_000817178.1|2995078_2996299_-	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_000683767.1|2996457_2998464_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_000559764.1|2998584_2998863_-	YfcL family protein	NA	NA	NA	NA	NA
WP_001089226.1|2998896_2999445_-	elongation factor P hydroxylase	NA	NA	NA	NA	NA
WP_000447356.1|2999444_3000254_-	TSUP family transporter	NA	NA	NA	NA	NA
WP_001043835.1|3000253_3001078_-	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
WP_001307917.1|3001081_3002167_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.5	2.7e-89
WP_001309606.1|3002201_3003134_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000730806.1|3003299_3003851_+	endonuclease SmrB	NA	NA	NA	NA	NA
WP_001383353.1|3003964_3004804_-	DUF2544 domain-containing protein	NA	NA	NA	NA	NA
WP_000782937.1|3004804_3005329_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000698462.1|3005325_3005802_-	fimbrial protein	NA	NA	NA	NA	NA
WP_001248900.1|3005798_3006302_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000182848.1|3006317_3007070_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_001112840.1|3007092_3009732_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_000033336.1|3009813_3010377_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_001195819.1|3011019_3011505_-	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_000426149.1|3011707_3013852_-	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
WP_000531918.1|3013851_3015162_-	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
WP_000030901.1|3015343_3015628_-	YfcZ/YiiS family protein	NA	NA	NA	NA	NA
WP_001307921.1|3015999_3017340_+	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
WP_000937775.1|3017705_3018980_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000776768.1|3019161_3019917_-	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
WP_000368129.1|3020210_3021143_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	99.7	2.7e-167
3021219:3021242	attL	GTCCTCTTAGTTAAATGGATATAA	NA	NA	NA	NA
WP_032161876.1|3021365_3029765_-	hypothetical protein	NA	A0A0P0ZCC7	Stx2-converting_phage	93.9	0.0e+00
WP_025404420.1|3029833_3031099_-	hypothetical protein	NA	A0A2L1IV65	Escherichia_phage	90.5	3.9e-185
WP_025404421.1|3031109_3031361_-|bacteriocin	bacteriocin	bacteriocin	A0A2R2Z351	Escherichia_phage	100.0	7.9e-13
WP_000455646.1|3031370_3031817_-	hypothetical protein	NA	A0A2L1IV89	Escherichia_phage	97.3	1.3e-74
WP_025404422.1|3031819_3032473_-	hypothetical protein	NA	Q08J74	Stx2-converting_phage	98.6	6.7e-112
WP_000035555.1|3032566_3032968_-	hypothetical protein	NA	Q08J75	Stx2-converting_phage	100.0	7.0e-72
WP_000078907.1|3033024_3033165_-	Hok/Gef family protein	NA	A0A2R2X2B4	Escherichia_phage	100.0	3.1e-19
WP_000836187.1|3033397_3034135_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A2L1IV31	Escherichia_phage	81.2	1.1e-110
WP_001459282.1|3034214_3034832_-	hypothetical protein	NA	A0A2L1IV83	Escherichia_phage	98.0	3.7e-120
WP_000455633.1|3034837_3035116_-	outer membrane protein	NA	A0A2L1IV69	Escherichia_phage	100.0	2.6e-49
WP_000197188.1|3035130_3036399_-	host specificity protein J	NA	A0A2R2Z364	Escherichia_phage	99.8	1.4e-219
WP_001146321.1|3036395_3038021_-	hypothetical protein	NA	A0A1I9LJT3	Stx_converting_phage	99.4	0.0e+00
WP_001303606.1|3038315_3038504_-	hypothetical protein	NA	A0A2R2Z344	Escherichia_phage	100.0	6.9e-30
WP_001023407.1|3038642_3038912_-|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
WP_012816803.1|3038913_3040851_-|tail	tail fiber protein	tail	A0A1I9LJS9	Stx_converting_phage	99.3	3.1e-64
WP_000207922.1|3040847_3041498_-	hypothetical protein	NA	A0A0P0ZG46	Escherichia_phage	100.0	4.6e-121
WP_000829202.1|3041497_3042061_-	hypothetical protein	NA	A0A0P0ZGG2	Escherichia_phage	100.0	4.1e-102
WP_001371266.1|3042044_3042506_-	hypothetical protein	NA	V5URI4	Shigella_phage	99.3	7.8e-75
WP_001140444.1|3042555_3042945_-	hypothetical protein	NA	V5UT93	Shigella_phage	100.0	9.9e-63
WP_000214474.1|3042999_3044214_-|capsid	N4-gp56 family major capsid protein	capsid	A0A2R2Z358	Escherichia_phage	100.0	1.3e-233
WP_000345011.1|3044237_3045245_-	hypothetical protein	NA	Q08J90	Stx2-converting_phage	99.7	3.0e-180
WP_000787520.1|3045402_3047547_-|portal	portal protein	portal	A0A1U9AJF2	Stx1_converting_phage	100.0	0.0e+00
WP_000143988.1|3047546_3049253_-|terminase	terminase	terminase	A0A2R2Z350	Escherichia_phage	100.0	0.0e+00
WP_001086069.1|3049233_3050040_-|terminase	terminase	terminase	A0A2R2Z334	Escherichia_phage	100.0	7.6e-134
WP_001108577.1|3050332_3050884_-	Rha family transcriptional regulator	NA	A0A0P0ZFJ1	Escherichia_phage	99.5	8.4e-100
WP_012816804.1|3051122_3051308_-	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	85.2	4.0e-22
WP_000539792.1|3051535_3051682_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|3051681_3052251_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000087702.1|3052521_3053055_-	lysozyme	NA	A0A1I9LJR4	Stx_converting_phage	97.2	1.6e-100
WP_000284506.1|3053059_3053275_-|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_001290217.1|3053351_3053624_-	DUF826 domain-containing protein	NA	A0A0P0ZC09	Stx2-converting_phage	100.0	4.8e-24
WP_000142777.1|3053664_3053844_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	96.6	1.4e-24
WP_025404423.1|3053980_3055918_-	SASA family carbohydrate esterase	NA	A0A0P0ZGE0	Escherichia_phage	99.2	0.0e+00
WP_000738068.1|3056415_3056685_-	Shiga toxin Stx2a subunit B	NA	A0A2R2Z326	Escherichia_phage	100.0	1.2e-43
WP_000649753.1|3056696_3057656_-	Shiga toxin Stx2c subunit A	NA	Q776Q3	Enterobacteria_phage	100.0	5.6e-176
WP_001204859.1|3058439_3058874_-	antitermination protein	NA	A0A0P0ZGJ3	Escherichia_phage	100.0	4.8e-82
WP_000144767.1|3058866_3059061_-	protein ninH	NA	A0A0P0ZGE1	Escherichia_phage	100.0	8.4e-31
WP_000813671.1|3059057_3059621_-	recombination protein NinG	NA	A0A0P0ZG59	Escherichia_phage	100.0	8.9e-105
WP_000402092.1|3059628_3060078_-	DUF1367 family protein	NA	A0A0P0ZFW0	Escherichia_phage	100.0	7.6e-83
WP_001193567.1|3060077_3061049_-	DNA primase	NA	A0A2R2Z336	Escherichia_phage	100.0	1.4e-195
WP_000913119.1|3061038_3062559_-	DEAD/DEAH box helicase	NA	A0A2R2Z335	Escherichia_phage	100.0	6.4e-307
WP_001271433.1|3062552_3062930_-	hypothetical protein	NA	A0A2R2Z329	Escherichia_phage	100.0	4.0e-61
WP_000171145.1|3063453_3063693_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000162431.1|3063798_3064518_+	LexA family transcriptional regulator	NA	A0A2R2X2B0	Escherichia_phage	68.6	3.1e-86
WP_000939555.1|3064613_3066083_+	SAM-dependent methyltransferase	NA	A0A2R2Z316	Escherichia_phage	97.1	2.7e-278
WP_025404424.1|3066079_3067033_+	restriction endonuclease BsuBI	NA	A0A0P0ZG22	Escherichia_phage	97.8	3.6e-183
WP_000331648.1|3067213_3067684_+	DUF4065 domain-containing protein	NA	D0UIM3	Aggregatibacter_phage	41.6	5.4e-23
WP_001292087.1|3067683_3068064_+	hypothetical protein	NA	NA	NA	NA	NA
WP_113706115.1|3068681_3069467_+	hypothetical protein	NA	A0A0P0ZGC2	Escherichia_phage	96.2	2.0e-139
WP_024177061.1|3069821_3070043_+	hypothetical protein	NA	A0A0P0ZGC3	Escherichia_phage	98.6	3.2e-34
WP_000995345.1|3070063_3070345_+	host nuclease inhibitor GamL	NA	A0A0P0ZFG3	Escherichia_phage	100.0	1.1e-47
WP_000459721.1|3070361_3071312_+	recombinase RecT	NA	A0A0P0ZFY9	Escherichia_phage	100.0	1.1e-179
WP_000187063.1|3071308_3071998_+	YqaJ viral recombinase family protein	NA	A0A0P0ZFI7	Escherichia_phage	100.0	3.5e-135
WP_000344636.1|3071997_3072585_+	hypothetical protein	NA	A0A0N7KZV4	Escherichia_phage	99.5	2.0e-107
WP_001071603.1|3072659_3073007_+	hypothetical protein	NA	A0A0P0ZGH3	Escherichia_phage	100.0	5.9e-59
WP_000080417.1|3073070_3073892_+	YfdQ family protein	NA	A0A2R2Z323	Escherichia_phage	100.0	2.3e-149
WP_001159714.1|3073968_3074412_+	hypothetical protein	NA	A0A0H4IQ60	Shigella_phage	99.3	1.9e-78
WP_001453790.1|3074519_3075398_+	phosphoadenosine phosphosulfate reductase family protein	NA	A0A2R2Z314	Escherichia_phage	100.0	1.0e-179
WP_000157000.1|3075394_3075598_+	hypothetical protein	NA	A0A2R2Z313	Escherichia_phage	100.0	4.7e-32
WP_000476216.1|3075590_3075830_+	hypothetical protein	NA	A0A2R2Z309	Escherichia_phage	97.5	6.7e-38
WP_000036158.1|3075826_3076528_+	ead/Ea22-like family protein	NA	A0A0H4ISY5	Shigella_phage	100.0	1.7e-134
WP_000628769.1|3077041_3077995_+	DUF551 domain-containing protein	NA	A0A1U9AJ59	Stx1_converting_phage	55.0	2.0e-80
WP_000969523.1|3077991_3078252_+	hypothetical protein	NA	A0A1B1W289	Salmonella_phage	97.6	9.3e-41
WP_000609351.1|3078336_3079080_+	hypothetical protein	NA	A0A0P0ZD96	Stx2-converting_phage	99.1	2.8e-122
WP_000203819.1|3079403_3079691_+	phage antirepressor Ant	NA	V5URG2	Shigella_phage	97.9	3.9e-48
WP_000211520.1|3079940_3080570_+	phage antirepressor Ant	NA	G9L6G1	Escherichia_phage	100.0	2.3e-117
WP_000809302.1|3080625_3081057_+	hypothetical protein	NA	A0A2R2Z303	Escherichia_phage	100.0	7.3e-75
WP_000163448.1|3081053_3081680_+	adenine methylase	NA	G9L6F9	Escherichia_phage	100.0	1.8e-122
WP_001291843.1|3081639_3081852_+	DUF1382 family protein	NA	A0A0P0ZGA1	Escherichia_phage	100.0	7.1e-31
WP_000994795.1|3081887_3082277_+	DUF1627 domain-containing protein	NA	A0A0H4J3B1	Shigella_phage	100.0	2.1e-52
WP_000453637.1|3082355_3082538_+	helix-turn-helix domain-containing protein	NA	A0A2R2Z2X2	Escherichia_phage	100.0	4.1e-27
WP_001218304.1|3082521_3083691_-|integrase	integrase family protein	integrase	G3CFG6	Escherichia_phage	99.7	3.7e-230
3083887:3083910	attR	GTCCTCTTAGTTAAATGGATATAA	NA	NA	NA	NA
>prophage 13
NZ_CP007136	Escherichia coli O145:H28 str. RM12581 chromosome, complete genome	5585611	3315049	3395096	5585611	tRNA,holin,protease,portal,tail	Enterobacteria_phage(47.62%)	76	NA	NA
WP_001295363.1|3315049_3315787_-|tRNA	tRNA (adenosine(37)-N6)-methyltransferase TrmM	tRNA	NA	NA	NA	NA
WP_000219193.1|3315918_3317253_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
WP_025404428.1|3317285_3318167_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000189191.1|3318269_3318857_+	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000627804.1|3318912_3319296_-	autonomous glycyl radical cofactor GrcA	NA	A0A088FS37	Shigella_phage	70.9	4.7e-33
WP_001262720.1|3319600_3320290_+	uracil-DNA glycosylase	NA	A0A077BCN4	Equid_alphaherpesvirus	52.1	3.5e-55
WP_000997403.1|3320337_3321375_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001098726.1|3321581_3322001_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_024221634.1|3322069_3322768_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_000082991.1|3322799_3325460_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_000949265.1|3325573_3326929_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_000464869.1|3326953_3327298_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_001235102.1|3334369_3336943_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
WP_000040153.1|3337072_3337804_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_000079110.1|3337800_3338781_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000197686.1|3338915_3339653_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000178456.1|3339923_3340265_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_001386991.1|3340368_3340416_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000200122.1|3340514_3341675_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_000225204.1|3341717_3342839_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_001168045.1|3342849_3343920_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	4.0e-90
WP_000976004.1|3344129_3344495_+	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_001212383.1|3344644_3345163_+	YfiR family protein	NA	NA	NA	NA	NA
WP_000368157.1|3345155_3346379_+	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_000589825.1|3346394_3346877_+	OmpA family protein	NA	NA	NA	NA	NA
WP_000065253.1|3346953_3347301_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000264777.1|3347342_3348110_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000043335.1|3348140_3348689_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000256450.1|3348707_3348956_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000460035.1|3349092_3350454_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_001189257.1|3350545_3351412_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_032149952.1|3351432_3352719_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001296310.1|3352773_3353367_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001059169.1|3353488_3354367_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_000880920.1|3354452_3356114_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001203437.1|3356262_3356604_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001117838.1|3356665_3356956_-	RnfH family protein	NA	NA	NA	NA	NA
WP_000600190.1|3356945_3357422_-	type II toxin-antitoxin system toxin RatA	NA	NA	NA	NA	NA
WP_000162574.1|3357553_3358036_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_001217542.1|3358884_3359133_+	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_001121225.1|3359726_3360377_+	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	99.1	1.2e-121
WP_000491541.1|3360601_3361477_-	hypothetical protein	NA	A0A0P0ZCT1	Stx2-converting_phage	97.6	2.8e-158
WP_001023407.1|3361617_3361887_-|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
WP_025404429.1|3361888_3363202_-|tail	tail fiber protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.4	1.3e-77
WP_001230514.1|3363266_3363866_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.0	5.7e-110
WP_025404430.1|3363933_3367410_-	host specificity protein J	NA	Q687E8	Enterobacteria_phage	95.4	0.0e+00
WP_148294921.1|3367651_3368281_-|tail	tail assembly protein	tail	A0A0P0ZEN7	Stx2-converting_phage	91.9	9.9e-97
WP_025404434.1|3368979_3369678_-|tail	phage minor tail protein L	tail	A0A0P0ZD82	Stx2-converting_phage	97.8	8.9e-131
WP_000847298.1|3369677_3370007_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_025404435.1|3370003_3372649_-|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	95.7	0.0e+00
WP_000532075.1|3372692_3373001_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	99.0	3.0e-54
WP_000479061.1|3373027_3373450_-|tail	phage minor tail protein G	tail	S5MQJ3	Escherichia_phage	97.1	3.7e-71
WP_025404436.1|3373463_3374216_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	99.6	3.8e-135
WP_000682716.1|3374223_3374622_-|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
WP_000974966.1|3374634_3375258_-	hypothetical protein	NA	Q9EYD6	Enterobacteria_phage	100.0	6.6e-101
WP_001281350.1|3375260_3375542_-	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	97.8	3.9e-45
WP_001097065.1|3375534_3375861_-	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_001365078.1|3375948_3377928_-|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	98.9	0.0e+00
WP_000974567.1|3377917_3379420_-|portal	phage portal protein	portal	Q8VNN6	Enterobacteria_phage	99.8	1.2e-289
WP_000102415.1|3379419_3379632_-	hypothetical protein	NA	S5MBY8	Escherichia_phage	98.6	3.0e-29
WP_158414418.1|3381332_3381527_-	hypothetical protein	NA	Q8VNN7	Enterobacteria_phage	97.7	6.3e-18
WP_113706117.1|3381490_3381751_-	hypothetical protein	NA	Q9EYD1	Enterobacteria_phage	88.4	1.4e-36
WP_000373407.1|3381747_3382224_-	DUF1441 family protein	NA	Q8VNN8	Enterobacteria_phage	100.0	3.3e-84
WP_012816804.1|3382698_3382884_-	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	85.2	4.0e-22
WP_038426936.1|3383402_3383936_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	97.7	2.5e-101
WP_038426937.1|3384447_3385242_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	96.6	2.6e-41
WP_000284517.1|3385246_3385462_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_025404438.1|3385611_3387465_-	SASA family carbohydrate esterase	NA	H6WZJ9	Escherichia_phage	97.9	0.0e+00
WP_000499458.1|3387872_3388040_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_001302581.1|3388125_3388869_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001235472.1|3389121_3389745_-	antitermination protein	NA	K7PM87	Enterobacteria_phage	98.1	2.2e-112
WP_001028854.1|3389741_3390407_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_001108081.1|3390989_3391556_-	HNH endonuclease	NA	A0A1U9AJK5	Stx1_converting_phage	100.0	2.3e-108
WP_001505174.1|3392113_3393886_+	hypothetical protein	NA	A0A1U9AJG3	Stx1_converting_phage	99.5	0.0e+00
WP_001254222.1|3394389_3394572_-	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	100.0	1.9e-29
WP_000153262.1|3394568_3395096_-	phage N-6-adenine-methyltransferase	NA	Q8H9Z7	Enterobacteria_phage	99.4	3.6e-100
>prophage 14
NZ_CP007136	Escherichia coli O145:H28 str. RM12581 chromosome, complete genome	5585611	3691522	3702111	5585611	integrase	Enterobacteria_phage(88.89%)	12	3687083:3687095	3705265:3705277
3687083:3687095	attL	ACGATCCGCGCGT	NA	NA	NA	NA
WP_025404448.1|3691522_3693856_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	99.0	0.0e+00
WP_000856729.1|3693870_3694191_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_000459319.1|3694326_3694782_-	hypothetical protein	NA	Q7M298	Enterobacteria_phage	98.2	4.7e-64
WP_001244665.1|3694774_3695062_-	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	97.9	8.6e-48
WP_025404449.1|3695054_3695645_-	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	97.0	4.5e-67
WP_001149160.1|3695641_3695908_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
WP_001283035.1|3696459_3697194_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	99.2	2.7e-130
WP_000638631.1|3697190_3697691_+	transactivation protein	NA	NA	NA	NA	NA
WP_000446132.1|3697764_3698337_+	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	97.3	2.2e-95
WP_000611230.1|3698647_3699070_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000220867.1|3699066_3700938_-	DEAD/DEAH box helicase family protein	NA	A0A097BY72	Enterococcus_phage	21.7	5.3e-13
WP_001218984.1|3700947_3702111_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	88.9	2.9e-203
3705265:3705277	attR	ACGCGCGGATCGT	NA	NA	NA	NA
>prophage 15
NZ_CP007136	Escherichia coli O145:H28 str. RM12581 chromosome, complete genome	5585611	4080578	4141883	5585611	tRNA,transposase,protease	uncultured_Mediterranean_phage(20.0%)	52	NA	NA
WP_000366126.1|4080578_4081076_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	54.8	2.5e-26
WP_000257293.1|4081081_4081720_-	stringent starvation protein A	NA	NA	NA	NA	NA
WP_000829818.1|4082114_4082507_-	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_000847559.1|4082522_4082951_-	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_001192336.1|4083169_4084297_-	cell division protein ZapE	NA	NA	NA	NA	NA
WP_001295270.1|4084490_4084889_+	DUF1043 family protein	NA	NA	NA	NA	NA
WP_001295271.1|4085042_4086410_+|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.6	2.3e-21
WP_000497723.1|4086499_4087567_+	outer membrane-stress sensor serine endopeptidase DegS	NA	A0A1S5Y2X3	uncultured_archaeal_virus	24.2	6.8e-05
WP_001295272.1|4087629_4088568_-	malate dehydrogenase	NA	NA	NA	NA	NA
WP_001257846.1|4089002_4089473_+	transcriptional regulator ArgR	NA	NA	NA	NA	NA
WP_000695688.1|4089837_4090101_+	peroxide/acid stress response protein YhcN	NA	NA	NA	NA	NA
WP_001029006.1|4090156_4090429_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000510962.1|4090520_4092488_-	p-hydroxybenzoic acid efflux pump subunit AaeB	NA	NA	NA	NA	NA
WP_000854033.1|4092493_4093426_-	p-hydroxybenzoic acid efflux pump subunit AaeA	NA	NA	NA	NA	NA
WP_000051841.1|4093433_4093637_-	AaeX family protein	NA	NA	NA	NA	NA
WP_025404463.1|4093819_4094749_+	HTH-type transcriptional activator AaeR	NA	NA	NA	NA	NA
WP_000055909.1|4094876_4096322_-|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_001253607.1|4096477_4100278_-	AsmA2 domain-containing protein	NA	NA	NA	NA	NA
WP_000123197.1|4100345_4101815_-	ribonuclease G	NA	NA	NA	NA	NA
WP_000203108.1|4101804_4102398_-	nucleoside triphosphate pyrophosphatase YhdE	NA	NA	NA	NA	NA
WP_000179409.1|4102406_4102895_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_000802515.1|4102894_4103998_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_000913396.1|4104063_4105107_-	rod shape-determining protein MreB	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
WP_001241422.1|4105411_4107352_-	RNase E specificity factor CsrD	NA	NA	NA	NA	NA
WP_001148476.1|4107503_4108478_+	oxidoreductase	NA	NA	NA	NA	NA
WP_000838308.1|4108514_4109345_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000354622.1|4110210_4110681_+	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_000884639.1|4110691_4112041_+	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_000381170.1|4112149_4112392_+	YhdT family protein	NA	NA	NA	NA	NA
WP_001175715.1|4112381_4113833_+	sodium/pantothenate symporter	NA	NA	NA	NA	NA
WP_001145827.1|4113844_4114726_+	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_001219652.1|4115054_4116020_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_000462905.1|4116045_4116342_+	DNA-binding transcriptional regulator Fis	NA	NA	NA	NA	NA
WP_001258919.1|4116427_4117312_+	adenine-specific DNA-methyltransferase	NA	M4QNN5	Ostreococcus_lucimarinus_virus	30.5	4.9e-25
WP_001295275.1|4117395_4117575_+	DUF2556 family protein	NA	NA	NA	NA	NA
WP_001129518.1|4117577_4118240_-	multidrug efflux transporter transcriptional repressor AcrS	NA	NA	NA	NA	NA
WP_000160334.1|4118638_4119796_+	multidrug efflux RND transporter periplasmic adaptor subunit AcrE	NA	NA	NA	NA	NA
WP_113706119.1|4119865_4121078_-|transposase	IS3-like element IS629 family transposase	transposase	Q6H9S3	Enterobacteria_phage	100.0	2.2e-169
WP_000825639.1|4121579_4121801_-	membrane protein	NA	NA	NA	NA	NA
WP_032162153.1|4122053_4125146_-	multidrug efflux RND transporter permease subunit AcrF	NA	NA	NA	NA	NA
WP_113706120.1|4125199_4126412_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.0	9.3e-168
WP_029594386.1|4126451_4127462_+	amino acid ABC transporter substrate-binding protein	NA	A0A1B1IT51	uncultured_Mediterranean_phage	39.7	1.4e-71
WP_000019655.1|4127529_4128711_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_001301413.1|4128720_4129824_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_000078340.1|4129831_4130590_+	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	9.1e-20
WP_022581407.1|4136473_4137028_+	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_001070559.1|4137003_4137261_-	DUF1488 domain-containing protein	NA	NA	NA	NA	NA
WP_000451242.1|4137257_4138076_-	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_001301437.1|4138080_4138653_-	L-threonylcarbamoyladenylate synthase type 1 TsaC	NA	NA	NA	NA	NA
WP_001129723.1|4138657_4139200_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000460670.1|4139228_4139702_-	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_085947970.1|4140669_4141883_-|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	100.0	2.9e-169
>prophage 16
NZ_CP007136	Escherichia coli O145:H28 str. RM12581 chromosome, complete genome	5585611	4559025	4569417	5585611	integrase	Enterobacteria_phage(100.0%)	11	4552411:4552423	4564152:4564164
4552411:4552423	attL	AACGCCTGAAAGG	NA	NA	NA	NA
WP_001218986.1|4559025_4560201_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	93.0	1.3e-211
WP_000503665.1|4560205_4561114_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000446137.1|4562593_4563166_-	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	96.8	3.8e-95
WP_000638631.1|4563239_4563740_-	transactivation protein	NA	NA	NA	NA	NA
WP_001283035.1|4563736_4564471_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	99.2	2.7e-130
4564152:4564164	attR	CCTTTCAGGCGTT	NA	NA	NA	NA
WP_001149160.1|4565022_4565289_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
WP_025404478.1|4565285_4565885_+	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	89.1	3.0e-58
WP_001244665.1|4565877_4566165_+	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	97.9	8.6e-48
WP_000459319.1|4566157_4566613_+	hypothetical protein	NA	Q7M298	Enterobacteria_phage	98.2	4.7e-64
WP_000856729.1|4566748_4567069_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_025404479.1|4567083_4569417_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	98.7	0.0e+00
>prophage 17
NZ_CP007136	Escherichia coli O145:H28 str. RM12581 chromosome, complete genome	5585611	4838965	4922937	5585611	capsid,tRNA,plate,holin,lysis,portal,protease,head,tail,integrase,terminase	Escherichia_phage(35.56%)	90	4871780:4871826	4905462:4905508
WP_000560983.1|4838965_4839403_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_001343389.1|4839447_4840389_+	fatty acid biosynthesis protein FabY	NA	NA	NA	NA	NA
WP_001295676.1|4843289_4843508_+	CopG family transcriptional regulator	NA	NA	NA	NA	NA
WP_001086385.1|4843724_4843967_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000027708.1|4844296_4845226_-	formate dehydrogenase accessory protein FdhE	NA	NA	NA	NA	NA
WP_025404487.1|4845222_4845858_-	formate dehydrogenase cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_000331377.1|4845854_4846757_-	formate dehydrogenase O subunit beta	NA	NA	NA	NA	NA
WP_077697102.1|4846769_4849820_-	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	23.8	1.1e-07
WP_025404488.1|4850013_4850847_+	formate dehydrogenase accessory sulfurtransferase FdhD	NA	NA	NA	NA	NA
WP_001400645.1|4850999_4852055_+	YiiG family protein	NA	NA	NA	NA	NA
WP_000931324.1|4852104_4853853_-	PTS transporter subunit EIIA	NA	NA	NA	NA	NA
WP_001019458.1|4853852_4854923_-	aminopeptidase	NA	NA	NA	NA	NA
WP_025404489.1|4854912_4856364_-	PTS fructose-like transporter subunit IIBC	NA	NA	NA	NA	NA
WP_000729614.1|4856374_4856821_-	PTS fructose transporter subunit IIA	NA	NA	NA	NA	NA
WP_000749945.1|4857298_4858693_+	carbohydrate porin	NA	NA	NA	NA	NA
WP_000619508.1|4858733_4859048_-	L-rhamnose mutarotase	NA	NA	NA	NA	NA
WP_001179715.1|4859057_4859882_-	rhamnulose-1-phosphate aldolase	NA	NA	NA	NA	NA
WP_000211504.1|4860148_4861408_-	L-rhamnose isomerase	NA	NA	NA	NA	NA
WP_000144078.1|4861404_4862874_-	rhamnulokinase	NA	NA	NA	NA	NA
WP_000217141.1|4863161_4863998_+	HTH-type transcriptional activator RhaS	NA	NA	NA	NA	NA
WP_001362440.1|4863981_4864920_+	HTH-type transcriptional activator RhaR	NA	NA	NA	NA	NA
WP_000063507.1|4864916_4865951_-	L-rhamnose/proton symporter RhaT	NA	NA	NA	NA	NA
WP_001297064.1|4866235_4866856_+	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	59.8	4.9e-64
WP_022581810.1|4867115_4868099_+	2-keto-3-deoxygluconate transporter	NA	NA	NA	NA	NA
WP_001270249.1|4868247_4868922_+	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_000580424.1|4869037_4870411_-	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	26.2	3.8e-16
WP_001033722.1|4870407_4871106_-	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_001223800.1|4871255_4871756_+	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
4871780:4871826	attL	GACACCATCCCTGTCTTCCCCCACATGATGTGGGGGTTTTTTTTATC	NA	NA	NA	NA
WP_000023384.1|4871941_4872922_-|integrase	tyrosine-type recombinase/integrase	integrase	U5N0A8	Enterobacteria_phage	100.0	4.7e-186
WP_001192857.1|4872991_4873285_-	helix-turn-helix domain-containing protein	NA	Q1JS45	Enterobacteria_phage	100.0	1.0e-48
WP_000453534.1|4873437_4873710_+	hypothetical protein	NA	Q1JS44	Enterobacteria_phage	100.0	1.5e-46
WP_000217670.1|4873879_4874380_+	hypothetical protein	NA	M1SV55	Escherichia_phage	100.0	2.6e-92
WP_000557703.1|4874443_4874668_+	DUF2732 family protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
WP_001277898.1|4874667_4874967_+	DUF5405 family protein	NA	S4TUD1	Salmonella_phage	99.0	3.2e-45
WP_001113264.1|4874969_4875194_+	TraR/DksA family transcriptional regulator	NA	S4TRY6	Salmonella_phage	100.0	2.9e-35
WP_000027676.1|4875190_4875466_+	DUF5405 family protein	NA	U5N3W1	Enterobacteria_phage	98.9	8.6e-45
WP_000268590.1|4875455_4877762_+	replication endonuclease	NA	Q858T4	Yersinia_virus	97.4	0.0e+00
WP_029594353.1|4877740_4878193_+	DUF3850 domain-containing protein	NA	Q2P9X4	Enterobacteria_phage	96.0	3.0e-79
WP_001540306.1|4878677_4879616_+	DNA cytosine methyltransferase	NA	Q7Y4B5	Escherichia_virus	97.8	7.2e-184
WP_000688782.1|4879616_4880609_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000140373.1|4880595_4881714_-	ParB N-terminal domain-containing protein	NA	Q858T2	Yersinia_virus	99.7	5.8e-172
WP_000038178.1|4882089_4883124_-|portal	phage portal protein	portal	Q858W8	Yersinia_virus	99.4	9.3e-201
WP_000156875.1|4883123_4884896_-|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	99.8	0.0e+00
WP_001085958.1|4885069_4885924_+|capsid	GPO family capsid scaffolding protein	capsid	Q94MB7	Escherichia_virus	89.8	3.4e-140
WP_001248561.1|4885982_4887056_+|capsid	phage major capsid protein, P2 family	capsid	Q778Y7	Enterobacteria_phage	99.7	1.5e-201
WP_000203465.1|4887059_4887803_+|terminase	terminase endonuclease subunit	terminase	Q858W5	Yersinia_virus	97.2	1.9e-123
WP_000988633.1|4887902_4888412_+|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_000846409.1|4888411_4888615_+|tail	tail protein X	tail	A0A0F7LCN2	Escherichia_phage	100.0	3.0e-31
WP_000123124.1|4888618_4888900_+|holin	holin	holin	A0A0F7LDF8	Escherichia_phage	100.0	3.7e-43
WP_001144101.1|4888899_4889397_+	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_000736594.1|4889411_4889837_+	protein lysA	NA	A0A0F7LBP4	Escherichia_phage	96.5	2.5e-59
WP_000040677.1|4889824_4890268_+|lysis	LysB family phage lysis regulatory protein	lysis	U5N3W5	Enterobacteria_phage	95.0	4.1e-65
WP_000917157.1|4890357_4890825_+|tail	phage tail protein	tail	U5N0S7	Enterobacteria_phage	97.4	3.3e-81
WP_001001792.1|4890817_4891270_+	phage virion morphogenesis protein	NA	A0A0F7LDR6	Escherichia_phage	98.7	9.1e-76
WP_000255497.1|4891341_4892127_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001093705.1|4892210_4892846_+|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	99.5	1.2e-113
WP_000127173.1|4892842_4893190_+|plate	baseplate assembly protein W	plate	A0A0F7L9X3	Escherichia_phage	99.1	8.5e-58
WP_001121506.1|4893194_4894103_+|plate	baseplate assembly protein	plate	U5N3T9	Enterobacteria_phage	99.0	4.8e-161
WP_001285314.1|4894095_4894626_+|tail	phage tail protein I	tail	A0A0F7LDF3	Escherichia_phage	100.0	1.0e-102
WP_000104679.1|4894636_4896565_+	hypothetical protein	NA	U5N099	Enterobacteria_phage	71.2	6.6e-224
WP_000930007.1|4896533_4897097_+|tail	tail fiber assembly protein	tail	Q858V3	Yersinia_virus	93.6	1.9e-86
WP_000796111.1|4897348_4898416_-	SMEK domain-containing protein	NA	NA	NA	NA	NA
WP_001286678.1|4898749_4899940_+|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.2	2.6e-223
WP_001251408.1|4899952_4900471_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001031303.1|4900527_4900803_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_000785970.1|4900835_4900955_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_000069943.1|4900947_4903395_+|tail	phage tail tape measure protein	tail	Q858U7	Yersinia_virus	95.2	0.0e+00
WP_000978881.1|4903409_4903889_+|tail	phage tail protein	tail	O64315	Escherichia_phage	98.7	4.3e-84
WP_000887624.1|4903888_4905052_+	phage late control D family protein	NA	Q858U5	Yersinia_virus	98.7	2.0e-204
WP_000468308.1|4905132_4905351_+	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_001076742.1|4905586_4906489_+	CDF family cation-efflux transporter FieF	NA	NA	NA	NA	NA
4905462:4905508	attR	GACACCATCCCTGTCTTCCCCCACATGATGTGGGGGTTTTTTTTATC	NA	NA	NA	NA
WP_000591795.1|4906669_4907632_+	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_001045689.1|4907950_4908940_+	sulfate/thiosulfate ABC transporter substrate-binding protein Sbp	NA	NA	NA	NA	NA
WP_000708998.1|4909046_4909802_+	CDP-diacylglycerol diphosphatase	NA	NA	NA	NA	NA
WP_001216325.1|4909856_4910624_-	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_000802226.1|4910731_4911331_-	YiiQ family protein	NA	NA	NA	NA	NA
WP_000155257.1|4911431_4911872_+	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_000655983.1|4912083_4912383_+	DUF406 domain-containing protein	NA	NA	NA	NA	NA
WP_000323555.1|4912409_4912838_+	universal stress protein UspD	NA	NA	NA	NA	NA
WP_000796310.1|4912842_4913589_-	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
WP_001250650.1|4913685_4914696_-	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_000136788.1|4914925_4916434_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_000084268.1|4916456_4917302_-	glycerol uptake facilitator protein GlpF	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	4.4e-15
WP_001296623.1|4917727_4917973_+	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000232687.1|4918011_4918638_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024221530.1|4918760_4919435_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000872908.1|4919494_4919980_-	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_001308187.1|4920072_4920999_-	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_001293341.1|4921065_4922397_-	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.9	1.7e-45
WP_000208242.1|4922406_4922937_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
>prophage 18
NZ_CP007136	Escherichia coli O145:H28 str. RM12581 chromosome, complete genome	5585611	5073673	5124116	5585611	capsid,tRNA,holin,head,tail,integrase,terminase,transposase	Enterobacteria_phage(33.96%)	58	5080409:5080423	5121299:5121313
WP_000956557.1|5073673_5074207_+	hypothetical protein	NA	K7PKJ4	Enterobacteria_phage	100.0	1.1e-99
WP_001093917.1|5074624_5074906_-	hypothetical protein	NA	K7PGU0	Enterobacteria_phage	96.8	2.8e-43
WP_001061344.1|5074942_5075515_-	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	98.9	3.5e-109
WP_000145667.1|5075818_5076307_-	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	76.2	1.1e-66
WP_001242734.1|5076303_5076825_-	hypothetical protein	NA	A0A0P0ZFU9	Escherichia_phage	91.0	3.5e-63
WP_000336726.1|5077296_5078115_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.2	1.2e-65
WP_000088311.1|5078150_5078453_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_000081283.1|5078747_5079572_-	DUF2303 family protein	NA	U5P439	Shigella_phage	99.6	3.9e-149
WP_000135681.1|5079637_5080000_-	hypothetical protein	NA	Q8SBF8	Shigella_phage	99.2	7.3e-60
5080409:5080423	attL	ATCGCCGCGCTGGTT	NA	NA	NA	NA
WP_000859462.1|5080666_5081341_-	LexA family transcriptional repressor	NA	Q8SBF6	Shigella_phage	100.0	1.2e-132
WP_000649477.1|5081431_5081632_+	transcriptional regulator	NA	U5P445	Shigella_phage	100.0	7.9e-32
WP_000521508.1|5081675_5082227_+	hypothetical protein	NA	A0A291AWW8	Escherichia_phage	100.0	4.5e-101
WP_001087342.1|5082223_5083375_+	peptidase	NA	K7PLX4	Enterobacteria_phage	96.3	6.9e-205
WP_000620696.1|5083371_5083596_+	hypothetical protein	NA	A5LH70	Enterobacteria_phage	100.0	5.7e-39
WP_000061518.1|5083592_5084411_+	helix-turn-helix domain-containing protein	NA	A0A291AWW0	Escherichia_phage	99.3	1.1e-122
WP_001447903.1|5084407_5084902_+	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	96.3	1.3e-83
WP_001341555.1|5084901_5085555_+	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.1	3.3e-127
WP_000210170.1|5085551_5085878_+	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	100.0	5.4e-54
WP_023277891.1|5085874_5086264_+	RusA family crossover junction endodeoxyribonuclease	NA	A5LH74	Enterobacteria_phage	98.4	7.8e-68
WP_025404492.1|5086283_5087093_+	KilA-N domain-containing protein	NA	Q8SBE6	Shigella_phage	97.4	1.3e-149
WP_001428967.1|5087100_5088090_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	98.8	1.2e-192
WP_001047129.1|5088103_5088856_+	antitermination protein	NA	K7PGU5	Enterobacteria_phage	98.8	7.6e-136
WP_001339373.1|5089165_5089318_+	restriction endonuclease subunit M	NA	A0A2R2Z327	Escherichia_phage	98.0	3.4e-19
WP_025404493.1|5090135_5091986_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	97.6	0.0e+00
WP_000411802.1|5092431_5092638_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.4e-31
WP_000075132.1|5092637_5093135_+	lysozyme RrrD	NA	A0A0N7KZA0	Stx2-converting_phage	100.0	2.6e-92
WP_001208681.1|5093351_5093537_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	78.7	2.9e-20
WP_001303878.1|5094064_5094379_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_032321890.1|5094460_5094685_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	90.6	7.8e-20
WP_000279796.1|5094726_5095092_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	100.0	3.1e-66
WP_025404316.1|5095387_5095951_+|terminase	terminase small subunit	terminase	B6DZ97	Enterobacteria_phage	93.0	1.4e-81
WP_025404494.1|5095947_5097294_+|terminase	terminase large subunit	terminase	H6WZK9	Escherichia_phage	79.4	2.5e-246
WP_025404495.1|5097357_5099295_+|capsid	phage major capsid protein	capsid	A0A0P0ZCT9	Stx2-converting_phage	98.6	0.0e+00
WP_001063027.1|5099339_5099561_+	hypothetical protein	NA	H6WZL1	Escherichia_phage	98.6	9.9e-36
WP_000125968.1|5101925_5102252_+|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	98.1	2.7e-53
WP_001007905.1|5102262_5102613_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573374.1|5102609_5103056_+	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_000133391.1|5103052_5103397_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	99.1	9.4e-57
WP_001275505.1|5103455_5104172_+	hypothetical protein	NA	A0A0P0ZD29	Stx2-converting_phage	97.5	5.2e-126
WP_001030047.1|5104177_5104552_+|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	92.7	5.8e-60
WP_122994012.1|5104647_5104857_+	DUF4035 domain-containing protein	NA	A0A0P0ZED8	Stx2-converting_phage	98.6	7.4e-33
WP_025404497.1|5104904_5108147_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	96.9	0.0e+00
WP_000807964.1|5108139_5108481_+|tail	phage tail protein	tail	A0A0P0ZCS8	Stx2-converting_phage	100.0	8.7e-63
WP_025404498.1|5108480_5109179_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.3	8.9e-131
WP_025404499.1|5109184_5109928_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	96.0	2.1e-146
WP_064761467.1|5109873_5110503_+|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	98.6	1.2e-102
WP_113706121.1|5112250_5113735_+	host specificity protein J	NA	Q6H9T2	Enterobacteria_phage	96.8	2.4e-266
WP_001216290.1|5113803_5114427_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1U8QHD6	Enterobacteria_phage	60.4	1.1e-68
WP_025404500.1|5114491_5115805_+|tail	tail fiber protein	tail	Q9EYE8	Enterobacteria_phage	98.9	6.9e-76
WP_001023407.1|5115806_5116076_+|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
WP_001370116.1|5116485_5117091_+	hypothetical protein	NA	A0A0P0ZCT1	Stx2-converting_phage	99.5	1.8e-111
WP_001121225.1|5117315_5117966_-	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	99.1	1.2e-121
WP_001217539.1|5118559_5118808_-	DinI family protein	NA	A5LH55	Enterobacteria_phage	100.0	1.1e-38
WP_000332271.1|5118869_5119967_-|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	99.7	9.5e-212
WP_025404501.1|5120055_5121093_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_000891400.1|5121226_5121469_+	envelope stress response protein PspG	NA	NA	NA	NA	NA
5121299:5121313	attR	ATCGCCGCGCTGGTT	NA	NA	NA	NA
WP_000235513.1|5121634_5122618_-	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_000918363.1|5122700_5124116_+	replicative DNA helicase	NA	O80281	Escherichia_phage	78.3	4.8e-200
>prophage 19
NZ_CP007136	Escherichia coli O145:H28 str. RM12581 chromosome, complete genome	5585611	5520926	5553372	5585611	protease,portal,tail,integrase,terminase	Enterobacteria_phage(67.86%)	31	5520128:5520142	5533058:5533072
5520128:5520142	attL	GCGATGGCGGAAATC	NA	NA	NA	NA
WP_001218292.1|5520926_5522150_+|integrase	site-specific integrase	integrase	A0A291AWU1	Escherichia_phage	98.5	1.2e-234
WP_000059336.1|5522250_5522703_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000542348.1|5522744_5523227_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024221786.1|5523516_5524113_-	DUF551 domain-containing protein	NA	A5LH60	Enterobacteria_phage	93.4	6.1e-112
WP_000934114.1|5525641_5527744_+|terminase	phage terminase large subunit family protein	terminase	K7PH40	Enterobacteria_phage	99.6	0.0e+00
WP_001072975.1|5527740_5527953_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_000985947.1|5527952_5529461_+|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	99.8	1.6e-289
WP_001136588.1|5529405_5531433_+|protease	Clp protease ClpP	protease	K7PGT6	Enterobacteria_phage	99.7	0.0e+00
WP_001097042.1|5531519_5531843_+	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	98.1	3.2e-51
WP_001283153.1|5531835_5532111_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_000677102.1|5532122_5532701_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.5	1.2e-101
WP_024221681.1|5532697_5533099_+|tail	tail protein	tail	A0A291AWY2	Escherichia_phage	98.5	5.4e-72
5533058:5533072	attR	GCGATGGCGGAAATC	NA	NA	NA	NA
WP_000211121.1|5533109_5533853_+|tail	tail protein	tail	A5LH35	Enterobacteria_phage	100.0	1.6e-133
WP_025404521.1|5533913_5534300_+|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	99.2	2.1e-65
WP_001161009.1|5534308_5534638_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_000372002.1|5534609_5537675_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	97.0	0.0e+00
WP_000447248.1|5537674_5538004_+|tail	phage tail protein	tail	A0A291AWW9	Escherichia_phage	100.0	1.7e-60
WP_001152362.1|5538013_5538712_+|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	97.8	1.6e-132
WP_038427005.1|5538716_5539460_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	98.8	6.3e-151
WP_025380703.1|5539357_5540005_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	97.2	1.5e-111
WP_025380704.1|5540065_5543464_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	90.7	0.0e+00
WP_021530825.1|5543530_5544130_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	98.0	2.8e-109
WP_038427007.1|5544194_5547548_+	short-chain fatty acid transporter	NA	X2KTY7	Enterobacteria_phage	37.3	2.1e-12
WP_000885593.1|5547547_5548123_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.8	5.0e-103
WP_000086527.1|5548220_5548811_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000836769.1|5549189_5549423_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	6.4e-33
WP_001372053.1|5549491_5549605_-	hypothetical protein	NA	A0A1C9IHU6	Salmonella_phage	77.8	1.4e-06
WP_001217539.1|5550031_5550280_-	DinI family protein	NA	A5LH55	Enterobacteria_phage	100.0	1.1e-38
WP_000202563.1|5550499_5552086_+	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	25.2	2.4e-30
WP_001295748.1|5552478_5553084_+	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_000490275.1|5553210_5553372_+	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	1.8e-10
>prophage 1
NZ_CP007138	Escherichia coli O145:H28 str. RM12581 plasmid pO145-12581, complete sequence	87120	7319	78610	87120	protease,integrase,transposase	Stx2-converting_phage(41.38%)	65	4431:4445	85285:85299
4431:4445	attL	TTGCAGCTGTTGTCG	NA	NA	NA	NA
WP_012917688.1|7319_8858_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	98.8	1.9e-295
WP_000612591.1|8907_9255_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000091308.1|9491_9857_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000937603.1|9856_11044_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_012917687.1|11322_12891_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	56.0	1.0e-158
WP_000631725.1|12894_13242_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.9	9.2e-44
WP_025404525.1|13238_13913_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	4.7e-12
WP_001341442.1|13966_14194_-|transposase	transposase	transposase	B6DZU5	Stx2-converting_phage	100.0	6.2e-33
WP_000361610.1|14356_15334_-	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	59.2	1.4e-100
WP_113706123.1|16139_17352_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	98.3	1.3e-166
WP_032162148.1|17392_17590_-	hypothetical protein	NA	Q7Y2I5	Escherichia_phage	93.8	6.4e-26
WP_001130313.1|17583_17832_+|transposase	IS3 family transposase	transposase	A0A0N7C035	Escherichia_phage	87.9	5.6e-27
WP_001341451.1|17816_18041_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	91.4	2.7e-28
WP_000445934.1|18105_18501_-	plasmid stabilization protein	NA	NA	NA	NA	NA
WP_000921957.1|18500_19460_-	plasmid stabilization protein	NA	A0A222YXF2	Escherichia_phage	40.9	5.4e-62
WP_077249722.1|19732_20635_+	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_012680995.1|20631_20943_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000086167.1|21018_21702_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	37.4	1.3e-28
WP_001443814.1|21701_21920_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000274418.1|21931_22366_+	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_001341455.1|22410_22893_+	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_001276261.1|22889_23609_+	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_032313270.1|23885_24203_+	hypothetical protein	NA	A0A0N7KZV3	Escherichia_phage	55.8	4.5e-05
WP_000117628.1|24664_25165_+	antirestriction protein ArdA	NA	NA	NA	NA	NA
WP_162137195.1|25166_25787_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000218854.1|25892_26327_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001247865.1|26419_26686_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000038351.1|26750_27641_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	53.8	4.4e-66
WP_077776889.1|27664_27886_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000148286.1|27916_28168_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001341408.1|28746_29595_+	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_000157095.1|29680_30016_-	molybdopterin-guanine dinucleotide biosynthesis protein MobC	NA	NA	NA	NA	NA
WP_001291056.1|30247_30580_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000991402.1|30591_33312_+	relaxase/mobilization nuclease domain-containing protein	NA	NA	NA	NA	NA
WP_001341409.1|33532_33853_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000088311.1|33891_34194_+|transposase	transposase	transposase	Q716C1	Shigella_phage	31.3	1.1e-05
WP_113706124.1|34620_35834_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	97.3	1.6e-164
WP_136138333.1|35832_36246_+	DUF1449 family protein	NA	NA	NA	NA	NA
WP_000112000.1|36544_36802_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001034100.1|37049_40952_-|protease	serine protease autotransporter EspP	protease	Q9LA58	Enterobacterial_phage	40.4	9.5e-238
WP_136139077.1|41889_42309_-	DUF1449 family protein	NA	NA	NA	NA	NA
WP_001341423.1|42239_42914_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	4.7e-12
WP_000631725.1|42910_43258_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.9	9.2e-44
WP_012917687.1|43261_44830_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	56.0	1.0e-158
WP_000091308.1|45653_46019_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000937603.1|46018_47206_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000422675.1|51200_51677_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	90.7	3.0e-45
WP_001443774.1|54803_55034_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000581688.1|55148_64649_+	toxin B	NA	NA	NA	NA	NA
WP_000907857.1|65608_66640_-	replication initiation protein	NA	NA	NA	NA	NA
WP_000335839.1|67348_67990_+	transcription termination factor NusG	NA	NA	NA	NA	NA
WP_025404528.1|68130_68796_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012917687.1|69455_71024_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	56.0	1.0e-158
WP_000631725.1|71027_71375_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.9	9.2e-44
WP_001341423.1|71371_72046_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	4.7e-12
WP_001066949.1|72099_72486_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_000704534.1|72613_73474_+	alpha/beta hydrolase	NA	A2RQC8	Archaeal_BJ1_virus	23.5	1.3e-09
WP_157776129.1|73962_74238_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000336726.1|74278_75097_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.2	1.2e-65
WP_000088311.1|75132_75435_-|transposase	transposase	transposase	Q716C1	Shigella_phage	31.3	1.1e-05
WP_001165114.1|75502_76048_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001044768.1|76209_76626_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_001261287.1|76622_76853_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_000465041.1|77412_77826_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001164205.1|77827_78610_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	97.3	1.2e-54
85285:85299	attR	TTGCAGCTGTTGTCG	NA	NA	NA	NA
>prophage 1
NZ_CP007137	Escherichia coli O145:H28 str. RM12581 plasmid pRM12581, complete sequence	64562	3207	45831	64562	transposase,integrase	Escherichia_phage(37.5%)	48	6222:6241	28423:28442
WP_113706617.1|3207_4420_+|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	99.0	4.2e-168
WP_025404531.1|4395_4833_-	hypothetical protein	NA	A0A0N7C1Y0	Escherichia_phage	72.4	3.9e-07
WP_000790610.1|4843_5377_-	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_000356489.1|5376_5649_-	nucleotide excision repair protein	NA	A0A2H4J3B6	uncultured_Caudovirales_phage	41.0	1.3e-08
6222:6241	attL	ACTTTCACATGTGAAAGTTT	NA	NA	NA	NA
WP_000683483.1|6364_6727_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000534551.1|6764_10379_-	conjugal transfer protein TraG	NA	NA	NA	NA	NA
WP_000256129.1|10391_11825_-	conjugal transfer protein TraH	NA	NA	NA	NA	NA
WP_113706618.1|12679_13893_-|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	99.3	2.7e-167
WP_000811656.1|14291_15803_-	ATP-dependent helicase	NA	A0A2D1GN12	Pseudoalteromonas_phage	30.7	3.6e-44
WP_000101568.1|16089_17130_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_001097010.1|17291_18167_-	DNA replication terminus site-binding protein	NA	NA	NA	NA	NA
WP_162149453.1|18316_18478_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000139717.1|18523_19015_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012728230.1|19011_19881_-	3'-5' exonuclease	NA	A0A1S6L012	Salmonella_phage	35.1	3.5e-23
WP_000543934.1|19885_20896_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0K0N6I5	Gordonia_phage	31.9	3.1e-07
WP_000949433.1|20898_21435_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000575657.1|21733_22015_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067858.1|22612_23317_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_000268552.1|23536_24193_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000936897.1|24192_25620_-	DNA cytosine methyltransferase	NA	NA	NA	NA	NA
WP_000647188.1|25623_26124_-	hypothetical protein	NA	I3UMJ0	Colwellia_phage	38.4	9.5e-18
WP_001447539.1|26132_26444_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001326170.1|26449_26881_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000344149.1|26948_27623_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014342216.1|27609_27729_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001125904.1|27871_28249_-	hypothetical protein	NA	A0A2H4P7P5	Pseudomonas_phage	49.6	1.7e-22
WP_000939033.1|28575_28719_+	hypothetical protein	NA	NA	NA	NA	NA
28423:28442	attR	ACTTTCACATGTGAAAGTTT	NA	NA	NA	NA
WP_000074431.1|28810_29446_+	N-6 DNA methylase	NA	NA	NA	NA	NA
WP_000703827.1|29498_29771_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001207227.1|29819_31001_-	ParB/RepB/Spo0J family partition protein	NA	I3NLC2	Bifidobacterium_phage	28.7	2.4e-11
WP_001151304.1|31004_31790_-	ParA family protein	NA	A0A1X9IGI7	Lactococcus_phage	26.4	6.1e-11
WP_014342215.1|31817_31949_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000338945.1|31963_32275_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001043260.1|32581_33397_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
WP_001082319.1|33457_34261_+	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
WP_000480968.1|34260_35097_+	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_000844627.1|35402_35645_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000164043.1|35676_36327_-	tetracycline resistance transcriptional repressor TetR(A)	NA	NA	NA	NA	NA
WP_000804063.1|36432_37632_+	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
WP_001255015.1|37898_38204_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012728216.1|38231_39446_-	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.7	5.5e-19
WP_012728215.1|39662_40547_-	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
WP_001120888.1|40577_42071_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000743213.1|42281_42506_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001366550.1|42502_43240_-	recombinase family protein	NA	NA	NA	NA	NA
WP_001044210.1|43725_43866_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|43871_44576_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001067855.1|45126_45831_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
