The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	0	10750	5099034	integrase	Salmonella_phage(81.82%)	13	172:184	8216:8228
172:184	attL	ACAACATCAGGAA	NA	NA	NA	NA
WP_038632775.1|454_1309_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	90.5	4.4e-148
WP_000752619.1|1305_1533_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	98.7	3.5e-36
WP_001244233.1|1532_1766_-	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	94.8	1.6e-31
WP_000996720.1|1833_2175_-	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	96.5	1.1e-54
WP_000956192.1|2292_2589_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	88.5	1.9e-21
WP_000460856.1|2596_3106_-	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	95.3	1.3e-83
WP_000102105.1|3138_3381_-	Rha family transcriptional regulator	NA	A0A1S6KZZ6	Salmonella_phage	97.5	6.8e-38
WP_000582125.1|3500_4133_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	89.0	1.3e-104
WP_000155495.1|4134_5151_+|integrase	site-specific integrase	integrase	E5G6L0	Salmonella_phage	93.7	2.0e-187
WP_051594477.1|5156_6218_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038632796.1|6748_7543_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038632799.1|7950_8499_+	AAA family ATPase	NA	A0A219VHB7	Ochrobactrum_phage	57.0	1.4e-22
8216:8228	attR	TTCCTGATGTTGT	NA	NA	NA	NA
WP_001189111.1|9241_10750_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.6e-44
>prophage 2
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	23169	26412	5099034		Ectocarpus_siliculosus_virus(100.0%)	1	NA	NA
WP_038632840.1|23169_26412_-	transporter substrate-binding domain-containing protein	NA	Q8QKV7	Ectocarpus_siliculosus_virus	30.5	6.8e-32
>prophage 3
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	37808	38825	5099034		Tupanvirus(100.0%)	1	NA	NA
WP_038632871.1|37808_38825_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	46.5	7.2e-81
>prophage 4
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	63920	64634	5099034		Bacillus_virus(100.0%)	1	NA	NA
WP_038632928.1|63920_64634_+	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	37.1	1.4e-14
>prophage 5
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	68637	72656	5099034		Klosneuvirus(50.0%)	4	NA	NA
WP_038632940.1|68637_69921_+	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	29.3	9.6e-30
WP_038632942.1|70061_71462_+	GABA permease	NA	NA	NA	NA	NA
WP_038632944.1|71507_72194_+	DNA-binding transcriptional regulator CsiR	NA	NA	NA	NA	NA
WP_038632949.1|72206_72656_-	peptidoglycan-binding protein LysM	NA	A0A090DBR9	Clostridium_phage	39.5	5.2e-07
>prophage 6
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	78273	83570	5099034		Lactobacillus_phage(20.0%)	5	NA	NA
WP_038632979.1|78273_78519_+	glutaredoxin-like protein NrdH	NA	A0A0M7REK7	Lactobacillus_phage	41.1	2.5e-11
WP_038632982.1|78515_78926_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	42.6	1.7e-17
WP_038632984.1|78898_81043_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	48.2	4.9e-196
WP_038632987.1|81053_82013_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A0M4S3B4	Mycobacterium_phage	69.9	2.3e-129
WP_038632990.1|82367_83570_+	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	38.8	1.4e-27
>prophage 7
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	96456	101863	5099034	tRNA	Vibrio_phage(25.0%)	5	NA	NA
WP_000906486.1|96456_96642_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
WP_038633032.1|96880_99508_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	39.0	6.4e-81
WP_038633035.1|99635_100136_-	recombination regulator RecX	NA	NA	NA	NA	NA
WP_038633038.1|100208_101273_-	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	63.8	4.0e-114
WP_003037333.1|101365_101863_-	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	51.0	2.6e-31
>prophage 8
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	107404	108370	5099034		Tetraselmis_virus(100.0%)	1	NA	NA
WP_038633059.1|107404_108370_+	arabinose-5-phosphate isomerase GutQ	NA	A0A2P0VNK5	Tetraselmis_virus	33.9	3.0e-36
>prophage 9
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	115821	116835	5099034		Enterobacteria_phage(100.0%)	1	NA	NA
WP_038633073.1|115821_116835_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	27.9	1.9e-25
>prophage 10
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	136098	142283	5099034		Brazilian_cedratvirus(50.0%)	4	NA	NA
WP_038633120.1|136098_136914_+	iron/manganese ABC transporter ATP-binding protein SitB	NA	A0A2R8FG22	Brazilian_cedratvirus	25.8	2.0e-12
WP_038633122.1|136916_137774_+	iron/manganese ABC transporter permease subunit SitC	NA	NA	NA	NA	NA
WP_038633125.1|137770_138622_+	iron/manganese ABC transporter permease subunit SitD	NA	NA	NA	NA	NA
WP_038633127.1|139721_142283_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	21.0	4.1e-32
>prophage 11
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	145303	148987	5099034		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_000081498.1|145303_146296_-	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_038633147.1|146358_147486_-	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	34.6	5.0e-06
WP_038633150.1|147605_148232_-	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	50.6	2.0e-36
WP_038633152.1|148225_148987_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	46.7	2.5e-57
>prophage 12
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	152118	154151	5099034		Tupanvirus(50.0%)	2	NA	NA
WP_038633165.1|152118_152724_-	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	37.1	1.6e-27
WP_038633168.1|152723_154151_-	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	25.1	9.7e-31
>prophage 13
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	161582	162254	5099034		Vibrio_phage(100.0%)	1	NA	NA
WP_038633185.1|161582_162254_-	7-carboxy-7-deazaguanine synthase QueE	NA	A0A2I7S8X1	Vibrio_phage	24.6	3.9e-14
>prophage 14
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	165616	168639	5099034		Streptococcus_phage(50.0%)	2	NA	NA
WP_003034129.1|165616_166915_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	57.9	1.4e-129
WP_005130912.1|167001_168639_-	CTP synthase (glutamine hydrolyzing)	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.7	3.9e-153
>prophage 15
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	172117	180198	5099034		Erysipelothrix_phage(25.0%)	5	NA	NA
WP_038633202.1|172117_173416_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	28.4	1.8e-36
WP_038633206.1|173473_176230_+	two-component sensor histidine kinase BarA	NA	A0A1V0SGX0	Hokovirus	29.5	4.6e-53
WP_038633208.1|176271_177414_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	40.9	3.7e-49
WP_038633210.1|177496_178837_-	glucarate dehydratase	NA	NA	NA	NA	NA
WP_038633213.1|178857_180198_-	glucarate dehydratase	NA	Q6A202	Oenococcus_phage	22.6	6.5e-05
>prophage 16
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	184724	185573	5099034		Vibrio_phage(100.0%)	1	NA	NA
WP_038633229.1|184724_185573_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	37.6	9.4e-42
>prophage 17
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	190442	191198	5099034		Bacillus_phage(100.0%)	1	NA	NA
WP_038633235.1|190442_191198_+	flap endonuclease Xni	NA	F8WQ40	Bacillus_phage	30.2	1.8e-07
>prophage 18
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	197955	199455	5099034		Bacillus_virus(100.0%)	1	NA	NA
WP_038633254.1|197955_199455_-	sugar ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	27.2	4.1e-16
>prophage 19
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	207664	223260	5099034	tRNA	environmental_halophage(16.67%)	9	NA	NA
WP_038642847.1|207664_208870_+	cysteine desulfurase CsdA	NA	Q2XUY6	environmental_halophage	36.6	2.1e-71
WP_038633278.1|208869_209316_+	cysteine desulfurase sulfur acceptor subunit CsdE	NA	NA	NA	NA	NA
WP_038633280.1|209394_210201_-|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	33.3	6.5e-16
WP_038633283.1|210335_211433_-	murein transglycosylase A	NA	NA	NA	NA	NA
WP_038633286.1|212143_213397_-	N-acetylmuramoyl-L-alanine amidase AmiC	NA	E5DV68	Deep-sea_thermophilic_phage	28.4	4.7e-13
WP_038633289.1|213631_214963_+	amino-acid N-acetyltransferase	NA	NA	NA	NA	NA
WP_038633294.1|215007_216837_-	exodeoxyribonuclease V subunit alpha	NA	A0A1P8DII4	Virus_Rctr197k	36.0	1.3e-03
WP_038633296.1|216833_220379_-	exodeoxyribonuclease V subunit beta	NA	A7KV33	Bacillus_phage	20.6	6.2e-10
WP_038633297.1|220371_223260_-	pitrilysin	NA	A0A1V0SJA4	Klosneuvirus	25.0	2.9e-66
>prophage 20
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	228741	235565	5099034		Cronobacter_phage(33.33%)	6	NA	NA
WP_038633316.1|228741_229536_-	thymidylate synthase	NA	R4IFY1	Cronobacter_phage	62.3	1.1e-116
WP_038633319.1|229542_230418_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_038633322.1|230606_232853_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	24.6	3.9e-10
WP_003825602.1|232865_233396_-	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_038633327.1|234080_234776_+	DNA mismatch repair endonuclease MutH	NA	NA	NA	NA	NA
WP_038633330.1|234851_235565_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	46.8	6.9e-46
>prophage 21
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	242145	243156	5099034		Enterobacteria_phage(100.0%)	1	NA	NA
WP_038633346.1|242145_243156_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	29.9	6.2e-32
>prophage 22
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	246859	250298	5099034	transposase	Sodalis_phage(33.33%)	3	NA	NA
WP_038633357.1|246859_247747_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	55.0	1.8e-67
WP_038633360.1|247802_249221_-	arabinose-proton symporter AraE	NA	O13311	Aichi_virus	26.9	1.8e-24
WP_003033923.1|249536_250298_-	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.1	2.6e-19
>prophage 23
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	265681	266287	5099034		Canarypox_virus(100.0%)	1	NA	NA
WP_038633392.1|265681_266287_-	ankyrin repeat domain-containing protein	NA	Q6VZ28	Canarypox_virus	26.9	7.0e-07
>prophage 24
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	275373	275910	5099034		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_038633410.1|275373_275910_+	N-acetyltransferase	NA	A0A2H4J136	uncultured_Caudovirales_phage	34.2	1.5e-16
>prophage 25
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	294529	295264	5099034		Microcystis_virus(100.0%)	1	NA	NA
WP_038642856.1|294529_295264_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A7K9	Microcystis_virus	38.1	1.1e-09
>prophage 26
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	299967	306057	5099034	tRNA	Catovirus(25.0%)	5	NA	NA
WP_006686909.1|299967_301485_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.9	2.3e-86
WP_100194817.1|301494_302593_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	1.8e-05
WP_038633470.1|302684_304418_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.3	1.2e-59
WP_038633473.1|304423_305137_-	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
WP_038633475.1|305160_306057_-	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	27.9	2.5e-29
>prophage 27
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	310814	316037	5099034		Pandoravirus(50.0%)	3	NA	NA
WP_038633498.1|310814_312248_+	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	26.3	3.7e-30
WP_038633501.1|312341_313085_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_038633504.1|313163_316037_-	aminomethyl-transferring glycine dehydrogenase	NA	M4QFZ1	Prochlorococcus_phage	50.4	1.3e-260
>prophage 28
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	324267	325500	5099034		Catovirus(100.0%)	1	NA	NA
WP_006686878.1|324267_325500_-	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	47.9	1.1e-102
>prophage 29
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	356187	359139	5099034		Staphylococcus_phage(50.0%)	2	NA	NA
WP_006686850.1|356187_357342_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.7	9.6e-130
WP_038633584.1|357744_359139_+	galactose/proton symporter	NA	O13311	Aichi_virus	25.5	1.1e-26
>prophage 30
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	372437	373523	5099034		Geobacillus_virus(100.0%)	1	NA	NA
WP_129694833.1|372437_373523_+	membrane-bound lytic murein transglycosylase MltC	NA	A0A0H3V0Q1	Geobacillus_virus	39.0	4.5e-12
>prophage 31
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	378734	382367	5099034	integrase	Stx2-converting_phage(66.67%)	3	367908:367922	380556:380570
367908:367922	attL	ATTTCGCATCATCAA	NA	NA	NA	NA
WP_032170149.1|378734_380000_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	39.1	1.3e-79
WP_071888038.1|381447_382023_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	37.0	1.5e-14
380556:380570	attR	TTGATGATGCGAAAT	NA	NA	NA	NA
WP_038633649.1|382019_382367_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.0	1.2e-43
>prophage 32
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	391471	393377	5099034	transposase	Escherichia_phage(50.0%)	3	NA	NA
WP_001067855.1|391471_392176_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_051594483.1|392209_392638_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004393997.1|392666_393377_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.3	3.7e-31
>prophage 33
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	397473	399551	5099034		Bacillus_phage(100.0%)	2	NA	NA
WP_006785898.1|397473_398874_-	copper resistance membrane spanning protein PcoS	NA	W8CYF6	Bacillus_phage	26.6	3.2e-18
WP_001188930.1|398870_399551_-	copper response regulator transcription factor PcoR	NA	W8CYM9	Bacillus_phage	34.4	8.7e-30
>prophage 34
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	404645	408108	5099034		Listeria_phage(50.0%)	3	NA	NA
WP_000287501.1|404645_405383_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A8ATH6	Listeria_phage	41.0	1.0e-12
WP_000843494.1|405416_405614_-	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
WP_038633697.1|405654_408108_-	Ag(+)-translocating P-type ATPase SilP	NA	A0A218MNH6	uncultured_virus	34.9	7.6e-84
>prophage 35
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	415281	419468	5099034	transposase	Bacillus_phage(66.67%)	4	NA	NA
WP_038633715.1|415281_415962_+	copper/silver response regulator transcription factor SilR	NA	W8CYM9	Bacillus_phage	35.7	7.8e-31
WP_032433718.1|415954_417430_+	copper/silver sensor histidine kinase SilS	NA	W8CYF6	Bacillus_phage	29.7	1.8e-27
WP_038633721.1|417680_418112_+	silver-binding protein SilE	NA	NA	NA	NA	NA
WP_096755719.1|418320_419468_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	92.2	1.9e-146
>prophage 36
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	426211	427766	5099034		Yersinia_phage(50.0%)	3	NA	NA
WP_001234374.1|426211_427030_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.4	1.2e-46
WP_038633754.1|427029_427293_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038633758.1|427289_427766_+	antirestriction protein	NA	A0A1S5R3R9	Pseudomonas_phage	31.8	1.2e-09
>prophage 37
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	431414	431621	5099034		Vibrio_phage(100.0%)	1	NA	NA
WP_038633780.1|431414_431621_-	helix-turn-helix domain-containing protein	NA	A0A2I7S995	Vibrio_phage	64.2	7.4e-17
>prophage 38
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	443293	445918	5099034		Cronobacter_phage(100.0%)	1	NA	NA
WP_038633800.1|443293_445918_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	31.7	9.6e-93
>prophage 39
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	465432	467073	5099034		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_038633848.1|465432_467073_-	Tar ligand binding domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	54.4	7.0e-09
>prophage 40
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	475998	481195	5099034		Staphylococcus_phage(33.33%)	4	NA	NA
WP_038633879.1|475998_476826_+	2,5-didehydrogluconate reductase DkgA	NA	A0A2H4PQR8	Staphylococcus_phage	42.3	1.0e-56
WP_038633882.1|477014_478469_+	DASS family sodium-coupled anion symporter	NA	NA	NA	NA	NA
WP_038633885.1|478512_478968_+	HIT family protein	NA	Q5YEY9	Rock_bream_iridovirus	36.8	1.1e-20
WP_003024532.1|479023_481195_-	YgiQ family radical SAM protein	NA	M1QSD9	Pseudomonas_phage	70.4	1.3e-103
>prophage 41
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	485301	488074	5099034		Bacillus_virus(50.0%)	2	NA	NA
WP_038633896.1|485301_487560_-	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	35.5	7.5e-86
WP_038633899.1|487678_488074_-	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	47.2	1.8e-19
>prophage 42
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	491366	493259	5099034		Bacillus_virus(100.0%)	1	NA	NA
WP_005123094.1|491366_493259_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	35.1	6.9e-93
>prophage 43
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	497598	505290	5099034		Erwinia_phage(25.0%)	9	NA	NA
WP_006688037.1|497598_498276_+	DUF1190 family protein	NA	A0A173GEW8	Erwinia_phage	47.3	3.7e-41
WP_038642878.1|498281_499442_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.1	1.3e-86
WP_038633925.1|499526_500315_-	4,5-DOPA dioxygenase extradiol	NA	NA	NA	NA	NA
WP_038633928.1|500462_501236_+	zinc transporter ZupT	NA	NA	NA	NA	NA
WP_069324349.1|501302_501479_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038633931.1|501910_502564_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	44.8	8.3e-46
WP_038633935.1|502953_503250_+	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_087856824.1|503283_503490_-	cell surface composition regulator GlgS	NA	NA	NA	NA	NA
WP_038633941.1|503856_505290_-	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	28.8	1.7e-38
>prophage 44
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	510464	513836	5099034		Sinorhizobium_phage(50.0%)	2	NA	NA
WP_038633951.1|510464_511697_+	multifunctional CCA addition/repair protein	NA	A0A0F6YPT7	Sinorhizobium_phage	49.4	1.4e-94
WP_038633954.1|511745_513836_-	polysaccharide degrading enzyme	NA	A0A068LRB9	Peridroma_alphabaculovirus	26.2	1.6e-29
>prophage 45
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	525467	531042	5099034	tRNA	Moraxella_phage(33.33%)	4	NA	NA
WP_038633989.1|525467_526481_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.5	2.2e-109
WP_001144069.1|526717_526933_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_038633998.1|527167_528913_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.8	8.4e-77
WP_038634001.1|529197_531042_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.4e-35
>prophage 46
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	545152	552290	5099034		Tupanvirus(33.33%)	6	NA	NA
WP_038634036.1|545152_546307_-	cyclopropane fatty acyl phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	45.8	3.6e-84
WP_038634037.1|546373_547222_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_038634038.1|547222_547996_-	siderophore-interacting protein	NA	NA	NA	NA	NA
WP_038634039.1|548235_548907_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_038634042.1|548959_550480_-	PAS domain-containing methyl-accepting chemotaxis protein	NA	A0A1B0V854	Salmonella_phage	48.5	6.4e-33
WP_129694873.1|550847_552290_+	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	28.9	2.1e-33
>prophage 47
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	557641	558610	5099034		Enterobacteria_phage(100.0%)	1	NA	NA
WP_038642882.1|557641_558610_+	TerC family protein	NA	I7HPH5	Enterobacteria_phage	31.8	4.5e-32
>prophage 48
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	579491	581786	5099034		Tetraselmis_virus(100.0%)	1	NA	NA
WP_038634104.1|579491_581786_-	2-ketobutyrate formate-lyase/pyruvate formate-lyase	NA	A0A2P0VNR5	Tetraselmis_virus	40.7	2.4e-156
>prophage 49
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	587609	588755	5099034		Streptococcus_phage(100.0%)	1	NA	NA
WP_038634116.1|587609_588755_-	glycerate 2-kinase	NA	W6LM47	Streptococcus_phage	39.9	5.9e-47
>prophage 50
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	602859	609543	5099034		Streptococcus_phage(25.0%)	9	NA	NA
WP_038634156.1|602859_603723_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	43.6	5.6e-50
WP_038634158.1|603786_605829_+	penicillin-binding protein activator	NA	NA	NA	NA	NA
WP_038634160.1|605786_606182_+	YraN family protein	NA	NA	NA	NA	NA
WP_003024948.1|606216_606807_+	DnaA initiator-associating protein DiaA	NA	A0A067XQR2	Caulobacter_phage	31.8	3.2e-12
WP_003024954.1|606816_607392_+	divisome-associated lipoprotein YraP	NA	NA	NA	NA	NA
WP_038634162.1|607485_608121_-	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_038634164.1|608249_608768_+	type 1 glutamine amidotransferase	NA	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	27.6	2.6e-10
WP_038634166.1|608747_609191_-	YhbP family protein	NA	NA	NA	NA	NA
WP_038634168.1|609243_609543_+	GIY-YIG nuclease family protein	NA	F2NZ06	Diadromus_pulchellus_ascovirus	51.2	2.2e-14
>prophage 51
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	615326	617252	5099034		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_038634182.1|615326_617252_-	ATP-dependent RNA helicase DeaD	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	30.8	4.6e-52
>prophage 52
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	622866	631665	5099034		Cafeteria_roenbergensis_virus(33.33%)	6	NA	NA
WP_038634196.1|622866_625557_-	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	26.3	3.3e-24
WP_038634199.1|625581_627069_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_003024996.1|627097_627550_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_038634202.1|628168_629512_+	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	93.7	4.8e-64
WP_006687886.1|629804_630137_-	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_051594485.1|630351_631665_-	M23 family metallopeptidase	NA	G9FHH0	Rhodococcus_phage	33.7	1.2e-06
>prophage 53
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	641944	647319	5099034	protease	Vibrio_virus(33.33%)	4	NA	NA
WP_077223913.1|641944_642661_-	type IV pilus major pilin	NA	Q8LTI3	Vibrio_virus	33.0	1.4e-14
WP_038634228.1|643106_644444_-	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_038634231.1|644436_645285_-	dihydropteroate synthase	NA	S4VNV0	Pandoravirus	31.2	1.3e-19
WP_003025013.1|645384_647319_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	G8DDJ2	Micromonas_pusilla_virus	43.6	4.1e-117
>prophage 54
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	656391	657872	5099034		Indivirus(50.0%)	2	NA	NA
WP_003025033.1|656391_657363_+	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	26.2	1.6e-08
WP_038634246.1|657587_657872_+	DNA-binding transcriptional regulator SfsB	NA	A0A2I7S995	Vibrio_phage	65.7	4.6e-17
>prophage 55
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	661964	676050	5099034		Staphylococcus_phage(25.0%)	16	NA	NA
WP_038634255.1|661964_662777_-	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	30.7	2.2e-19
WP_038634258.1|662992_663970_+	calcium/sodium antiporter	NA	NA	NA	NA	NA
WP_038634261.1|663983_664970_+	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	31.2	4.3e-38
WP_038634264.1|664990_665557_+	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	75.6	1.2e-53
WP_038634267.1|665553_666129_+	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_038634270.1|666097_666646_+	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_003025073.1|666652_667378_+	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	3.2e-22
WP_038634272.1|667424_668858_+	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_038634275.1|668880_669168_+	ribosome hibernation promoting factor	NA	A0A0M7QCF2	Escherichia_phage	43.2	5.5e-10
WP_038634278.1|669250_669742_+	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_003025085.1|669787_670642_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.4	1.4e-05
WP_003025086.1|670638_670911_+	PTS phosphocarrier protein NPr	NA	NA	NA	NA	NA
WP_038634281.1|670977_671697_-	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
WP_038634284.1|671693_672347_-	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_038634287.1|672576_674913_-	aerobic respiration two-component sensor histidine kinase ArcB	NA	A0A1V0SGX0	Hokovirus	31.1	9.9e-41
WP_114140335.1|675120_676050_-	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	32.8	5.2e-17
>prophage 56
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	686898	688389	5099034		Burkholderia_virus(100.0%)	1	NA	NA
WP_038634306.1|686898_688389_-	sialic acid transporter NanT	NA	Q6JIH2	Burkholderia_virus	23.5	7.0e-08
>prophage 57
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	692100	692604	5099034	protease	Pseudomonas_phage(100.0%)	1	NA	NA
WP_038634317.1|692100_692604_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	54.8	9.6e-26
>prophage 58
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	696503	697871	5099034	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_038634331.1|696503_697871_+|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.3	1.5e-20
>prophage 59
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	715566	716610	5099034		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000913396.1|715566_716610_-	rod shape-determining protein MreB	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
>prophage 60
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	729255	730140	5099034		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_038634402.1|729255_730140_+	adenine-specific DNA-methyltransferase	NA	A0A0P0CJX0	Ostreococcus_lucimarinus_virus	31.1	3.1e-27
>prophage 61
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	736736	740892	5099034		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_038634415.1|736736_737762_+	amino acid ABC transporter substrate-binding protein	NA	A0A1B1IT51	uncultured_Mediterranean_phage	39.5	1.2e-70
WP_038634418.1|737831_739013_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_038634420.1|739022_740126_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_038634423.1|740133_740892_+	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	3.1e-20
>prophage 62
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	748817	749432	5099034		Streptococcus_phage(100.0%)	1	NA	NA
WP_038634432.1|748817_749432_-	IMPACT family protein	NA	A0A1X9I5T8	Streptococcus_phage	45.7	2.1e-19
>prophage 63
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	760417	763737	5099034		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_038634459.1|760417_761209_-	Sec-independent protein translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	32.4	4.7e-27
WP_038634462.1|761211_761760_-	Sec-independent protein translocase subunit TatB	NA	NA	NA	NA	NA
WP_003017888.1|761763_762018_-	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_038634465.1|762096_763737_-	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	M4R0M8	Ostreococcus_lucimarinus_virus	29.5	9.7e-43
>prophage 64
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	776272	778102	5099034		Catovirus(100.0%)	1	NA	NA
WP_038634489.1|776272_778102_-	ATP-dependent DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	38.3	8.2e-83
>prophage 65
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	782119	785989	5099034		Bacillus_phage(100.0%)	3	NA	NA
WP_038634502.1|782119_784282_-	DNA helicase II	NA	A7KV33	Bacillus_phage	37.7	3.5e-117
WP_038634504.1|784370_785087_-	5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB	NA	NA	NA	NA	NA
WP_038634507.1|785086_785989_-	tyrosine recombinase XerC	NA	A0A142F1N9	Bacillus_phage	29.5	7.2e-24
>prophage 66
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	802461	808623	5099034		uncultured_marine_virus(20.0%)	6	NA	NA
WP_038634547.1|802461_803592_-	dTDP-4-amino-4,6-dideoxygalactose transaminase	NA	A0A0F7LAY0	uncultured_marine_virus	39.4	1.7e-17
WP_038634550.1|803596_804274_-	dTDP-4-amino-4,6-dideoxy-D-galactose acyltransferase	NA	NA	NA	NA	NA
WP_038634554.1|804251_805133_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	A0A291LA53	Escherichia_phage	67.0	1.0e-107
WP_038634557.1|805166_806234_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.1	6.6e-101
WP_038634559.1|806233_807496_-	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1HNJ7	Paramecium_bursaria_Chlorella_virus	26.5	7.7e-24
WP_038634562.1|807492_808623_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	27.0	1.4e-27
>prophage 67
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	812677	818916	5099034		Indivirus(25.0%)	5	NA	NA
WP_001280776.1|812677_813007_-	thioredoxin TrxA	NA	A0A1V0SD63	Indivirus	38.5	4.2e-14
WP_003829013.1|813138_814407_+	ATP-dependent RNA helicase RhlB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.2	8.3e-42
WP_038634581.1|814540_816022_+	guanosine-5'-triphosphate,3'-diphosphate diphosphatase	NA	NA	NA	NA	NA
WP_038634584.1|816059_818084_-	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.8	8.4e-113
WP_038634587.1|818187_818916_-	nicotinamide riboside transporter PnuC	NA	A0A126HGA3	Vibrio_phage	33.5	7.1e-22
>prophage 68
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	830186	831833	5099034		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_038634612.1|830186_831833_-	acetolactate synthase 2 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	32.0	1.1e-65
>prophage 69
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	845659	847131	5099034	tRNA	Synechococcus_phage(50.0%)	2	NA	NA
WP_038634641.1|845659_846169_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	41.9	1.8e-19
WP_038634644.1|846183_847131_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	36.9	1.7e-07
>prophage 70
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	868330	870325	5099034		Vibrio_phage(100.0%)	1	NA	NA
WP_038634719.1|868330_870325_+	type II secretion system secretin GspD	NA	R9TEZ5	Vibrio_phage	34.9	2.3e-30
>prophage 71
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	882289	887861	5099034		Tupanvirus(33.33%)	7	NA	NA
WP_003031109.1|882289_883474_-	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	7.5e-13
WP_038634754.1|883543_885658_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	26.9	1.1e-57
WP_003023657.1|885754_886225_-	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_003023654.1|886320_886695_-	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_038634759.1|886820_887108_-	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
WP_038634761.1|887115_887475_-	sulfurtransferase complex subunit TusC	NA	NA	NA	NA	NA
WP_038634764.1|887474_887861_-	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	39.8	3.3e-18
>prophage 72
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	893612	899030	5099034		Tupanvirus(50.0%)	5	NA	NA
WP_038634776.1|893612_895514_+	ABC transporter ATP-binding protein	NA	A0A2K9L0W2	Tupanvirus	34.1	3.8e-75
WP_038642912.1|895530_896463_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_038634778.1|896553_897450_-	malonate decarboxylase subunit epsilon	NA	NA	NA	NA	NA
WP_038634780.1|897446_898067_-	malonate decarboxylase holo-ACP synthase	NA	NA	NA	NA	NA
WP_038634783.1|898070_899030_-	AEC family transporter	NA	A0A0U2C0Y4	Salmonella_phage	91.1	7.1e-54
>prophage 73
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	903812	907088	5099034		Bacillus_phage(33.33%)	3	NA	NA
WP_038634794.1|903812_905303_-	nicotinate phosphoribosyltransferase	NA	A0A218KC49	Bacillus_phage	52.2	1.5e-143
WP_038634796.1|905317_906178_-	ribose-phosphate pyrophosphokinase	NA	A0A2P1CBA5	Salmonella_phage	40.3	8.1e-49
WP_038642914.1|906368_907088_+	NUDIX hydrolase	NA	G3MA14	Bacillus_virus	27.9	1.1e-19
>prophage 74
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	910825	914895	5099034		environmental_Halophage(50.0%)	3	NA	NA
WP_038634805.1|910825_912913_+	FUSC family protein	NA	H9YQA8	environmental_Halophage	89.1	6.5e-68
WP_038634808.1|913028_914246_-	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_038634811.1|914331_914895_-	aminodeoxychorismate synthase component 2	NA	A0A0P0IKJ1	Acinetobacter_phage	57.9	3.2e-62
>prophage 75
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	926279	927116	5099034		Vibrio_phage(100.0%)	1	NA	NA
WP_038634842.1|926279_927116_-	adenine-specific DNA-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	49.1	3.7e-67
>prophage 76
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	942380	946152	5099034		Bacillus_phage(66.67%)	3	NA	NA
WP_038634881.1|942380_944003_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	53.1	5.3e-142
WP_038634884.1|944077_945430_-	two-component system sensor histidine kinase EnvZ	NA	W8CYF6	Bacillus_phage	23.6	1.9e-12
WP_155268633.1|945426_946152_-	two-component system response regulator OmpR	NA	W8CYM9	Bacillus_phage	34.7	7.8e-29
>prophage 77
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	959215	961609	5099034		Iris_mild_mosaic_virus(100.0%)	1	NA	NA
WP_038634907.1|959215_961609_-	maltodextrin phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	40.2	4.7e-14
>prophage 78
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	968875	971323	5099034		Dickeya_phage(100.0%)	1	NA	NA
WP_038634923.1|968875_971323_-	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	82.1	3.6e-33
>prophage 79
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	990775	992586	5099034		Enterococcus_phage(50.0%)	2	NA	NA
WP_038634968.1|990775_991519_-	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	26.1	5.2e-12
WP_038634970.1|991515_992586_-	sn-glycerol-3-phosphate import ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	32.0	4.4e-20
>prophage 80
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	996903	998402	5099034		Planktothrix_phage(50.0%)	2	NA	NA
WP_087856271.1|996903_997617_-	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivF	NA	G9BWD6	Planktothrix_phage	31.1	1.8e-14
WP_003827578.1|997634_998402_-	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	24.5	4.9e-13
>prophage 81
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	1004072	1006916	5099034		Salicola_phage(50.0%)	3	NA	NA
WP_038634997.1|1004072_1004927_-	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	42.3	5.4e-45
WP_038635001.1|1005196_1006255_-	cell division protein FtsX	NA	NA	NA	NA	NA
WP_006687468.1|1006247_1006916_-	cell division ATP-binding protein FtsE	NA	A0A2H4PQG7	Staphylococcus_phage	27.6	1.1e-13
>prophage 82
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	1010183	1014239	5099034		Dickeya_phage(50.0%)	4	NA	NA
WP_038635015.1|1010183_1010810_+	lysoplasmalogenase	NA	A0A140XAH6	Dickeya_phage	60.2	1.8e-29
WP_038635018.1|1010885_1013084_+	Zn(II)/Cd(II)/Pb(II) translocating P-type ATPase ZntA	NA	E4ZFI9	Streptococcus_phage	37.7	7.2e-118
WP_038635021.1|1013159_1013405_-	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	83.3	4.7e-10
WP_038635023.1|1013573_1014239_+	7-cyano-7-deazaguanine/7-aminomethyl-7- deazaguanine transporter	NA	A0A2I7SAW6	Vibrio_phage	54.9	1.5e-58
>prophage 83
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	1021098	1023846	5099034		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_038635043.1|1021098_1023846_-	ribosome-associated ATPase/putative transporter RbbA	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	33.0	3.9e-20
>prophage 84
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	1037773	1039246	5099034		Micromonas_sp._RCC1109_virus(100.0%)	1	NA	NA
WP_038635074.1|1037773_1039246_+	fructuronate reductase	NA	E5EQS6	Micromonas_sp._RCC1109_virus	30.4	4.2e-45
>prophage 85
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	1046804	1048847	5099034		Indivirus(100.0%)	1	NA	NA
WP_051594491.1|1046804_1048847_-	oligopeptidase A	NA	A0A1V0SD92	Indivirus	22.5	7.1e-43
>prophage 86
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	1087557	1089542	5099034		Bacillus_virus(50.0%)	2	NA	NA
WP_038635143.1|1087557_1088562_-	dipeptide ABC transporter ATP binding subunit DppF	NA	G3M9Y6	Bacillus_virus	29.4	7.3e-17
WP_038635145.1|1088558_1089542_-	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.7	1.9e-14
>prophage 87
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	1099391	1101725	5099034		Escherichia_phage(100.0%)	1	NA	NA
WP_038635166.1|1099391_1101725_-	molybdopterin guanine dinucleotide-containing S/N-oxide reductase	NA	A0A077SK27	Escherichia_phage	30.3	3.4e-73
>prophage 88
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	1109518	1109731	5099034		Morganella_phage(100.0%)	1	NA	NA
WP_000014594.1|1109518_1109731_+	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	72.9	2.7e-22
>prophage 89
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	1114085	1115081	5099034		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_038642921.1|1114085_1115081_+	acyltransferase	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	25.2	6.3e-13
>prophage 90
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	1144901	1146749	5099034		Tupanvirus(100.0%)	1	NA	NA
WP_038635270.1|1144901_1146749_-	selenocysteine-specific translation elongation factor	NA	A0A2K9KZ60	Tupanvirus	25.1	6.2e-14
>prophage 91
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	1164306	1173667	5099034		Rhizobium_phage(16.67%)	9	NA	NA
WP_003024152.1|1164306_1164558_-	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	53.4	2.2e-15
WP_003024148.1|1164610_1165042_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_038635319.1|1165289_1166834_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_038635322.1|1166843_1168127_+	murein hydrolase activator EnvC	NA	G9BW84	Planktothrix_phage	34.3	1.8e-07
WP_038635324.1|1168130_1169057_+	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_038635327.1|1169057_1170095_-	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	32.2	1.9e-12
WP_038635329.1|1170288_1171314_-	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	80.8	2.3e-18
WP_038635332.1|1171323_1172520_-	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	28.6	1.7e-33
WP_003827312.1|1172734_1173667_+	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	37.1	1.0e-36
>prophage 92
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	1176988	1178002	5099034		Catovirus(100.0%)	1	NA	NA
WP_038635340.1|1176988_1178002_+	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	33.9	4.9e-05
>prophage 93
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	1185735	1190308	5099034		uncultured_Mediterranean_phage(25.0%)	7	NA	NA
WP_003024099.1|1185735_1186215_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	43.2	6.3e-27
WP_038635364.1|1186263_1187073_-	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	F8WPX6	Bacillus_phage	31.2	2.6e-25
WP_003024094.1|1187171_1187339_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_003024071.1|1187359_1187596_-	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_038635368.1|1187814_1188480_-	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_129694987.1|1188651_1189872_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	34.1	7.2e-43
WP_129694986.1|1189852_1190308_+	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	60.1	2.8e-48
>prophage 94
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	1193716	1264757	5099034	tRNA,integrase,transposase	Salmonella_phage(15.0%)	57	1210582:1210595	1270324:1270337
WP_038635384.1|1193716_1194979_+|integrase	site-specific integrase	integrase	A0A1W6JPG6	Morganella_phage	70.7	1.4e-171
WP_038635387.1|1195298_1195862_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	36.9	4.7e-21
WP_038642925.1|1195929_1196931_+	ATP-binding protein	NA	A0A0N7FZ09	Sulfolobales_virus	28.9	2.6e-06
WP_038635391.1|1196947_1199461_+	S8 family serine peptidase	NA	NA	NA	NA	NA
WP_071888170.1|1199582_1199936_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_038635393.1|1199947_1200781_-	DUF1311 domain-containing protein	NA	J9Q6K3	Salmonella_phage	35.1	3.9e-08
WP_038635396.1|1200803_1201388_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038635399.1|1201622_1202000_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_155268625.1|1202035_1202611_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071888053.1|1202832_1203063_+	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_038635401.1|1203213_1204281_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038635404.1|1204446_1204887_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038635407.1|1204900_1205572_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038635410.1|1206015_1206633_+	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_038635413.1|1206629_1208309_-	NAD-dependent DNA ligase LigB	NA	F8SJM3	Pseudomonas_phage	22.4	2.7e-24
WP_038635416.1|1208570_1209194_+	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	35.0	1.1e-18
WP_000135058.1|1209248_1209524_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_038635422.1|1209542_1211654_+	bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase	NA	A0A291L9W9	Bordetella_phage	34.5	4.8e-10
1210582:1210595	attL	CCAGCACCACGGCA	NA	NA	NA	NA
WP_038635425.1|1211658_1212348_+|tRNA	tRNA (guanosine(18)-2'-O)-methyltransferase TrmH	tRNA	NA	NA	NA	NA
WP_038635428.1|1212353_1214435_+	ATP-dependent DNA helicase RecG	NA	NA	NA	NA	NA
WP_038635431.1|1214474_1215680_-	sodium/glutamate symporter	NA	NA	NA	NA	NA
WP_038635433.1|1215906_1217298_+	xanthine/proton symporter XanP	NA	H9YQ34	environmental_Halophage	95.9	2.5e-68
WP_038635436.1|1217419_1219126_+	AsmA family protein	NA	NA	NA	NA	NA
WP_038635440.1|1219164_1219842_-	D-lyxose/D-mannose family sugar isomerase	NA	NA	NA	NA	NA
WP_006687642.1|1219891_1220752_-	ketose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_038635444.1|1220832_1221684_-	class II fructose-bisphosphate aldolase family protein	NA	NA	NA	NA	NA
WP_006687644.1|1221695_1222787_-	PTS fructose transporter subunit IIC	NA	NA	NA	NA	NA
WP_006687645.1|1222813_1223134_-	PTS fructose transporter subunit IIB	NA	NA	NA	NA	NA
WP_003024008.1|1223153_1223624_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_038635450.1|1223650_1225204_-	PRD domain-containing protein	NA	NA	NA	NA	NA
WP_038635453.1|1225525_1227844_-	alpha-xylosidase	NA	NA	NA	NA	NA
WP_038635456.1|1227854_1229237_-	glycoside-pentoside-hexuronide family transporter	NA	NA	NA	NA	NA
WP_001218910.1|1229921_1231106_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	69.9	2.6e-162
WP_000999850.1|1231516_1232560_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000412404.1|1232957_1234028_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001329026.1|1234289_1235591_+	MFS transporter	NA	NA	NA	NA	NA
WP_038635468.1|1235605_1237987_+	glycoside hydrolase family 31 protein	NA	NA	NA	NA	NA
WP_000157061.1|1238634_1239120_+	single-stranded DNA-binding protein	NA	Q1MVN2	Enterobacteria_phage	63.8	4.4e-52
WP_038635474.1|1241356_1242865_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.6	8.1e-44
WP_032143699.1|1243173_1243545_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038635488.1|1245961_1246312_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	6.2e-40
WP_038635492.1|1246308_1246734_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	97.9	4.4e-48
WP_000412211.1|1250084_1250744_+	type A-1 chloramphenicol O-acetyltransferase	NA	G3CFL0	Escherichia_phage	100.0	8.4e-131
WP_000656305.1|1250944_1251322_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001138064.1|1251388_1254355_-|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.6	0.0e+00
WP_000147567.1|1254357_1254918_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
WP_000454193.1|1255043_1255394_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_000845048.1|1255596_1256610_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_000381802.1|1256755_1257289_+	aminoglycoside nucleotidyltransferase ANT(2'')-Ia	NA	NA	NA	NA	NA
WP_000186237.1|1257371_1258004_+	type B-3 chloramphenicol O-acetyltransferase CatB3	NA	A0A2R8FE91	Brazilian_cedratvirus	41.2	4.1e-26
WP_000679427.1|1258160_1258508_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|1258501_1259341_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
WP_079276088.1|1259838_1261287_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_002008781.1|1262071_1262572_+	hypothetical protein	NA	A0A2L0UZT6	Agrobacterium_phage	28.6	2.0e-07
WP_000019304.1|1262571_1263141_+	trimethoprim-resistant dihydrofolate reductase DfrA19	NA	NA	NA	NA	NA
WP_048228299.1|1263151_1263757_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000845048.1|1263743_1264757_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
1270324:1270337	attR	TGCCGTGGTGCTGG	NA	NA	NA	NA
>prophage 95
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	1268372	1270788	5099034		Yersinia_phage(33.33%)	5	NA	NA
WP_038635526.1|1268372_1269194_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.6	2.5e-47
WP_000680586.1|1269193_1269439_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080700392.1|1269463_1270006_+	antirestriction protein	NA	A9J566	Pseudomonas_phage	30.3	1.7e-12
WP_001186768.1|1270021_1270498_+	RadC family protein	NA	NA	NA	NA	NA
WP_000692306.1|1270566_1270788_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	44.4	3.2e-10
>prophage 96
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	1274381	1275128	5099034		Enterobacteria_phage(100.0%)	1	NA	NA
WP_001016257.1|1274381_1275128_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
>prophage 97
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	1279631	1282436	5099034		Escherichia_phage(100.0%)	1	NA	NA
WP_038635552.1|1279631_1282436_-	intestinal colonization autotransporter adhesin MisL	NA	A0A2L1IV18	Escherichia_phage	48.5	6.6e-100
>prophage 98
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	1290387	1295068	5099034	transposase	Mollivirus(33.33%)	5	NA	NA
WP_038635575.1|1290387_1291164_-	SDR family oxidoreductase	NA	A0A0M4JSW6	Mollivirus	25.5	1.6e-11
WP_038635578.1|1291311_1292256_+	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	26.0	6.4e-15
WP_038635581.1|1292281_1293184_+	DMT family transporter	NA	NA	NA	NA	NA
WP_038635584.1|1293210_1294029_-	lipoprotein NlpA	NA	NA	NA	NA	NA
WP_038635587.1|1294153_1295068_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	50.0	5.2e-70
>prophage 99
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	1306481	1307864	5099034		Pandoravirus(100.0%)	1	NA	NA
WP_038635623.1|1306481_1307864_+	glycoside hydrolase family 1 protein	NA	A0A0B5JD41	Pandoravirus	27.8	2.9e-40
>prophage 100
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	1327927	1332769	5099034		Micromonas_sp._RCC1109_virus(50.0%)	5	NA	NA
WP_038635679.1|1327927_1329616_-	acetolactate synthase large subunit	NA	E5EQ70	Micromonas_sp._RCC1109_virus	29.9	1.2e-56
WP_003827118.1|1329723_1329822_-	ilvB operon leader peptide IvbL	NA	NA	NA	NA	NA
WP_003023909.1|1330344_1330434_+	type I toxin-antitoxin system toxin TisB	NA	NA	NA	NA	NA
WP_038635683.1|1330557_1331391_+	EamA family transporter	NA	NA	NA	NA	NA
WP_038635685.1|1331584_1332769_+	multidrug efflux MFS transporter EmrD	NA	S4TR35	Salmonella_phage	24.8	1.9e-16
>prophage 101
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	1340886	1341821	5099034		Synechococcus_phage(50.0%)	2	NA	NA
WP_005121488.1|1340886_1341315_-	heat shock chaperone IbpB	NA	A0A1D8KPX5	Synechococcus_phage	37.3	1.6e-13
WP_006687722.1|1341407_1341821_-	heat shock chaperone IbpA	NA	A0A1D7SU06	Cyanophage	36.2	1.8e-17
>prophage 102
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	1348299	1355668	5099034		Bacillus_virus(33.33%)	7	NA	NA
WP_038635722.1|1348299_1350714_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	34.4	1.8e-114
WP_038635725.1|1350742_1351816_-	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_005121477.1|1351815_1352916_-	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	35.0	1.1e-53
WP_003827078.1|1352920_1354324_-	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_003023858.1|1354929_1355070_+	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_003844432.1|1355087_1355447_+	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_003023846.1|1355410_1355668_+	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	56.7	5.4e-17
>prophage 103
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	1362647	1373225	5099034		Moraxella_phage(20.0%)	9	NA	NA
WP_038635749.1|1362647_1363985_-	adenine permease AdeP	NA	A0A0R6PHV4	Moraxella_phage	37.6	1.4e-63
WP_038635752.1|1364152_1364818_+	6-phosphogluconate phosphatase	NA	NA	NA	NA	NA
WP_038635754.1|1364870_1365596_-	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_003023821.1|1365610_1366384_-	phosphate ABC transporter ATP-binding protein PstB	NA	W8CYL7	Bacillus_phage	30.6	3.4e-14
WP_003827037.1|1366430_1367321_-	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_038635761.1|1367320_1368280_-	phosphate ABC transporter permease PstC	NA	NA	NA	NA	NA
WP_038635764.1|1368424_1369465_-	phosphate ABC transporter substrate-binding protein PstS	NA	M4QHS4	Cyanophage	35.8	1.6e-46
WP_038635767.1|1369799_1371629_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	41.4	1.4e-122
WP_038635769.1|1371854_1373225_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	38.0	3.3e-36
>prophage 104
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	1385512	1386505	5099034		Heterosigma_akashiwo_virus(100.0%)	1	NA	NA
WP_038635786.1|1385512_1386505_+	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	38.0	1.3e-50
>prophage 105
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	1389779	1393773	5099034		Paramecium_bursaria_Chlorella_virus(50.0%)	3	NA	NA
WP_038635795.1|1389779_1391648_+	low affinity potassium transporter Kup	NA	M1I6H8	Paramecium_bursaria_Chlorella_virus	30.5	9.3e-66
WP_038635798.1|1391840_1392260_+	D-ribose pyranase	NA	NA	NA	NA	NA
WP_038635801.1|1392267_1393773_+	ribose ABC transporter ATP-binding protein RbsA	NA	A0A2K9L0W2	Tupanvirus	21.5	3.8e-17
>prophage 106
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	1409903	1412690	5099034		Enterococcus_phage(100.0%)	1	NA	NA
WP_038635834.1|1409903_1412690_+	DNA polymerase I	NA	A8E2B3	Enterococcus_phage	30.3	3.8e-47
>prophage 107
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	1418023	1419073	5099034		Ectocarpus_siliculosus_virus(100.0%)	1	NA	NA
WP_038635845.1|1418023_1419073_-	nitrogen regulation protein NR(II)	NA	Q8QKV7	Ectocarpus_siliculosus_virus	26.1	4.5e-09
>prophage 108
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	1431778	1434575	5099034		Staphylococcus_phage(50.0%)	3	NA	NA
WP_038635871.1|1431778_1432675_-	sulfolactaldehyde 3-reductase	NA	D2K0C8	Staphylococcus_phage	93.0	5.1e-62
WP_038635874.1|1432841_1433738_+	sugar kinase	NA	NA	NA	NA	NA
WP_038635877.1|1433771_1434575_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	29.6	8.4e-24
>prophage 109
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	1438158	1439067	5099034		Acanthamoeba_polyphaga_moumouvirus(100.0%)	1	NA	NA
WP_038635890.1|1438158_1439067_-	alpha/beta hydrolase	NA	L7RDF8	Acanthamoeba_polyphaga_moumouvirus	31.1	1.5e-24
>prophage 110
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	1442399	1445450	5099034		Escherichia_phage(100.0%)	1	NA	NA
WP_137350704.1|1442399_1445450_-	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	23.8	6.5e-08
>prophage 111
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	1456825	1460604	5099034	transposase	Shigella_phage(50.0%)	3	NA	NA
WP_096755719.1|1456825_1457972_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	92.2	1.9e-146
WP_038635940.1|1458660_1459695_-	L-rhamnose/proton symporter RhaT	NA	NA	NA	NA	NA
WP_038635943.1|1459983_1460604_+	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	57.4	7.8e-62
>prophage 112
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	1464081	1466150	5099034		Bacillus_phage(50.0%)	2	NA	NA
WP_038635957.1|1464081_1465455_-	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.9	5.0e-16
WP_038635960.1|1465451_1466150_-	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	29.5	2.6e-05
>prophage 113
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	1480410	1481256	5099034		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_038635996.1|1480410_1481256_-	aquaporin	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.7	1.2e-15
>prophage 114
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	1488551	1489883	5099034		Erwinia_phage(100.0%)	1	NA	NA
WP_038636017.1|1488551_1489883_-	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.7	5.8e-46
>prophage 115
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	1511104	1511767	5099034		Synechococcus_phage(100.0%)	1	NA	NA
WP_038636057.1|1511104_1511767_-	fructose-6-phosphate aldolase	NA	A0A0E3F0E2	Synechococcus_phage	34.1	2.2e-30
>prophage 116
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	1527725	1529564	5099034		Acinetobacter_phage(100.0%)	1	NA	NA
WP_038636088.1|1527725_1529564_+	TonB-dependent vitamin B12 receptor BtuB	NA	A0A0P0I887	Acinetobacter_phage	31.4	3.1e-13
>prophage 117
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	1538128	1553542	5099034		uncultured_Mediterranean_phage(20.0%)	10	NA	NA
WP_032940924.1|1538128_1539079_-	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	32.0	8.7e-28
WP_016157942.1|1540027_1541212_+	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	7.5e-13
WP_003033128.1|1541442_1541826_+	preprotein translocase subunit SecE	NA	NA	NA	NA	NA
WP_003033125.1|1541827_1542373_+	transcription termination/antitermination protein NusG	NA	A0A291AUS6	Sinorhizobium_phage	29.6	1.1e-14
WP_038636105.1|1542530_1542959_+	50S ribosomal protein L11	NA	NA	NA	NA	NA
WP_006688358.1|1542962_1543670_+	50S ribosomal protein L1	NA	NA	NA	NA	NA
WP_005132895.1|1543963_1544461_+	50S ribosomal protein L10	NA	NA	NA	NA	NA
WP_000028882.1|1544527_1544893_+	50S ribosomal protein L7/L12	NA	NA	NA	NA	NA
WP_003033111.1|1545213_1549242_+	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	29.4	1.6e-22
WP_038636118.1|1549318_1553542_+	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	27.5	7.7e-68
>prophage 118
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	1557186	1557945	5099034		Catovirus(100.0%)	1	NA	NA
WP_038636131.1|1557186_1557945_-	HesA/MoeB/ThiF family protein	NA	A0A1V0SAV8	Catovirus	29.1	2.0e-11
>prophage 119
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	1563306	1565070	5099034		Klosneuvirus(50.0%)	3	NA	NA
WP_038636148.1|1563306_1563987_+	deoxyribonuclease V	NA	A0A1V0SJW5	Klosneuvirus	29.2	9.6e-21
WP_008787112.1|1564020_1564611_+	YjaG family protein	NA	NA	NA	NA	NA
WP_001044509.1|1564797_1565070_+	DNA-binding protein HU-alpha	NA	A7KV42	Bacillus_phage	57.8	5.5e-20
>prophage 120
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	1570558	1572148	5099034		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_038636165.1|1570558_1572148_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	48.1	3.8e-68
>prophage 121
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	1585459	1592190	5099034		Dickeya_phage(50.0%)	4	NA	NA
WP_038636187.1|1585459_1589143_+	methionine synthase	NA	A0A140XBC7	Dickeya_phage	88.5	4.9e-26
WP_038636190.1|1589356_1590985_+	Na/Pi cotransporter family protein	NA	NA	NA	NA	NA
WP_032942056.1|1591112_1591802_-	dipeptidase PepE	NA	NA	NA	NA	NA
WP_038636193.1|1591911_1592190_-	putative addiction module antidote protein	NA	A0A141GEX5	Brucella_phage	50.0	3.3e-12
>prophage 122
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	1597881	1602534	5099034		uncultured_Caudovirales_phage(100.0%)	7	NA	NA
WP_038636207.1|1597881_1598580_-	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	68.1	3.8e-89
WP_038636209.1|1598665_1598986_+	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	45.7	2.9e-20
WP_038636211.1|1599030_1600320_+	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	71.1	1.2e-168
WP_038636213.1|1600332_1600758_+	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	71.4	2.1e-50
WP_038636215.1|1600885_1601476_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_038636216.1|1601724_1602201_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_110496249.1|1602360_1602534_-	hypothetical protein	NA	A0A2H4JB52	uncultured_Caudovirales_phage	51.8	5.2e-08
>prophage 123
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	1620739	1621849	5099034		Mycoplasma_phage(100.0%)	1	NA	NA
WP_038636246.1|1620739_1621849_+	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	47.2	6.2e-17
>prophage 124
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	1629045	1629654	5099034		Lactococcus_phage(100.0%)	1	NA	NA
WP_003031703.1|1629045_1629654_+	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
>prophage 125
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	1635309	1644404	5099034		Escherichia_phage(25.0%)	7	NA	NA
WP_003826610.1|1635309_1636725_+	replicative DNA helicase	NA	O80281	Escherichia_phage	77.9	1.8e-199
WP_038636265.1|1636870_1637950_+	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	28.5	1.2e-28
WP_038636267.1|1638084_1639278_+	aromatic amino acid transaminase	NA	NA	NA	NA	NA
WP_038636269.1|1639523_1640237_+	acid phosphatase AphA	NA	NA	NA	NA	NA
WP_038636271.1|1640363_1640720_+	MmcQ/YjbR family DNA-binding protein	NA	NA	NA	NA	NA
WP_038636273.1|1640805_1643628_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	55.6	5.2e-312
WP_003826621.1|1643879_1644404_+	single-stranded DNA-binding protein SSB1	NA	A0A0A0P1Q9	Enterobacteria_phage	94.5	1.1e-53
>prophage 126
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	1648366	1649716	5099034		Moraxella_phage(100.0%)	1	NA	NA
WP_038636284.1|1648366_1649716_+	guanine/hypoxanthine transporter GhxP	NA	A0A0R6PHV4	Moraxella_phage	71.1	5.2e-159
>prophage 127
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	1655896	1657855	5099034		Staphylococcus_phage(100.0%)	1	NA	NA
WP_038636301.1|1655896_1657855_-	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	41.3	4.6e-92
>prophage 128
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	1675170	1684767	5099034		Escherichia_phage(40.0%)	11	NA	NA
WP_038636350.1|1675170_1676694_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	23.9	1.8e-11
WP_038636353.1|1676808_1679073_+	hybrid sensor histidine kinase/response regulator	NA	NA	NA	NA	NA
WP_038636356.1|1679142_1679472_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038636359.1|1679627_1679930_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A222YWE2	Escherichia_phage	77.0	2.2e-41
WP_038636361.1|1679949_1680291_+	HigA family addiction module antidote protein	NA	A0A222YWD7	Escherichia_phage	81.8	6.2e-45
WP_038636364.1|1680342_1681101_-	phosphonate metabolism protein PhnP	NA	NA	NA	NA	NA
WP_038636367.1|1681109_1681544_-	aminoalkylphosphonate N-acetyltransferase	NA	NA	NA	NA	NA
WP_038636371.1|1681530_1682085_-	ribose 1,5-bisphosphokinase	NA	NA	NA	NA	NA
WP_038636374.1|1682087_1683224_-	alpha-D-ribose 1-methylphosphonate 5-triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_038636377.1|1683220_1683901_-	phosphonate C-P lyase system protein PhnL	NA	F2Y2R6	Organic_Lake_phycodnavirus	27.7	1.2e-07
WP_038636380.1|1684008_1684767_-	phosphonate C-P lyase system protein PhnK	NA	G3M9Y6	Bacillus_virus	27.8	3.0e-15
>prophage 129
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	1690348	1691137	5099034		Pithovirus(100.0%)	1	NA	NA
WP_038636408.1|1690348_1691137_-	phosphonate ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	29.3	5.0e-13
>prophage 130
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	1697705	1699208	5099034		Burkholderia_virus(100.0%)	1	NA	NA
WP_038636419.1|1697705_1699208_+	glycine betaine/L-proline transporter ProP	NA	Q6JIH2	Burkholderia_virus	31.7	1.2e-55
>prophage 131
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	1729563	1731547	5099034		Cronobacter_phage(50.0%)	2	NA	NA
WP_000027827.1|1729563_1729857_+	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	43.3	1.2e-12
WP_006686275.1|1729900_1731547_+	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.3	1.3e-188
>prophage 132
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	1736453	1736987	5099034		Morganella_phage(100.0%)	1	NA	NA
WP_038636486.1|1736453_1736987_-	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	54.8	7.2e-48
>prophage 133
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	1742888	1743866	5099034		Tupanvirus(100.0%)	1	NA	NA
WP_003830517.1|1742888_1743866_+	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	29.1	8.1e-29
>prophage 134
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	1751232	1751778	5099034		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_006686300.1|1751232_1751778_+	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.4	5.0e-28
>prophage 135
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	1755844	1759039	5099034		Vibrio_phage(50.0%)	2	NA	NA
WP_038636515.1|1755844_1757176_+	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	29.6	2.5e-17
WP_038636518.1|1757185_1759039_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.0	1.7e-59
>prophage 136
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	1764493	1768935	5099034		Pithovirus(50.0%)	3	NA	NA
WP_003025606.1|1764493_1765792_+	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.6	2.9e-66
WP_038636528.1|1766008_1766434_+	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_038636531.1|1766472_1768935_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	32.5	2.7e-65
>prophage 137
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	1789627	1791199	5099034		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_038636596.1|1789627_1791199_+	Tar ligand binding domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	32.9	8.2e-15
>prophage 138
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	1806927	1814702	5099034		uncultured_Caudovirales_phage(50.0%)	7	NA	NA
WP_038636623.1|1806927_1807455_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.9	3.2e-56
WP_038636626.1|1807764_1808721_+	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_038636628.1|1808849_1810352_+	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	29.9	6.2e-12
WP_038642975.1|1810365_1811388_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_038636631.1|1811374_1812376_+	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_074458528.1|1812479_1813592_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	32.7	2.2e-14
WP_032940279.1|1813703_1814702_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.4	2.8e-69
>prophage 139
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	1839908	1849016	5099034		Vibrio_phage(40.0%)	8	NA	NA
WP_038636701.1|1839908_1842431_+	type VI secretion system ATPase TssH	NA	A0A2I7SAX5	Vibrio_phage	31.6	8.9e-80
WP_129694863.1|1842456_1843092_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038636704.1|1843239_1843488_+	plasmid stabilization protein	NA	NA	NA	NA	NA
WP_038636706.1|1843477_1843759_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	60.2	5.2e-21
WP_038636709.1|1843785_1845750_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	29.4	3.4e-42
WP_038636711.1|1845749_1846271_+	toxin-antitoxin system YwqK family antitoxin	NA	NA	NA	NA	NA
WP_038636713.1|1846292_1846757_-	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	K4F9T1	Cronobacter_phage	57.7	1.1e-52
WP_038636715.1|1846877_1849016_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.9	2.2e-268
>prophage 140
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	1852702	1856747	5099034		Enterobacteria_phage(50.0%)	2	NA	NA
WP_038636723.1|1852702_1853650_-	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	21.2	3.9e-12
WP_038636726.1|1854038_1856747_+	magnesium-translocating P-type ATPase	NA	M1HM40	Paramecium_bursaria_Chlorella_virus	27.5	4.5e-45
>prophage 141
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	1861018	1861954	5099034		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_038636743.1|1861018_1861954_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	39.2	2.5e-51
>prophage 142
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	1872881	1881827	5099034	tRNA	Klosneuvirus(33.33%)	6	NA	NA
WP_038636776.1|1872881_1875737_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.9	6.7e-140
WP_038636780.1|1875736_1876180_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_038636783.1|1876324_1877836_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.4	1.0e-46
WP_038636786.1|1878102_1879203_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_038636788.1|1879202_1880285_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_038642982.1|1880324_1881827_-	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.3	3.0e-83
>prophage 143
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	1887004	1889795	5099034	integrase	Tupanvirus(50.0%)	2	1883683:1883695	1896657:1896669
1883683:1883695	attL	GGGTCAGCAGTTT	NA	NA	NA	NA
WP_038636806.1|1887004_1888024_-	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L7I1	Tupanvirus	32.0	4.2e-44
WP_038636809.1|1888538_1889795_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	41.4	5.8e-80
1896657:1896669	attR	AAACTGCTGACCC	NA	NA	NA	NA
>prophage 144
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	1893947	1896746	5099034		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_038636823.1|1893947_1896746_-	DEAD/DEAH box helicase family protein	NA	A0A2H4J643	uncultured_Caudovirales_phage	27.8	1.6e-45
>prophage 145
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	1910049	1910871	5099034		Yersinia_phage(100.0%)	1	NA	NA
WP_038636852.1|1910049_1910871_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	37.6	1.4e-45
>prophage 146
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	1927850	1932270	5099034		Ostreococcus_tauri_virus(50.0%)	4	NA	NA
WP_038636887.1|1927850_1929326_+	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	31.8	6.9e-48
WP_038636895.1|1929459_1930233_+	Uxu operon transcriptional regulator	NA	NA	NA	NA	NA
WP_038636898.1|1930870_1931074_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038636901.1|1931262_1932270_+	porin	NA	Q1MVN1	Enterobacteria_phage	49.6	1.1e-84
>prophage 147
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	1951284	1952946	5099034		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_038636951.1|1951284_1952946_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	72.3	6.0e-08
>prophage 148
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	1956181	1957204	5099034		Tupanvirus(100.0%)	1	NA	NA
WP_038636961.1|1956181_1957204_+	zinc-binding alcohol dehydrogenase family protein	NA	A0A2K9L7I1	Tupanvirus	25.3	1.0e-10
>prophage 149
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	1964220	1965282	5099034		Tupanvirus(100.0%)	1	NA	NA
WP_038636971.1|1964220_1965282_+	SIS domain-containing protein	NA	A0A2K9KZ81	Tupanvirus	24.8	1.0e-13
>prophage 150
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	1969422	1970702	5099034		Shigella_phage(50.0%)	2	NA	NA
WP_038636979.1|1969422_1970160_-	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	50.8	3.8e-63
WP_006686572.1|1970162_1970702_-	primosomal protein DnaT	NA	T1SA92	Salmonella_phage	61.7	4.9e-28
>prophage 151
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	1981925	1984729	5099034		Streptococcus_phage(50.0%)	3	NA	NA
WP_006686587.1|1981925_1983515_+	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	25.5	1.2e-29
WP_038636996.1|1983822_1984440_+	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_003019081.1|1984567_1984729_+	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	66.0	2.8e-11
>prophage 152
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	1990296	1991619	5099034		Geobacillus_virus(100.0%)	1	NA	NA
WP_038637008.1|1990296_1991619_+	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.3	5.7e-78
>prophage 153
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	1998146	2003273	5099034		Enterococcus_phage(33.33%)	3	NA	NA
WP_038637017.1|1998146_1999379_+	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	44.3	9.1e-86
WP_038637020.1|1999460_2001128_-	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.6	1.1e-41
WP_038637023.1|2001335_2003273_+	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	36.2	1.6e-12
>prophage 154
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	2007212	2008637	5099034		Ectocarpus_siliculosus_virus(100.0%)	1	NA	NA
WP_038637036.1|2007212_2008637_+	two-component system sensor histidine kinase CreC	NA	Q8QKV7	Ectocarpus_siliculosus_virus	21.4	3.0e-08
>prophage 155
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	2019834	2020788	5099034		Synechococcus_phage(100.0%)	1	NA	NA
WP_038637054.1|2019834_2020788_+	transaldolase	NA	A0A0E3G6C9	Synechococcus_phage	34.4	1.7e-10
>prophage 156
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	2025202	2035102	5099034	tRNA	Chrysochromulina_ericina_virus(25.0%)	8	NA	NA
WP_038637064.1|2025202_2027125_+	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	50.3	1.9e-146
WP_032940353.1|2027212_2028346_+	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	34.9	1.1e-29
WP_038637066.1|2028554_2029721_+	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	51.8	2.0e-90
WP_038637068.1|2029759_2030659_+	transcriptional activator NhaR	NA	NA	NA	NA	NA
WP_038637070.1|2030717_2030981_-	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_071888087.1|2031086_2031302_+	DUF2575 family protein	NA	NA	NA	NA	NA
WP_038637072.1|2031309_2032248_+	bifunctional riboflavin kinase/FAD synthetase	NA	NA	NA	NA	NA
WP_038637074.1|2032285_2035102_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L9X8	Tupanvirus	26.0	2.3e-76
>prophage 157
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	2041277	2042426	5099034		Halovirus(100.0%)	1	NA	NA
WP_038637089.1|2041277_2042426_+	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	33.2	6.3e-49
>prophage 158
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	2047910	2053521	5099034		Hepacivirus(50.0%)	4	NA	NA
WP_038637099.1|2047910_2049464_-	crotonobetaine/carnitine-CoA ligase	NA	Q75ZG1	Hepacivirus	24.6	1.5e-29
WP_038637101.1|2049526_2050744_-	L-carnitine CoA-transferase	NA	NA	NA	NA	NA
WP_003018898.1|2050826_2051969_-	crotonobetainyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_038637104.1|2052003_2053521_-	L-carnitine/gamma-butyrobetaine antiport BCCT transporter	NA	A0A2I7QNT1	Vibrio_phage	22.2	1.4e-08
>prophage 159
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	2061851	2063270	5099034		Bacillus_phage(50.0%)	2	NA	NA
WP_003018873.1|2061851_2062331_+	type 3 dihydrofolate reductase	NA	A0A219UQN5	Bacillus_phage	47.1	3.0e-29
WP_038637114.1|2062421_2063270_-	bis(5'-nucleosyl)-tetraphosphatase (symmetrical) ApaH	NA	A0A0A0YWI7	Pseudomonas_phage	45.3	1.1e-05
>prophage 160
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	2070998	2076433	5099034		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_038637132.1|2070998_2073905_-	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	37.9	1.7e-21
WP_038637136.1|2074081_2076433_-	DNA polymerase II	NA	A0A1B2RW58	Lymphocystis_disease_virus	25.1	2.5e-15
>prophage 161
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	2083583	2084291	5099034		Bacillus_virus(100.0%)	1	NA	NA
WP_038637159.1|2083583_2084291_-	thiamine ABC transporter ATP-binding protein ThiQ	NA	G3M9Y6	Bacillus_virus	37.8	2.2e-23
>prophage 162
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	2097145	2098870	5099034		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_071888094.1|2097145_2098870_+	acetolactate synthase 3 large subunit	NA	E5ERI2	Ostreococcus_lucimarinus_virus	25.7	3.0e-34
>prophage 163
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	2124963	2126007	5099034		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_038637240.1|2124963_2126007_+	GMP reductase	NA	A0A0N9Q9A5	Chrysochromulina_ericina_virus	55.3	1.2e-102
>prophage 164
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	2130275	2130839	5099034		Sphingobium_phage(100.0%)	1	NA	NA
WP_038637254.1|2130275_2130839_+	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	31.0	2.8e-10
>prophage 165
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	2141907	2143332	5099034		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_003018686.1|2141907_2143332_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.9	4.6e-41
>prophage 166
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	2154261	2162158	5099034		Escherichia_phage(25.0%)	7	NA	NA
WP_038637298.1|2154261_2155029_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	36.6	4.7e-32
WP_003018667.1|2155039_2155387_-	YacC family pilotin-like protein	NA	NA	NA	NA	NA
WP_038637303.1|2155540_2157151_+	multicopper oxidase CueO	NA	A0A0C6DWA2	Mamastrovirus	53.2	6.2e-18
WP_038642994.1|2157236_2159627_-	glucose/quinate/shikimate family membrane-bound PQQ-dependent dehydrogenase	NA	NA	NA	NA	NA
WP_042312274.1|2159830_2160367_+	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.1	3.0e-17
WP_038637306.1|2160460_2161123_-	carbonate dehydratase	NA	NA	NA	NA	NA
WP_038637310.1|2161231_2162158_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	32.7	4.1e-22
>prophage 167
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	2167626	2174446	5099034	tRNA	Bacillus_virus(50.0%)	6	NA	NA
WP_071888105.1|2167626_2169042_-	polynucleotide adenylyltransferase PcnB	NA	G3MAR3	Bacillus_virus	35.9	5.4e-26
WP_038637339.1|2169092_2169989_-|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_003018625.1|2170059_2170515_-	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
WP_038637342.1|2170692_2171397_-	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
WP_038637344.1|2171412_2171943_-	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
WP_071888108.1|2171971_2174446_+	ATP-dependent helicase HrpB	NA	A0A0U2UIE6	Niemeyer_virus	30.4	3.7e-38
>prophage 168
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	2179724	2180522	5099034		Planktothrix_phage(100.0%)	1	NA	NA
WP_038637358.1|2179724_2180522_+	Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC	NA	G9BWD6	Planktothrix_phage	27.8	2.1e-14
>prophage 169
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	2186457	2186802	5099034		Lake_Baikal_phage(100.0%)	1	NA	NA
WP_006686771.1|2186457_2186802_+	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	50.5	1.0e-26
>prophage 170
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	2190804	2192238	5099034	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_005132129.1|2190804_2192238_+|protease	serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	29.8	2.1e-25
>prophage 171
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	2203773	2204532	5099034		Flavobacterium_phage(100.0%)	1	NA	NA
WP_032940405.1|2203773_2204532_+	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	41.5	9.4e-25
>prophage 172
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	2213342	2217446	5099034		Emiliania_huxleyi_virus(50.0%)	2	NA	NA
WP_038637421.1|2213342_2213939_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.3	4.6e-27
WP_038637424.1|2213963_2217446_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.8	7.0e-208
>prophage 173
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	2229485	2230517	5099034		Planktothrix_phage(100.0%)	1	NA	NA
WP_038637459.1|2229485_2230517_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	5.5e-36
>prophage 174
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	2236962	2237766	5099034		Indivirus(100.0%)	1	NA	NA
WP_038637465.1|2236962_2237766_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	35.0	1.3e-37
>prophage 175
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	2241812	2246011	5099034		uncultured_Caudovirales_phage(33.33%)	5	NA	NA
WP_038637483.1|2241812_2243171_-	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	9.9e-09
WP_038637485.1|2243242_2243998_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_038637488.1|2244031_2244754_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_038637491.1|2244750_2245218_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	59.1	1.9e-52
WP_038642996.1|2245282_2246011_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	41.1	6.2e-42
>prophage 176
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	2261600	2264883	5099034		Caulobacter_phage(50.0%)	4	NA	NA
WP_016149592.1|2261600_2262182_+	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	30.8	7.4e-14
WP_038637544.1|2262293_2263061_+	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_038637546.1|2263031_2263772_-	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_038637549.1|2264121_2264883_+	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	39.2	7.0e-20
>prophage 177
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	2278326	2278722	5099034		Hokovirus(100.0%)	1	NA	NA
WP_038637597.1|2278326_2278722_+	adenylyltransferase/cytidyltransferase family protein	NA	A0A1V0SGE7	Hokovirus	47.8	5.6e-29
>prophage 178
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	2282320	2285990	5099034		Catovirus(100.0%)	2	NA	NA
WP_038637608.1|2282320_2283397_-	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	38.8	1.2e-14
WP_038637611.1|2283428_2285990_-	glycosyltransferase	NA	A0A1V0SAN7	Catovirus	37.3	2.3e-30
>prophage 179
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	2314261	2317972	5099034		Streptococcus_phage(66.67%)	3	NA	NA
WP_038637692.1|2314261_2315317_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	59.0	3.0e-114
WP_038637695.1|2315606_2316710_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	39.6	2.0e-60
WP_038637698.1|2316721_2317972_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	46.5	3.4e-96
>prophage 180
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	2331644	2332181	5099034		Salmonella_phage(100.0%)	1	NA	NA
WP_038637727.1|2331644_2332181_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1B0VBR9	Salmonella_phage	36.1	6.6e-17
>prophage 181
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	2342873	2391577	5099034	protease,plate,head,capsid,tail,terminase,integrase,transposase	Pseudomonas_phage(30.56%)	67	2339083:2339097	2371013:2371027
2339083:2339097	attL	TGGCCGCAGGGAAAA	NA	NA	NA	NA
WP_038637754.1|2342873_2343602_-	helix-turn-helix domain-containing protein	NA	A5X9F5	Aeromonas_virus	37.1	2.7e-21
WP_038637756.1|2343800_2344064_+	helix-turn-helix domain-containing protein	NA	F6MII4	Haemophilus_phage	66.7	8.0e-24
WP_051594504.1|2344068_2346126_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A2D1GNK9	Pseudomonas_phage	47.9	4.6e-167
WP_038637759.1|2346137_2347031_+	AAA family ATPase	NA	A0A2D1GNS0	Pseudomonas_phage	59.8	4.7e-100
WP_051594505.1|2347041_2347332_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038637762.1|2347344_2347551_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038637765.1|2347540_2348185_+	DUF3164 family protein	NA	A4JWM8	Burkholderia_virus	61.7	2.5e-71
WP_038637769.1|2348186_2348420_+	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_032663812.1|2348409_2348601_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038637773.1|2348681_2349401_+	DUF2786 domain-containing protein	NA	A0A2P9JZH4	Alteromonadaceae_phage	32.9	5.6e-27
WP_051594506.1|2349397_2349877_+	hypothetical protein	NA	Q5G8V2	Enterobacteria_phage	43.5	2.8e-19
WP_038637777.1|2349873_2350134_+	DUF4752 family protein	NA	T1S9K2	Salmonella_phage	71.4	6.9e-28
WP_155268627.1|2350130_2350301_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038637780.1|2350300_2350675_+	DUF4406 domain-containing protein	NA	A0A1V0E824	Vibrio_phage	50.0	4.5e-20
WP_023063185.1|2350667_2350883_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071884826.1|2351060_2351276_+	hypothetical protein	NA	A0A2D1GNS9	Pseudomonas_phage	57.7	3.1e-18
WP_038637791.1|2351337_2351814_+	regulatory protein GemA	NA	A0A2D1GNN4	Pseudomonas_phage	62.2	2.8e-43
WP_023311913.1|2351758_2352193_+	hypothetical protein	NA	A0A2D1GNW5	Pseudomonas_phage	47.0	5.2e-28
WP_038637800.1|2352192_2352705_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038637804.1|2352783_2353428_+	glycoside hydrolase family 19 protein	NA	A0A248XCW5	Klebsiella_phage	56.3	4.3e-63
WP_038637807.1|2353424_2353688_+	DUF2644 domain-containing protein	NA	A0A2D1GNW8	Pseudomonas_phage	57.3	3.7e-13
WP_038643028.1|2353653_2354286_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000171281.1|2354294_2354537_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021567611.1|2354533_2354818_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038637812.1|2354819_2355320_+	DUF1804 family protein	NA	L7P7L4	Pseudomonas_phage	53.4	5.2e-48
WP_038637815.1|2355312_2355522_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038637818.1|2355526_2357179_+|terminase	phage terminase large subunit	terminase	H6V8N6	Pseudomonas_phage	66.3	3.4e-213
WP_038637820.1|2357181_2358750_+	DUF935 domain-containing protein	NA	A0A0U5KSI0	unidentified_phage	44.8	2.1e-127
WP_038637823.1|2358736_2359996_+|capsid	minor capsid protein	capsid	A0A0M4UTA3	Ralstonia_phage	34.8	6.7e-52
WP_038637825.1|2359992_2360535_+	phage virion morphogenesis protein	NA	A0A2H4J9E5	uncultured_Caudovirales_phage	37.1	4.8e-23
WP_024238605.1|2360651_2360861_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038637831.1|2360916_2362032_+|protease	phage protease	protease	A0A2D1GNS3	Pseudomonas_phage	43.3	5.5e-58
WP_032663798.1|2362043_2362436_+	hypothetical protein	NA	J9RWG0	Pseudomonas_phage	45.0	1.7e-22
WP_038637834.1|2362449_2363358_+|head	Mu-like prophage major head subunit gpT family protein	head	A0A2H4J778	uncultured_Caudovirales_phage	63.5	2.2e-105
WP_038637837.1|2363357_2363765_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021567602.1|2363768_2364197_+	DUF1320 family protein	NA	A0A1B0T6F3	Thiobacimonas_phage	35.1	5.1e-12
WP_038637840.1|2364196_2364856_+	DUF1834 family protein	NA	A0A0M3LQJ7	Mannheimia_phage	35.4	3.2e-21
WP_038637843.1|2364842_2365064_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038637846.1|2365050_2366469_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	B7SDP8	Haemophilus_phage	42.0	1.0e-85
WP_023311695.1|2366482_2366857_+	hypothetical protein	NA	F6MIK8	Haemophilus_phage	54.9	9.6e-31
WP_038637851.1|2366857_2367250_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038637854.1|2367384_2369553_+|tail	phage tail tape measure protein	tail	A0A0M3LPB6	Mannheimia_phage	35.8	7.0e-73
WP_038637856.1|2369549_2370881_+	DNA circularization N-terminal domain-containing protein	NA	A0A2H4JGT4	uncultured_Caudovirales_phage	26.2	7.4e-33
WP_038637859.1|2370864_2372082_+|tail	tail protein	tail	A0A2H4J9E6	uncultured_Caudovirales_phage	37.9	2.4e-75
2371013:2371027	attR	TTTTCCCTGCGGCCA	NA	NA	NA	NA
WP_038637862.1|2372065_2372671_+|plate	phage baseplate assembly protein	plate	F6MIL4	Haemophilus_phage	56.4	2.0e-30
WP_038637864.1|2372760_2373111_+	phage GP46 family protein	NA	A0A2H4JDR8	uncultured_Caudovirales_phage	60.0	4.5e-30
WP_038637866.1|2373110_2374178_+|plate	baseplate J/gp47 family protein	plate	F6MIL6	Haemophilus_phage	43.3	4.8e-67
WP_038637869.1|2374174_2374747_+	DUF2313 domain-containing protein	NA	F6MIL7	Haemophilus_phage	42.2	3.2e-33
WP_155268628.1|2374746_2375862_+	hypothetical protein	NA	A0A0U3E1R2	Pseudomonas_phage	32.3	5.1e-19
WP_038637872.1|2375861_2376143_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080700401.1|2376135_2376387_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	68.5	2.4e-22
WP_038637874.1|2376553_2377108_+	recombinase family protein	NA	K7PJT4	Enterobacteria_phage	81.3	9.4e-83
WP_038637877.1|2377818_2378211_-	VOC family protein	NA	NA	NA	NA	NA
WP_038637880.1|2378242_2378497_-	Zn-finger protein	NA	NA	NA	NA	NA
WP_038637881.1|2378795_2379968_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_038637884.1|2379980_2381432_-	Na+/H+ antiporter NhaC	NA	NA	NA	NA	NA
WP_038637887.1|2381572_2382583_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_038637888.1|2382684_2383296_-	LysE family translocator	NA	NA	NA	NA	NA
WP_038637891.1|2383532_2384339_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_038637894.1|2384455_2384905_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_038637897.1|2385031_2386501_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_069323885.1|2386845_2386935_-	cytochrome bd-II oxidase subunit CbdX	NA	NA	NA	NA	NA
WP_038637900.1|2386948_2388085_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_038637903.1|2388102_2389641_-	cytochrome bd-II oxidase subunit 1	NA	NA	NA	NA	NA
WP_038637904.1|2389731_2390589_-	hydrogenase expression/formation protein	NA	NA	NA	NA	NA
WP_038637907.1|2390585_2390990_-	hydrogenase-1 operon protein HyaE	NA	NA	NA	NA	NA
WP_038637910.1|2390995_2391577_-|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
>prophage 182
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	2428930	2436893	5099034		Staphylococcus_phage(33.33%)	5	NA	NA
WP_038637989.1|2428930_2430817_+	propionate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	29.4	1.8e-53
WP_038637992.1|2430863_2431136_-	YceK/YidQ family lipoprotein	NA	NA	NA	NA	NA
WP_038637995.1|2431291_2432545_-	MFS transporter	NA	NA	NA	NA	NA
WP_038637998.1|2432602_2435680_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	80.6	0.0e+00
WP_129694859.1|2435801_2436893_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	81.5	9.3e-159
>prophage 183
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	2463595	2469038	5099034		Micromonas_sp._RCC1109_virus(66.67%)	5	NA	NA
WP_038638040.1|2463595_2464546_+	acetaldehyde dehydrogenase (acetylating)	NA	E5EQ71	Micromonas_sp._RCC1109_virus	36.7	9.6e-35
WP_038638043.1|2464542_2465556_+	4-hydroxy-2-oxovalerate aldolase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	30.8	2.7e-43
WP_038643046.1|2465624_2466836_+	3-(3-hydroxy-phenyl)propionate transporter MhpT	NA	NA	NA	NA	NA
WP_038638046.1|2466950_2467877_+	homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_038638049.1|2467991_2469038_-	ferric ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.2	3.1e-34
>prophage 184
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	2477085	2477853	5099034		Planktothrix_phage(100.0%)	1	NA	NA
WP_038638074.1|2477085_2477853_+	taurine ABC transporter ATP-binding subunit	NA	G9BWD6	Planktothrix_phage	39.1	5.6e-25
>prophage 185
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	2494447	2495563	5099034		Bacillus_phage(100.0%)	1	NA	NA
WP_051594509.1|2494447_2495563_+	diguanylate cyclase AdrA	NA	A0A127AWB9	Bacillus_phage	35.5	9.6e-18
>prophage 186
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	2499274	2509101	5099034		Bacillus_phage(60.0%)	7	NA	NA
WP_003021479.1|2499274_2500186_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	64.3	2.7e-103
WP_038638141.1|2500277_2501186_+	fructokinase	NA	NA	NA	NA	NA
WP_038643051.1|2501192_2502362_-	MFS transporter AraJ	NA	NA	NA	NA	NA
WP_038638144.1|2502526_2505676_-	exonuclease subunit SbcC	NA	G3MAB6	Bacillus_virus	26.4	3.8e-11
WP_038638145.1|2505672_2506875_-	exonuclease subunit SbcD	NA	R4JGS2	Bacillus_phage	37.6	3.7e-07
WP_003021496.1|2507065_2507755_+	phosphate response regulator transcription factor PhoB	NA	W8CYM9	Bacillus_phage	38.9	2.0e-37
WP_038638149.1|2507805_2509101_+	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	29.2	2.2e-26
>prophage 187
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	2525419	2535038	5099034	tRNA	uncultured_Mediterranean_phage(50.0%)	11	NA	NA
WP_003021535.1|2525419_2526547_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.3	1.6e-89
WP_003021544.1|2526569_2526902_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	33.0	2.8e-10
WP_071888113.1|2526929_2528777_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_038638190.1|2528787_2529759_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	37.8	1.4e-44
WP_038638193.1|2529937_2530303_+	VOC family protein	NA	NA	NA	NA	NA
WP_038638197.1|2530326_2531019_+	YafY family transcriptional regulator	NA	A0A1B0RXM1	Streptococcus_phage	29.0	6.6e-17
WP_003021561.1|2531064_2531928_-	nucleoside-specific channel-forming protein Tsx	NA	NA	NA	NA	NA
WP_038638200.1|2532226_2532766_-	DUF3251 domain-containing protein	NA	NA	NA	NA	NA
WP_016152032.1|2532920_2533370_+	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_038638204.1|2533373_2534477_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	35.8	1.5e-52
WP_003021575.1|2534567_2535038_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	47.4	7.8e-30
>prophage 188
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	2546071	2546590	5099034		Escherichia_phage(100.0%)	1	NA	NA
WP_038643054.1|2546071_2546590_+	4Fe-4S dicluster domain-containing protein	NA	A0A077SL61	Escherichia_phage	38.3	7.8e-31
>prophage 189
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	2562576	2567622	5099034	protease	Agrobacterium_phage(25.0%)	4	NA	NA
WP_032939995.1|2562576_2563200_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	63.4	4.9e-64
WP_003831013.1|2563326_2564601_+|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.4	1.9e-131
WP_038638272.1|2564785_2567140_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.5	9.4e-225
WP_003021629.1|2567349_2567622_+	DNA-binding protein HU-beta	NA	A7KV42	Bacillus_phage	58.4	1.5e-20
>prophage 190
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	2570846	2571542	5099034		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_038638285.1|2570846_2571542_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	68.0	3.2e-88
>prophage 191
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	2575951	2579495	5099034		Bacillus_phage(100.0%)	2	NA	NA
WP_038638295.1|2575951_2577724_+	SmdA family multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.1	1.6e-46
WP_038638298.1|2577716_2579495_+	SmdB family multidrug efflux ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.3	4.1e-39
>prophage 192
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	2591630	2594780	5099034		Leptospira_phage(100.0%)	1	NA	NA
WP_038638345.1|2591630_2594780_-	multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	23.5	1.4e-53
>prophage 193
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	2600320	2611215	5099034	transposase	Sodalis_phage(20.0%)	12	NA	NA
WP_038638355.1|2600320_2601244_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	55.0	9.2e-67
WP_006685679.1|2601313_2601481_-	pleiotropic regulatory protein RsmS	NA	NA	NA	NA	NA
WP_038638358.1|2601495_2602023_-	primosomal replication protein N''	NA	NA	NA	NA	NA
WP_038638360.1|2602092_2602470_+	DUF454 family protein	NA	NA	NA	NA	NA
WP_006685676.1|2602664_2603216_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	47.3	3.2e-30
WP_038638363.1|2603333_2605262_+	DNA polymerase III subunit gamma/tau	NA	E7DN81	Pneumococcus_phage	41.5	3.0e-43
WP_003021764.1|2605319_2605649_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_003021767.1|2605648_2606254_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_038638366.1|2606364_2608239_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	36.7	2.9e-115
WP_003021773.1|2608470_2609115_+	adenylate kinase	NA	NA	NA	NA	NA
WP_038638369.1|2609296_2610259_+	ferrochelatase	NA	NA	NA	NA	NA
WP_038638372.1|2610255_2611215_-	acetyl esterase	NA	A0A2L2DMU8	Acanthamoeba_polyphaga_mimivirus	27.5	7.7e-16
>prophage 194
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	2619396	2621898	5099034		uncultured_virus(100.0%)	1	NA	NA
WP_038638391.1|2619396_2621898_-	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	38.4	2.0e-116
>prophage 195
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	2627042	2627720	5099034		Bacillus_virus(100.0%)	1	NA	NA
WP_038638402.1|2627042_2627720_+	iron ABC transporter ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	34.4	6.8e-27
>prophage 196
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	2630870	2631557	5099034		Planktothrix_phage(100.0%)	1	NA	NA
WP_038638411.1|2630870_2631557_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.8	1.8e-30
>prophage 197
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	2636428	2637445	5099034		Planktothrix_phage(100.0%)	1	NA	NA
WP_038638422.1|2636428_2637445_+	virulence-associated ABC transporter ATP-binding protein SfbB	NA	G9BWD6	Planktothrix_phage	39.1	5.1e-34
>prophage 198
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	2641879	2643661	5099034		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_038638436.1|2641879_2643661_+	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	27.2	1.1e-39
>prophage 199
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	2651117	2652266	5099034		Streptococcus_phage(100.0%)	1	NA	NA
WP_038638454.1|2651117_2652266_+	glycerate 3-kinase	NA	W6LM47	Streptococcus_phage	41.4	7.7e-47
>prophage 200
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	2663665	2666871	5099034	tRNA	Moumouvirus(50.0%)	4	NA	NA
WP_038638484.1|2663665_2665051_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.4	1.6e-46
WP_038638488.1|2665141_2665666_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_016152124.1|2665790_2666003_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_003021887.1|2666004_2666871_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	36.5	1.2e-28
>prophage 201
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	2677034	2680968	5099034		Morganella_phage(33.33%)	5	NA	NA
WP_038638520.1|2677034_2677463_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	47.9	1.6e-26
WP_038638523.1|2677626_2678430_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_038638526.1|2678513_2678723_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038638528.1|2678843_2680295_-	Cu(+)/Ag(+) sensor histidine kinase	NA	A0A1V0SGX0	Hokovirus	26.7	7.3e-10
WP_038638530.1|2680284_2680968_-	copper response regulator transcription factor CusR	NA	W8CYM9	Bacillus_phage	36.0	6.0e-31
>prophage 202
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	2684306	2689918	5099034		Leptospira_phage(50.0%)	3	NA	NA
WP_038638543.1|2684306_2687450_+	CusA/CzcA family heavy metal efflux RND transporter	NA	S5VTK5	Leptospira_phage	22.2	2.7e-57
WP_038638546.1|2687502_2688357_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_038638549.1|2688592_2689918_+	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	46.3	1.4e-103
>prophage 203
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	2693768	2703107	5099034		Escherichia_phage(100.0%)	1	NA	NA
WP_038638564.1|2693768_2703107_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	23.4	1.5e-10
>prophage 204
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	2708731	2710111	5099034		Mycobacterium_phage(100.0%)	1	NA	NA
WP_129695026.1|2708731_2710111_-	MFS transporter	NA	A0A0M3UL24	Mycobacterium_phage	30.8	6.1e-30
>prophage 205
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	2721620	2729709	5099034		Tupanvirus(33.33%)	5	NA	NA
WP_038638611.1|2721620_2725511_+	enterobactin non-ribosomal peptide synthetase EntF	NA	A0A2K9KZV5	Tupanvirus	29.0	9.3e-60
WP_038638614.1|2725739_2726873_+	LPS O-antigen length regulator	NA	NA	NA	NA	NA
WP_038638617.1|2726918_2727716_-	iron-enterobactin ABC transporter ATP-binding protein	NA	A0A1V0SJ29	Klosneuvirus	22.5	1.9e-07
WP_114140310.1|2727712_2728702_-	iron-enterobactin ABC transporter permease	NA	NA	NA	NA	NA
WP_038638624.1|2728701_2729709_-	Fe(3+)-siderophore ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	25.2	4.4e-14
>prophage 206
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	2742106	2743932	5099034		uncultured_marine_virus(50.0%)	2	NA	NA
WP_038638649.1|2742106_2742724_-	ParB-like nuclease domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	54.8	4.6e-54
WP_038638652.1|2742708_2743932_-	phosphoadenosine phosphosulfate reductase	NA	A0A220GKF8	Streptococcus_phage	33.3	1.2e-58
>prophage 207
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	2747050	2750953	5099034		Bacillus_virus(50.0%)	3	NA	NA
WP_038638660.1|2747050_2748616_+	alkyl hydroperoxide reductase subunit F	NA	G3MA85	Bacillus_virus	33.7	3.2e-43
WP_071888118.1|2748717_2749278_-	desulfoferrodoxin	NA	NA	NA	NA	NA
WP_038638663.1|2749291_2750953_-	medium-chain fatty-acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	25.7	2.2e-34
>prophage 208
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	2762187	2764322	5099034		Morganella_phage(50.0%)	3	NA	NA
WP_016152215.1|2762187_2762616_-	universal stress protein UspG	NA	A0A1W6JNV4	Morganella_phage	39.2	2.8e-18
WP_005120853.1|2762804_2763215_-	nucleoside diphosphate kinase regulator	NA	NA	NA	NA	NA
WP_038638697.1|2763491_2764322_+	alpha/beta hydrolase	NA	W8EHU1	Mycobacterium_phage	31.2	6.0e-17
>prophage 209
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	2778172	2778817	5099034		Morganella_phage(50.0%)	2	NA	NA
WP_000034825.1|2778172_2778382_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	2.7e-22
WP_003831281.1|2778433_2778817_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	52.6	3.4e-23
>prophage 210
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	2782422	2784871	5099034		Stx2-converting_phage(50.0%)	2	NA	NA
WP_038638745.1|2782422_2783634_-	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	47.9	1.3e-100
WP_038638749.1|2783776_2784871_-	endolytic peptidoglycan transglycosylase RlpA	NA	F5B3X9	Synechococcus_phage	53.2	4.7e-09
>prophage 211
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	2793030	2798205	5099034	tRNA	Staphylococcus_phage(50.0%)	4	NA	NA
WP_110498575.1|2793030_2795613_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	42.7	1.2e-185
WP_038638764.1|2795848_2796331_+	zinc ribbon-containing protein	NA	NA	NA	NA	NA
WP_038638767.1|2796427_2797363_-	pyrimidine-specific ribonucleoside hydrolase RihA	NA	NA	NA	NA	NA
WP_000631392.1|2797479_2798205_-	glutamate/aspartate ABC transporter ATP binding protein GltL	NA	G9BWD6	Planktothrix_phage	38.1	1.9e-30
>prophage 212
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	2804048	2805134	5099034		Pseudomonas_phage(100.0%)	1	NA	NA
WP_087857137.1|2804048_2805134_-	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	46.6	3.3e-47
>prophage 213
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	2809036	2810701	5099034		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_038638793.1|2809036_2810701_-	asparagine synthase B	NA	A9YVS6	Ostreococcus_tauri_virus	39.9	1.6e-85
>prophage 214
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	2815343	2832229	5099034	tRNA	Vibrio_phage(16.67%)	16	NA	NA
WP_038638803.1|2815343_2817293_+	PTS N-acetyl glucosamine transporter subunit IIABC	NA	A0A2I7SAJ6	Vibrio_phage	48.6	1.4e-08
WP_038638804.1|2817479_2819147_+|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	94.4	0.0e+00
WP_038638807.1|2819580_2820987_+	chitoporin	NA	NA	NA	NA	NA
WP_038638809.1|2821036_2821369_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038638812.1|2821413_2822709_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	34.4	2.6e-59
WP_038638814.1|2822762_2823902_-	tricarballylate utilization 4Fe-4S protein TcuB	NA	NA	NA	NA	NA
WP_038638817.1|2823888_2825292_-	FAD-dependent tricarballylate dehydrogenase TcuA	NA	A0A2P0ZL82	Lactobacillus_phage	25.8	8.7e-08
WP_038638820.1|2825389_2826316_-	tricarballylate utilization LysR family transcriptional regulator TcuR	NA	NA	NA	NA	NA
WP_003022836.1|2826443_2826890_-	ferric iron uptake transcriptional regulator	NA	NA	NA	NA	NA
WP_110498567.1|2826882_2826969_-	ryhB-regulated fur leader peptide	NA	NA	NA	NA	NA
WP_006685496.1|2827179_2827755_-	flavodoxin FldA	NA	NA	NA	NA	NA
WP_038643079.1|2827865_2828153_-	LexA regulated protein	NA	NA	NA	NA	NA
WP_038638825.1|2828281_2829055_-	esterase	NA	A0A1J0GVH7	Mycobacterium_phage	35.4	3.4e-06
WP_038638828.1|2829248_2829791_+	replication initiation negative regulator SeqA	NA	NA	NA	NA	NA
WP_038638831.1|2829815_2831456_+	alpha-D-glucose phosphate-specific phosphoglucomutase	NA	NA	NA	NA	NA
WP_038638835.1|2831551_2832229_-	two-component system response regulator KdpE	NA	W8CYM9	Bacillus_phage	32.0	2.6e-26
>prophage 215
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	2835495	2837544	5099034		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_038638844.1|2835495_2837544_-	potassium-transporting ATPase subunit KdpB	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	24.3	2.4e-30
>prophage 216
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	2840909	2844960	5099034	transposase	Hokovirus(33.33%)	3	NA	NA
WP_038638854.1|2840909_2842328_+	deoxyribodipyrimidine photo-lyase	NA	A0A1V0SGL1	Hokovirus	33.6	7.8e-65
WP_038638856.1|2842489_2843428_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	53.6	2.7e-66
WP_038638859.1|2843478_2844960_-	dipeptide permease DtpD	NA	A0A0P0IY73	Acinetobacter_phage	27.2	6.1e-44
>prophage 217
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	2850750	2851542	5099034		Kaumoebavirus(100.0%)	1	NA	NA
WP_038638879.1|2850750_2851542_+	endonuclease VIII	NA	A0A1V0CNR6	Kaumoebavirus	30.4	5.8e-09
>prophage 218
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	2891491	2895006	5099034		Vibrio_phage(33.33%)	4	NA	NA
WP_038638959.1|2891491_2892211_+	nicotinamide riboside transporter PnuC	NA	A0A126HGA3	Vibrio_phage	33.6	8.9e-25
WP_038638962.1|2892207_2893149_-	CDF family zinc transporter ZitB	NA	A0A1V0SED0	Indivirus	28.0	4.9e-23
WP_038638965.1|2893262_2893637_-	YbgS-like family protein	NA	NA	NA	NA	NA
WP_038638968.1|2893953_2895006_+	3-deoxy-7-phosphoheptulonate synthase AroG	NA	S4W5F1	Pandoravirus	49.0	3.4e-81
>prophage 219
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	2899340	2905905	5099034		Tupanvirus(33.33%)	7	NA	NA
WP_038638984.1|2899340_2900357_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	45.1	1.3e-77
WP_038638987.1|2900574_2902047_-	molybdate ABC transporter ATP-binding protein ModF	NA	A0A1M7XV31	Cedratvirus	27.1	1.0e-11
WP_038638991.1|2902114_2902903_-	molybdenum-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_003023026.1|2903033_2903183_+	multidrug efflux pump-associated protein, AcrZ family	NA	NA	NA	NA	NA
WP_038638993.1|2903381_2904155_+	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_038638996.1|2904154_2904844_+	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_038638999.1|2904846_2905905_+	molybdenum ABC transporter ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	33.8	2.0e-20
>prophage 220
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	2914267	2917707	5099034		Catovirus(50.0%)	3	NA	NA
WP_038639024.1|2914267_2915788_+	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	40.0	1.1e-80
WP_038639028.1|2915883_2916360_-	kinase inhibitor	NA	NA	NA	NA	NA
WP_038639031.1|2916417_2917707_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	28.0	5.3e-20
>prophage 221
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	2924140	2925049	5099034		Streptococcus_phage(100.0%)	1	NA	NA
WP_038639050.1|2924140_2925049_-	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	30.7	3.5e-26
>prophage 222
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	2934715	2945083	5099034		Anomala_cuprea_entomopoxvirus(25.0%)	9	NA	NA
WP_038639084.1|2934715_2936452_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	31.2	5.1e-18
WP_038639088.1|2936444_2937440_-	secretion protein HlyD	NA	NA	NA	NA	NA
WP_038639092.1|2937436_2938102_-	transcriptional regulator CecR	NA	NA	NA	NA	NA
WP_038639094.1|2938323_2939664_+	ATP-dependent RNA helicase RhlE	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	34.0	4.9e-53
WP_038639097.1|2939760_2941911_+	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	27.3	3.7e-42
WP_038639100.1|2941939_2942908_+	DNA-binding protein YbiB	NA	NA	NA	NA	NA
WP_051594512.1|2943071_2944202_+	malate/lactate/ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
WP_006685371.1|2944254_2944515_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_003831562.1|2944816_2945083_-	DksA/TraR family C4-type zinc finger protein	NA	A0A2C9CZU7	Yersinia_phage	52.3	4.7e-16
>prophage 223
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	2948976	2954213	5099034		Planktothrix_phage(33.33%)	6	NA	NA
WP_038639112.1|2948976_2949699_-	glutamine ABC transporter ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	41.1	2.8e-34
WP_006685364.1|2949695_2950355_-	glutamine ABC transporter permease GlnP	NA	NA	NA	NA	NA
WP_038639115.1|2950491_2951238_-	glutamine ABC transporter substrate-binding protein GlnH	NA	NA	NA	NA	NA
WP_038639118.1|2951603_2952107_-	DNA starvation/stationary phase protection protein Dps	NA	A0A222YYG6	Streptomyces_phage	28.1	4.2e-05
WP_038639121.1|2952410_2953298_-	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
WP_003035257.1|2953697_2954213_+	outer membrane protein OmpX	NA	A5LH44	Enterobacteria_phage	33.7	1.9e-16
>prophage 224
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	2959281	2960877	5099034		Tupanvirus(100.0%)	1	NA	NA
WP_038639134.1|2959281_2960877_+	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.5	1.1e-59
>prophage 225
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	2968557	2973794	5099034	transposase	Citrobacter_phage(33.33%)	4	NA	NA
WP_038639151.1|2968557_2970990_-	glycyl radical protein	NA	A0A076YHZ7	Citrobacter_phage	50.9	2.3e-08
WP_038639154.1|2970995_2971895_-	glycyl-radical enzyme activating protein	NA	NA	NA	NA	NA
WP_038639157.1|2972027_2972690_+	fructose-6-phosphate aldolase	NA	A0A1D8KKK9	Synechococcus_phage	31.3	8.5e-22
WP_038639160.1|2972864_2973794_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	52.4	1.1e-64
>prophage 226
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	2977932	2979804	5099034		Planktothrix_phage(100.0%)	1	NA	NA
WP_038639174.1|2977932_2979804_+	glutathione ABC transporter ATP-binding protein GsiA	NA	G9BWD6	Planktothrix_phage	27.2	2.8e-14
>prophage 227
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	2987437	2989447	5099034		Stx2-converting_phage(50.0%)	2	NA	NA
WP_032940149.1|2987437_2988640_+	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	47.1	1.7e-97
WP_038639198.1|2988688_2989447_-	DNA-binding transcriptional repressor DeoR	NA	A0A077SK06	Escherichia_phage	28.8	2.6e-14
>prophage 228
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	3000108	3009552	5099034		Vibrio_phage(25.0%)	11	NA	NA
WP_016152408.1|3000108_3000372_-	glutaredoxin, GrxA family	NA	A0A2I7SAE2	Vibrio_phage	67.9	5.0e-26
WP_038639228.1|3000545_3000836_+	YbjC family protein	NA	NA	NA	NA	NA
WP_038639231.1|3000819_3001542_+	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_038639233.1|3001599_3002502_+	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	34.0	8.2e-36
WP_038639236.1|3002592_3003069_+	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_038639239.1|3003502_3004615_+	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_038639242.1|3004753_3005887_+	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.9	2.2e-30
WP_038639245.1|3005896_3006850_+	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_038639247.1|3006846_3007692_+	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_038639250.1|3007751_3008240_+	YbjO family protein	NA	NA	NA	NA	NA
WP_038639253.1|3008424_3009552_+	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.1	2.3e-27
>prophage 229
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	3013840	3030306	5099034	tRNA	Bacillus_phage(25.0%)	10	NA	NA
WP_038639270.1|3013840_3015562_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	24.0	7.3e-17
WP_038639271.1|3015562_3017329_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	25.3	1.6e-22
WP_003831889.1|3017443_3018412_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.3	1.9e-62
WP_002439523.1|3018959_3019454_+	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_038639280.1|3019588_3023566_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	49.2	2.8e-88
WP_038639282.1|3023677_3024289_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_038639284.1|3024299_3025643_+	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	41.3	1.5e-81
WP_003836908.1|3025734_3027027_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	46.1	2.5e-94
WP_038639287.1|3027233_3029678_+	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	50.6	3.0e-221
WP_038639290.1|3029688_3030306_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	5.6e-76
>prophage 230
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	3033563	3036772	5099034		Tetraselmis_virus(100.0%)	2	NA	NA
WP_003035751.1|3033563_3034304_-	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	1.0e-20
WP_006685273.1|3034489_3036772_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.8	3.2e-161
>prophage 231
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	3040895	3041984	5099034		Streptococcus_phage(100.0%)	1	NA	NA
WP_038639304.1|3040895_3041984_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.5	4.5e-81
>prophage 232
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	3046137	3050677	5099034		Bacillus_phage(100.0%)	3	NA	NA
WP_003035780.1|3046137_3046422_+	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	39.1	9.2e-10
WP_038639309.1|3046627_3048892_+	ComEC family protein	NA	NA	NA	NA	NA
WP_038639312.1|3048928_3050677_+	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	30.7	1.9e-60
>prophage 233
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	3065406	3065955	5099034		Rhodobacter_phage(100.0%)	1	NA	NA
WP_003831948.1|3065406_3065955_+	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	32.6	3.5e-05
>prophage 234
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	3069137	3072678	5099034		uncultured_Caudovirales_phage(66.67%)	4	NA	NA
WP_011787801.1|3069137_3070628_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	82.2	8.6e-224
WP_011787802.1|3070662_3071517_+	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	48.6	1.3e-67
WP_011787803.1|3071607_3071940_+	TraR/DksA C4-type zinc finger protein	NA	NA	NA	NA	NA
WP_011787804.1|3072057_3072678_-	recombinase family protein	NA	A0A286S1P7	Klebsiella_phage	37.1	1.7e-24
>prophage 235
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	3077678	3084165	5099034	tRNA	Bandra_megavirus(33.33%)	4	NA	NA
WP_038639361.1|3077678_3079079_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	35.5	2.2e-80
WP_038639364.1|3079244_3080447_-	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_038639369.1|3080713_3083326_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	21.8	2.4e-19
WP_038639372.1|3083397_3084165_-	aliphatic sulfonates ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.0	2.0e-30
>prophage 236
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	3092932	3094840	5099034		Tupanvirus(100.0%)	1	NA	NA
WP_038639409.1|3092932_3094840_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.3	4.6e-52
>prophage 237
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	3107413	3109468	5099034		Bacillus_phage(100.0%)	1	NA	NA
WP_038639439.1|3107413_3109468_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	1.4e-19
>prophage 238
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	3122711	3128470	5099034	protease	Shigella_phage(50.0%)	5	NA	NA
WP_003035917.1|3122711_3123371_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	8.9e-48
WP_038639484.1|3123640_3125269_+	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_038639487.1|3125743_3127186_-	glucosyltransferase domain-containing protein	NA	A0A192Y7W8	Salmonella_phage	22.6	8.3e-14
WP_038639491.1|3127187_3128111_-	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	81.7	4.0e-147
WP_038639494.1|3128107_3128470_-	GtrA family protein	NA	U5P0S6	Shigella_phage	55.0	1.3e-32
>prophage 239
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	3132696	3133623	5099034		Klosneuvirus(100.0%)	1	NA	NA
WP_038639512.1|3132696_3133623_-	curved DNA-binding protein	NA	A0A1V0SIM1	Klosneuvirus	40.0	4.2e-11
>prophage 240
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	3142546	3142720	5099034		Enterobacteria_phage(100.0%)	1	NA	NA
WP_032939912.1|3142546_3142720_+	general stress protein	NA	Q9KX95	Enterobacteria_phage	92.6	1.4e-05
>prophage 241
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	3155496	3157746	5099034		Erwinia_phage(50.0%)	3	NA	NA
WP_110498396.1|3155496_3156405_+	phosphate starvation-inducible protein PhoH	NA	A0A1B2ICF6	Erwinia_phage	70.4	6.9e-91
WP_038639571.1|3156454_3156748_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038639573.1|3157122_3157746_+	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	A0A2R8FG22	Brazilian_cedratvirus	28.8	2.7e-09
>prophage 242
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	3165098	3172257	5099034		Escherichia_phage(33.33%)	6	NA	NA
WP_129695001.1|3165098_3167618_+	trimethylamine-N-oxide reductase TorA	NA	A0A077SK27	Escherichia_phage	31.1	2.9e-86
WP_038639605.1|3168452_3169391_+	glyoxylate/hydroxypyruvate reductase GhrA	NA	A0A1B1IVB5	uncultured_Mediterranean_phage	29.4	1.1e-06
WP_038639608.1|3169477_3170215_+	phosphatase	NA	NA	NA	NA	NA
WP_038639611.1|3170238_3170793_+	molecular chaperone	NA	NA	NA	NA	NA
WP_038639615.1|3170894_3171377_+	DUF1097 domain-containing protein	NA	NA	NA	NA	NA
WP_003036082.1|3171423_3172257_-	curli production assembly/transport protein CsgG	NA	M1ICK2	Pelagibacter_phage	39.7	3.0e-40
>prophage 243
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	3176438	3176981	5099034		Scale_drop_disease_virus(100.0%)	1	NA	NA
WP_038639630.1|3176438_3176981_+	O-acetyl-ADP-ribose deacetylase	NA	A0A0K1L687	Scale_drop_disease_virus	42.4	3.2e-27
>prophage 244
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	3185283	3188976	5099034		Bacillus_phage(50.0%)	3	NA	NA
WP_038643109.1|3185283_3186615_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	34.8	1.3e-18
WP_038639648.1|3186679_3187900_-	multidrug efflux MFS transporter MdtG	NA	NA	NA	NA	NA
WP_038639653.1|3188055_3188976_-	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferasee	NA	A0A1W6JP29	Morganella_phage	41.6	1.7e-57
>prophage 245
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	3193695	3193941	5099034		Enterobacteria_phage(100.0%)	1	NA	NA
WP_006685106.1|3193695_3193941_-	DNA damage-inducible protein I	NA	K7PM44	Enterobacteria_phage	50.0	8.2e-15
>prophage 246
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	3209173	3210124	5099034		Brevibacillus_phage(100.0%)	1	NA	NA
WP_038639713.1|3209173_3210124_+	flagellar assembly peptidoglycan hydrolase FlgJ	NA	S5M633	Brevibacillus_phage	30.9	1.3e-10
>prophage 247
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	3224716	3225843	5099034		Trichoplusia_ni_ascovirus(50.0%)	2	NA	NA
WP_006685074.1|3224716_3225451_+	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	34.1	7.7e-16
WP_000103754.1|3225606_3225843_+	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	45.2	1.5e-10
>prophage 248
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	3229130	3229772	5099034		Pseudomonas_phage(100.0%)	1	NA	NA
WP_038639762.1|3229130_3229772_+	dTMP kinase	NA	Q2Z0N0	Pseudomonas_phage	38.2	1.3e-27
>prophage 249
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	3233486	3235265	5099034		Acinetobacter_phage(100.0%)	1	NA	NA
WP_038639771.1|3233486_3235265_-	aminopeptidase P family protein	NA	A0A0P0I8D7	Acinetobacter_phage	33.9	1.7e-80
>prophage 250
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	3261706	3261964	5099034		Erwinia_phage(100.0%)	1	NA	NA
WP_029139491.1|3261706_3261964_+	DUF1471 domain-containing protein	NA	A0A1B2IFR9	Erwinia_phage	35.7	3.6e-05
>prophage 251
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	3269248	3276888	5099034		Mycoplasma_phage(50.0%)	8	NA	NA
WP_038639849.1|3269248_3269950_+	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	40.3	3.2e-35
WP_038639852.1|3269949_3271194_+	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
WP_038639855.1|3271212_3272124_+	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
WP_038639858.1|3272139_3272961_+	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	1.9e-23
WP_003030797.1|3273060_3274107_-	spermidine/putrescine ABC transporter substrate-binding protein PotD	NA	NA	NA	NA	NA
WP_006684943.1|3274134_3274914_-	spermidine/putrescine ABC transporter permease PotC	NA	NA	NA	NA	NA
WP_038639863.1|3274910_3275768_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	25.4	4.3e-10
WP_038639864.1|3275751_3276888_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	40.1	5.5e-29
>prophage 252
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	3282696	3283179	5099034		Enterobacteria_phage(100.0%)	1	NA	NA
WP_038643118.1|3282696_3283179_+	host specificity protein J	NA	Q9EYE7	Enterobacteria_phage	47.8	6.6e-32
>prophage 253
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	3286303	3290817	5099034		Klebsiella_phage(20.0%)	5	NA	NA
WP_038639888.1|3286303_3286546_-	DinI family protein	NA	Q6UAW0	Klebsiella_phage	76.6	9.9e-29
WP_038639891.1|3286623_3287043_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	55.1	3.0e-33
WP_038639894.1|3287044_3288313_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	82.0	2.6e-205
WP_038639897.1|3288305_3288977_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	60.8	1.6e-81
WP_038639900.1|3289446_3290817_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.6	6.1e-107
>prophage 254
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	3293952	3296239	5099034		Phage_21(50.0%)	2	NA	NA
WP_038639915.1|3293952_3295203_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	94.4	9.4e-22
WP_038639917.1|3295510_3296239_+	MerR family transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	44.8	3.9e-44
>prophage 255
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	3304683	3307636	5099034		Klebsiella_phage(33.33%)	5	NA	NA
WP_038639958.1|3304683_3304926_-	DinI family protein	NA	Q6UAW0	Klebsiella_phage	75.3	8.4e-28
WP_038639961.1|3305126_3305666_-	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	73.1	2.1e-39
WP_038639964.1|3305810_3306089_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038639967.1|3307010_3307217_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038643122.1|3307345_3307636_-	Bor family protein	NA	C6ZCX3	Enterobacteria_phage	52.6	1.4e-21
>prophage 256
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	3321391	3322417	5099034		Bacillus_virus(100.0%)	1	NA	NA
WP_038640019.1|3321391_3322417_-	sensor domain-containing diguanylate cyclase	NA	G3MA91	Bacillus_virus	26.1	5.5e-12
>prophage 257
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	3327346	3330275	5099034		Bacillus_phage(100.0%)	2	NA	NA
WP_038640038.1|3327346_3328837_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	28.3	6.8e-11
WP_038640041.1|3328991_3330275_-	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	26.6	3.2e-09
>prophage 258
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	3339372	3341998	5099034		Plodia_interpunctella_granulovirus(50.0%)	2	NA	NA
WP_038640069.1|3339372_3340626_-	glycoside hydrolase family 18 protein	NA	A0A1L5JGH0	Plodia_interpunctella_granulovirus	27.1	1.2e-24
WP_038640072.1|3340921_3341998_+	zinc-binding dehydrogenase	NA	A0A2P1EIJ9	Megavirus	24.5	8.1e-14
>prophage 259
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	3346281	3350340	5099034		Staphylococcus_phage(50.0%)	4	NA	NA
WP_038640078.1|3346281_3347265_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	24.4	1.9e-06
WP_032943120.1|3347400_3348159_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_038640079.1|3348299_3349658_+	MFS transporter	NA	NA	NA	NA	NA
WP_129694905.1|3349695_3350340_-	bifunctional nicotinamidase/pyrazinamidase	NA	A0A2K9L6K4	Tupanvirus	36.0	3.0e-16
>prophage 260
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	3357332	3359279	5099034		Streptococcus_phage(100.0%)	1	NA	NA
WP_038640087.1|3357332_3359279_+	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	29.4	1.2e-39
>prophage 261
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	3364302	3364935	5099034		Bacillus_phage(100.0%)	1	NA	NA
WP_038640099.1|3364302_3364935_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	32.8	3.1e-13
>prophage 262
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	3368162	3369227	5099034		Salmonella_phage(100.0%)	1	NA	NA
WP_016487843.1|3368162_3369227_+	DUF1016 family protein	NA	A0A0U2BZN7	Salmonella_phage	41.0	7.2e-23
>prophage 263
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	3373003	3381839	5099034		Yersinia_phage(25.0%)	11	NA	NA
WP_003092327.1|3373003_3373831_+	DUF945 domain-containing protein	NA	A0A2C9CYF8	Yersinia_phage	39.6	1.6e-46
WP_006379606.1|3373911_3375981_+	ParB N-terminal domain-containing protein	NA	G8DH78	Emiliania_huxleyi_virus	26.3	1.3e-20
WP_016487839.1|3376042_3376252_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001273857.1|3377022_3377337_+	DUF736 domain-containing protein	NA	NA	NA	NA	NA
WP_006379425.1|3377649_3377943_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016487838.1|3378230_3378578_+	DUF2958 domain-containing protein	NA	A0A1W6DX76	Sphingobium_phage	46.8	6.6e-18
WP_006379424.1|3378920_3379691_+	DUF2285 domain-containing protein	NA	NA	NA	NA	NA
WP_001247107.1|3379802_3380087_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_022652188.1|3380113_3380959_+	replication initiator protein A	NA	NA	NA	NA	NA
WP_071536585.1|3380973_3381204_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003092312.1|3381200_3381839_+	AAA family ATPase	NA	A0A2H4JGZ2	uncultured_Caudovirales_phage	40.0	3.5e-33
>prophage 264
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	3387474	3388263	5099034		Pithovirus(100.0%)	1	NA	NA
WP_028689679.1|3387474_3388263_-	ATP-binding cassette domain-containing protein	NA	W5SAS9	Pithovirus	29.4	1.2e-09
>prophage 265
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	3417842	3419063	5099034		Klosneuvirus(100.0%)	1	NA	NA
WP_038640138.1|3417842_3419063_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	28.5	8.5e-28
>prophage 266
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	3426546	3427377	5099034		Bacillus_virus(100.0%)	1	NA	NA
WP_038640152.1|3426546_3427377_-	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	55.7	2.0e-73
>prophage 267
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	3433526	3439277	5099034		Tupanvirus(33.33%)	5	NA	NA
WP_038640164.1|3433526_3435785_-	catalase HPII	NA	A0A2K9L572	Tupanvirus	48.2	1.7e-143
WP_071600734.1|3435977_3436241_+	cell division activator CedA	NA	NA	NA	NA	NA
WP_006684833.1|3436305_3437697_-	cystine/sulfocysteine:cation symporter	NA	NA	NA	NA	NA
WP_087050648.1|3437832_3438432_-	metal-dependent hydrolase	NA	A0A127AVX7	Bacillus_phage	34.3	3.5e-06
WP_038640166.1|3438515_3439277_-	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	33.7	2.2e-21
>prophage 268
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	3444525	3458282	5099034	tRNA	Tupanvirus(22.22%)	15	NA	NA
WP_032939806.1|3444525_3446454_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	36.9	1.1e-127
WP_048997935.1|3446457_3447000_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	8.2e-15
WP_003030583.1|3447096_3447294_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_003030578.1|3447348_3447705_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001386830.1|3447829_3447874_+	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_038640179.1|3448114_3449098_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.1e-33
WP_038640181.1|3449113_3451501_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_003030571.1|3451505_3451805_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
WP_038640182.1|3452085_3453066_+	vitamin B12 ABC transporter permease BtuC	NA	A0A2H4IY97	uncultured_Caudovirales_phage	24.8	6.7e-15
WP_038640185.1|3453127_3453679_+	glutathione peroxidase	NA	NA	NA	NA	NA
WP_038640187.1|3453678_3454428_+	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	28.2	1.6e-08
WP_038640189.1|3454505_3454970_+	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.2	3.5e-14
WP_038640192.1|3455288_3456002_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_038640194.1|3456063_3457506_+	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	37.1	2.4e-53
WP_038640197.1|3457502_3458282_-	heme ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	27.0	8.7e-10
>prophage 269
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	3463582	3470001	5099034		Pandoravirus(33.33%)	4	NA	NA
WP_038640209.1|3463582_3464629_-	3-deoxy-7-phosphoheptulonate synthase AroH	NA	A0A0B5IW14	Pandoravirus	47.1	8.8e-82
WP_038640212.1|3464755_3465589_-	posphoenolpyruvate synthetase regulatory kinase/phosphorylase PpsR	NA	NA	NA	NA	NA
WP_038640216.1|3465917_3468296_+	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	36.1	2.6e-169
WP_038640218.1|3468363_3470001_-	medium-chain fatty-acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	28.6	5.0e-31
>prophage 270
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	3496313	3501404	5099034		Lake_Baikal_phage(33.33%)	5	NA	NA
WP_038640259.1|3496313_3496682_+	Fe-S cluster assembly scaffold SufA	NA	A0A2H4N7N5	Lake_Baikal_phage	39.4	4.3e-15
WP_038640262.1|3496690_3498178_+	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_038640264.1|3498194_3498941_+	Fe-S cluster assembly ATPase SufC	NA	A0A1V0SE00	Indivirus	25.0	1.7e-07
WP_038640265.1|3498915_3500187_+	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_038640267.1|3500183_3501404_+	cysteine desulfurase SufS	NA	Q2XUY6	environmental_halophage	43.1	7.3e-96
>prophage 271
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	3505565	3512977	5099034		Escherichia_phage(66.67%)	6	NA	NA
WP_038640275.1|3505565_3506588_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	24.3	2.2e-13
WP_038640276.1|3506580_3507249_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_038640278.1|3507270_3508083_+	methionine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_038640280.1|3508161_3511227_-	tetrathionate reductase subunit TtrA	NA	A0A077SK27	Escherichia_phage	25.7	1.6e-06
WP_038640283.1|3511219_3512242_-	tetrathionate reductase subunit TtrC	NA	NA	NA	NA	NA
WP_038640285.1|3512242_3512977_-	tetrathionate reductase subunit TtrB	NA	A0A077SL61	Escherichia_phage	37.4	4.2e-22
>prophage 272
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	3519860	3524407	5099034		Escherichia_phage(33.33%)	6	NA	NA
WP_051594516.1|3519860_3520529_+	4Fe-4S dicluster domain-containing protein	NA	A0A077SL61	Escherichia_phage	39.1	1.4e-24
WP_038640300.1|3520525_3521311_+	thiosulfate reductase cytochrome B subunit	NA	NA	NA	NA	NA
WP_038640302.1|3521314_3522127_+	hypothetical protein	NA	A0A077K9W7	Edwardsiella_phage	33.8	1.0e-05
WP_038640304.1|3522136_3522814_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_038640306.1|3522803_3523589_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_038640309.1|3523588_3524407_-	amino acid ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	25.8	2.3e-13
>prophage 273
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	3535279	3541096	5099034		Streptococcus_phage(33.33%)	5	NA	NA
WP_038640329.1|3535279_3536755_-	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	25.1	2.2e-17
WP_038640330.1|3536861_3538124_+	4-aminobutyrate transaminase	NA	A0A1V0SKB7	Klosneuvirus	25.2	6.8e-20
WP_038640331.1|3538300_3539356_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_038640332.1|3539342_3540347_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_038640333.1|3540343_3541096_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	30.8	1.8e-07
>prophage 274
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	3545415	3547200	5099034		Bacillus_phage(100.0%)	1	NA	NA
WP_038640341.1|3545415_3547200_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	33.3	4.0e-18
>prophage 275
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	3555161	3566202	5099034		Bodo_saltans_virus(16.67%)	11	NA	NA
WP_038640357.1|3555161_3555860_+	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	32.1	8.7e-09
WP_038640359.1|3555898_3557272_-	multidrug efflux MATE transporter MdtK	NA	NA	NA	NA	NA
WP_038640361.1|3557489_3558131_+	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	37.3	1.5e-23
WP_038640363.1|3558178_3559327_-	cyclopropane fatty acyl phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	45.1	9.3e-85
WP_038640365.1|3559617_3560823_-	Bcr/CflA family multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_038640367.1|3560936_3561869_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_038640368.1|3561865_3562891_-	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	31.3	1.4e-31
WP_003029209.1|3563188_3563278_+	stress response protein YnhF	NA	NA	NA	NA	NA
WP_038640370.1|3563453_3564623_+	MFS transporter	NA	NA	NA	NA	NA
WP_003029205.1|3564662_3565244_-	superoxide dismutase [Fe]	NA	Q56AR7	Bacillus_thuringiensis_phage	46.0	3.4e-43
WP_038640372.1|3565371_3566202_-	C40 family peptidase	NA	A0A2H5BM69	Streptomyces_phage	41.6	2.4e-18
>prophage 276
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	3571304	3571829	5099034		Salmonella_phage(100.0%)	1	NA	NA
WP_038640384.1|3571304_3571829_+	superoxide dismutase [Cu-Zn] SodC2	NA	Q9MC02	Salmonella_phage	57.7	4.2e-48
>prophage 277
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	3578746	3580021	5099034	tRNA	Cronobacter_phage(100.0%)	1	NA	NA
WP_038640399.1|3578746_3580021_+|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	42.6	8.5e-87
>prophage 278
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	3610624	3611926	5099034		Bacillus_phage(100.0%)	1	NA	NA
WP_038640455.1|3610624_3611926_-	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	23.8	1.3e-13
>prophage 279
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	3631346	3633547	5099034		Bacillus_phage(50.0%)	2	NA	NA
WP_038640487.1|3631346_3632069_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.6	8.6e-36
WP_038640489.1|3632065_3633547_+	HAMP domain-containing histidine kinase	NA	A0A1V0SGX0	Hokovirus	28.4	1.2e-12
>prophage 280
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	3640128	3653107	5099034		Escherichia_phage(37.5%)	14	NA	NA
WP_038640503.1|3640128_3640743_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	38.1	3.3e-28
WP_038640505.1|3640785_3641640_-	dimethyl sulfoxide reductase anchor subunit family protein	NA	NA	NA	NA	NA
WP_038640507.1|3641641_3642259_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.1	1.2e-75
WP_038640509.1|3642269_3644708_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.4	1.3e-213
WP_129694949.1|3644861_3645170_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_038643159.1|3645273_3645984_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_038640513.1|3645990_3646551_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_038640515.1|3646588_3646930_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_038640517.1|3647082_3647409_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	53.9	1.7e-23
WP_003832907.1|3647516_3648731_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.2	7.4e-48
WP_038640519.1|3648744_3649764_+	Zn-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_038640521.1|3649817_3651197_+	MHS family MFS transporter	NA	Q6JIH2	Burkholderia_virus	26.8	3.9e-29
WP_038640524.1|3651361_3652828_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	30.2	4.2e-45
WP_038640526.1|3652903_3653107_-	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	2.2e-13
>prophage 281
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	3657164	3658091	5099034		Bacillus_phage(100.0%)	1	NA	NA
WP_038640534.1|3657164_3658091_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	35.9	7.2e-19
>prophage 282
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	3662918	3667413	5099034		Cedratvirus(33.33%)	6	NA	NA
WP_038640542.1|3662918_3663716_+	urea ABC transporter ATP-binding protein UrtD	NA	A0A1M7XV31	Cedratvirus	25.2	5.2e-10
WP_038640544.1|3663725_3664424_+	urea ABC transporter ATP-binding subunit UrtE	NA	A0A2H4PQG7	Staphylococcus_phage	25.7	1.7e-12
WP_038640546.1|3664464_3665652_-	efflux MFS transporter YdeE	NA	NA	NA	NA	NA
WP_038643162.1|3665850_3666750_+	O-acetylserine/cysteine exporter	NA	NA	NA	NA	NA
WP_038640548.1|3666783_3667002_-	multiple antibiotic resistance protein MarB	NA	NA	NA	NA	NA
WP_003032424.1|3667029_3667413_-	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	3.6e-09
>prophage 283
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	3679278	3683234	5099034	transposase	Staphylococcus_phage(50.0%)	3	NA	NA
WP_038640576.1|3679278_3680439_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	36.1	2.3e-38
WP_038640578.1|3680536_3680719_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038640580.1|3680924_3683234_+	N-acetylmuramidase family protein	NA	A0A142IF03	Pseudomonas_phage	38.9	2.0e-25
>prophage 284
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	3689831	3691775	5099034		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_038640594.1|3689831_3691775_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	30.3	1.1e-08
>prophage 285
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	3697662	3699583	5099034		Planktothrix_phage(100.0%)	2	NA	NA
WP_038640607.1|3697662_3698649_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.8	7.2e-17
WP_038640609.1|3698641_3699583_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.6	1.2e-13
>prophage 286
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	3710456	3712843	5099034		Streptococcus_phage(50.0%)	2	NA	NA
WP_038640634.1|3710456_3712172_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A1B0RXA0	Streptococcus_phage	25.4	1.9e-36
WP_038640636.1|3712243_3712843_-	inorganic diphosphatase	NA	A0A1B1ISK6	uncultured_Mediterranean_phage	39.9	1.5e-22
>prophage 287
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	3719192	3720272	5099034		Enterobacteria_phage(100.0%)	1	NA	NA
WP_038640648.1|3719192_3720272_+	porin OmpD	NA	Q1MVN1	Enterobacteria_phage	74.0	1.3e-149
>prophage 288
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	3728400	3729945	5099034		Escherichia_phage(100.0%)	1	NA	NA
WP_038640659.1|3728400_3729945_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	39.5	1.1e-19
>prophage 289
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	3733468	3735445	5099034		Tetraselmis_virus(100.0%)	1	NA	NA
WP_038640669.1|3733468_3735445_+	MBL fold metallo-hydrolase	NA	A0A2P0VMX1	Tetraselmis_virus	45.6	3.6e-161
>prophage 290
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	3738523	3739297	5099034		Bacillus_virus(100.0%)	1	NA	NA
WP_038640679.1|3738523_3739297_-	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.6	1.0e-18
>prophage 291
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	3745648	3747190	5099034		Salmonella_phage(100.0%)	1	NA	NA
WP_038640691.1|3745648_3747190_+	methyl-accepting chemotaxis protein	NA	A0A1B0V854	Salmonella_phage	54.3	2.0e-34
>prophage 292
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	3750636	3752757	5099034		Salmonella_phage(100.0%)	1	NA	NA
WP_038640698.1|3750636_3752757_+	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	67.6	3.2e-139
>prophage 293
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	3765594	3766722	5099034		Salmonella_phage(100.0%)	1	NA	NA
WP_038640722.1|3765594_3766722_+	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	22.9	4.4e-10
>prophage 294
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	3770104	3774531	5099034		Mycoplasma_phage(50.0%)	4	NA	NA
WP_038640730.1|3770104_3771121_-	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	58.9	2.5e-25
WP_038640732.1|3771137_3772283_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_038640734.1|3772612_3774022_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_087856629.1|3774114_3774531_-	type II toxin-antitoxin system HicB family antitoxin	NA	F1C593	Cronobacter_phage	55.6	3.1e-30
>prophage 295
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	3777973	3782675	5099034		Phage_TP(50.0%)	4	NA	NA
WP_038640746.1|3777973_3779935_-	U32 family peptidase	NA	Q6DW11	Phage_TP	27.8	2.1e-23
WP_038640748.1|3780014_3780551_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_038640751.1|3780656_3781823_+	benzoate/H(+) symporter BenE family transporter	NA	NA	NA	NA	NA
WP_038640753.1|3781805_3782675_-	AraC family transcriptional regulator	NA	A0A291LAM3	Bordetella_phage	46.1	9.4e-13
>prophage 296
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	3793764	3796741	5099034		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_038640777.1|3793764_3795453_-	Tar ligand binding domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	30.9	5.9e-19
WP_038640779.1|3795622_3796741_-	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	29.6	3.6e-33
>prophage 297
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	3802936	3805386	5099034		Salmonella_phage(33.33%)	3	NA	NA
WP_038640793.1|3802936_3804202_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	73.5	1.3e-183
WP_038640795.1|3804204_3804624_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	57.7	1.8e-33
WP_038640797.1|3804855_3805386_-	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	44.9	4.1e-19
>prophage 298
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	3809180	3813083	5099034		Klosneuvirus(100.0%)	1	NA	NA
WP_038640805.1|3809180_3813083_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.7	2.6e-54
>prophage 299
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	3818050	3819040	5099034		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_038640813.1|3818050_3819040_+	2-hydroxyacid dehydrogenase	NA	M1HMI7	Paramecium_bursaria_Chlorella_virus	43.1	8.6e-71
>prophage 300
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	3824017	3834562	5099034	tRNA	Enterobacteria_phage(14.29%)	11	NA	NA
WP_038640818.1|3824017_3825148_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	58.2	2.2e-115
WP_069324961.1|3825294_3825507_+	KTSC domain-containing protein	NA	NA	NA	NA	NA
WP_006684401.1|3825588_3826023_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.1	7.2e-30
WP_038640822.1|3826220_3827156_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	93.4	2.4e-139
WP_038640824.1|3827204_3828578_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	31.7	1.9e-52
WP_071888136.1|3828606_3828789_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038640826.1|3829063_3830047_-	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_038643181.1|3830201_3831311_-	chemoreceptor protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	21.7	4.3e-10
WP_038640831.1|3832024_3833257_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	37.2	1.2e-16
WP_038640833.1|3833269_3833833_-	DNA endonuclease SmrA	NA	NA	NA	NA	NA
WP_038640835.1|3834046_3834562_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	54.5	1.6e-23
>prophage 301
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	3838233	3843616	5099034		Tupanvirus(33.33%)	8	NA	NA
WP_038640844.1|3838233_3839286_-	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L7I1	Tupanvirus	46.7	9.2e-87
WP_038640846.1|3839315_3839945_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_038640848.1|3840116_3840500_-	VOC family protein	NA	NA	NA	NA	NA
WP_038640850.1|3840617_3841388_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	28.7	4.6e-19
WP_038640852.1|3841414_3841684_-	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_038640854.1|3841750_3841981_-	thioredoxin	NA	NA	NA	NA	NA
WP_038640857.1|3842097_3842661_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_038640858.1|3842746_3843616_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	43.2	2.7e-52
>prophage 302
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	3858801	3861294	5099034		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_080700409.1|3858801_3861294_-	lysozyme	NA	M1HAV4	Paramecium_bursaria_Chlorella_virus	30.7	3.6e-33
>prophage 303
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	3868358	3869441	5099034		Indivirus(100.0%)	1	NA	NA
WP_038640897.1|3868358_3869441_-	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	28.3	4.0e-13
>prophage 304
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	3883756	3886851	5099034		Trichoplusia_ni_ascovirus(50.0%)	5	NA	NA
WP_038640922.1|3883756_3884665_-	SDR family oxidoreductase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	53.0	7.4e-77
WP_071888139.1|3884841_3885420_-	2-oxo-tetronate isomerase	NA	NA	NA	NA	NA
WP_038640925.1|3885367_3885814_-	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_038640927.1|3885823_3886327_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038640929.1|3886458_3886851_+	YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	34.4	2.4e-08
>prophage 305
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	3890662	3892463	5099034		Planktothrix_phage(50.0%)	2	NA	NA
WP_003020556.1|3890662_3891655_+	peptide ABC transporter ATP-binding protein SapD	NA	G9BWD6	Planktothrix_phage	24.7	4.7e-08
WP_038640937.1|3891656_3892463_+	peptide ABC transporter ATP-binding protein SapF	NA	G3M9Y6	Bacillus_virus	27.4	1.3e-13
>prophage 306
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	3895868	3897803	5099034		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_038640943.1|3895868_3897803_+	exoribonuclease II	NA	A0A2H4UVB7	Bodo_saltans_virus	23.9	1.2e-07
>prophage 307
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	3905594	3906278	5099034		Staphylococcus_phage(100.0%)	1	NA	NA
WP_072276918.1|3905594_3906278_+	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.4	1.2e-42
>prophage 308
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	3911122	3988658	5099034	coat,protease,tail,terminase,holin,integrase,transposase	Escherichia_phage(29.82%)	87	3904672:3904687	3986169:3986184
3904672:3904687	attL	GCGCTTTATGCCTTCT	NA	NA	NA	NA
WP_038640964.1|3911122_3913720_-	type I DNA topoisomerase	NA	A0A2K9L1Q2	Tupanvirus	35.0	1.6e-87
WP_003020616.1|3914118_3914370_+	YciN family protein	NA	NA	NA	NA	NA
WP_038640966.1|3914478_3915525_-|protease	protease SohB	protease	NA	NA	NA	NA
WP_038640968.1|3915747_3916509_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	2.6e-06
WP_038640970.1|3916505_3917096_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_038640972.1|3917179_3918055_-	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_038640974.1|3918155_3918776_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_129694998.1|3918772_3919663_-	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_012905981.1|3919786_3919831_+	trp operon leader peptide	NA	NA	NA	NA	NA
WP_038640978.1|3919925_3921488_+	anthranilate synthase component 1	NA	NA	NA	NA	NA
WP_038640980.1|3921487_3923083_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	39.3	1.1e-51
WP_038643199.1|3923086_3924445_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.7	5.9e-38
WP_038640982.1|3924455_3925649_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_038640984.1|3925648_3926455_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_038640986.1|3926487_3927960_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	30.4	1.4e-16
WP_038640988.1|3928144_3928417_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038643201.1|3929120_3930701_+	phosphoethanolamine transferase	NA	NA	NA	NA	NA
WP_038640990.1|3930766_3931405_-	outer membrane protein OmpW	NA	NA	NA	NA	NA
WP_038640992.1|3931803_3932547_+	UPF0259 family protein	NA	NA	NA	NA	NA
WP_038640994.1|3932600_3933140_+	septation protein A	NA	NA	NA	NA	NA
WP_038640996.1|3933304_3933706_+	acyl-CoA thioester hydrolase YciA	NA	NA	NA	NA	NA
WP_038643203.1|3933793_3934510_-	TonB system transport protein TonB	NA	NA	NA	NA	NA
WP_006684292.1|3934734_3935031_+	YciI family protein	NA	NA	NA	NA	NA
WP_038640998.1|3935846_3937115_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	81.8	3.4e-205
WP_038641000.1|3937116_3937536_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	54.3	6.7e-33
WP_038641002.1|3937613_3937856_+	DinI family protein	NA	Q6UAW0	Klebsiella_phage	75.3	1.3e-28
WP_038641004.1|3937994_3939416_-	hypothetical protein	NA	A0A1V0E5M2	Salmonella_phage	49.2	1.0e-109
WP_038641006.1|3939425_3940370_-	hypothetical protein	NA	H6WRW5	Salmonella_phage	65.5	1.2e-117
WP_038641008.1|3940372_3943606_-	host specificity protein J	NA	G8C7R4	Escherichia_phage	70.8	0.0e+00
WP_038641010.1|3943661_3944261_-|tail	tail assembly protein	tail	G8C7R3	Escherichia_phage	92.0	2.5e-97
WP_038641012.1|3944248_3944980_-	C40 family peptidase	NA	G8C7R2	Escherichia_phage	91.8	3.4e-141
WP_038641014.1|3944992_3945766_-|tail	phage minor tail protein L	tail	G8C7R1	Escherichia_phage	89.0	3.6e-133
WP_038641016.1|3945774_3946125_-|tail	phage tail protein	tail	G8C7R0	Escherichia_phage	92.2	8.9e-55
WP_038641018.1|3946289_3946532_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129695011.1|3946722_3947106_-	hypothetical protein	NA	A0A286S1N7	Klebsiella_phage	43.4	7.1e-21
WP_114070829.1|3947180_3948941_-|tail	phage tail tape measure protein	tail	G8C7Q6	Escherichia_phage	62.5	1.1e-89
WP_019076573.1|3950311_3950599_-	DUF1799 domain-containing protein	NA	I6PD79	Cronobacter_phage	60.0	2.7e-17
WP_038641024.1|3950616_3950955_-	hypothetical protein	NA	G8C7Q5	Escherichia_phage	90.2	6.8e-52
WP_038641026.1|3950996_3951929_-	immunoglobulin domain-containing protein	NA	G8C7Q3	Escherichia_phage	91.3	3.1e-155
WP_038641028.1|3951975_3952425_-	DUF4128 domain-containing protein	NA	G8C7Q2	Escherichia_phage	76.5	6.3e-61
WP_038641030.1|3952414_3953014_-	hypothetical protein	NA	G8C7Q1	Escherichia_phage	87.4	1.9e-97
WP_038641032.1|3953016_3953370_-	hypothetical protein	NA	G8C7Q0	Escherichia_phage	84.6	3.9e-50
WP_038641034.1|3953371_3953854_-	hypothetical protein	NA	G8C7P9	Escherichia_phage	84.4	3.7e-75
WP_038641038.1|3954273_3955413_-|coat	coat protein	coat	G8C7P7	Escherichia_phage	83.8	1.1e-173
WP_016156687.1|3955430_3956183_-	hypothetical protein	NA	G8C7P6	Escherichia_phage	92.0	1.5e-123
WP_038641040.1|3956503_3957610_-	phage Mu F like family protein	NA	G8C7P5	Escherichia_phage	90.5	1.9e-188
WP_038641042.1|3957611_3959012_-	DUF4055 domain-containing protein	NA	G8C7P4	Escherichia_phage	93.8	1.1e-252
WP_038641044.1|3959016_3960321_-|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	60.0	7.5e-147
WP_038641046.1|3960298_3961294_-|terminase	terminase small subunit	terminase	I6X6R5	Burkholderia_virus	40.2	6.7e-39
WP_096755719.1|3961666_3962813_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	92.2	1.9e-146
WP_038641048.1|3962829_3963258_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038641050.1|3963344_3963863_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	50.0	5.8e-10
WP_038641052.1|3963859_3964408_-	lysozyme	NA	K7PM52	Enterobacteria_phage	95.6	6.4e-100
WP_001568784.1|3964379_3964658_-|holin	holin	holin	K7PGZ9	Enterobacteria_phage	97.8	5.1e-45
WP_038641055.1|3965059_3965749_-	antiterminator	NA	I6PDF8	Cronobacter_phage	57.1	1.8e-67
WP_129694979.1|3965745_3965877_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	93.9	1.1e-10
WP_129694980.1|3965873_3966494_-	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	65.7	1.2e-46
WP_038641057.1|3966478_3966898_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038641061.1|3967105_3967705_-	DUF1367 family protein	NA	K7PKS6	Enterobacteria_phage	95.0	6.5e-106
WP_001568777.1|3967739_3967988_-	hypothetical protein	NA	K7PHG9	Enterobacteria_phage	98.8	8.0e-42
WP_038641063.1|3968105_3968339_-	DinI-like family protein	NA	K7PM44	Enterobacteria_phage	96.1	2.8e-36
WP_038641067.1|3968700_3969483_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155268629.1|3969638_3969791_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038641069.1|3969787_3970063_-	hypothetical protein	NA	A0A077KAZ4	Edwardsiella_phage	87.1	1.4e-34
WP_038641071.1|3970179_3970398_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038641073.1|3970394_3970886_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038641075.1|3971424_3971736_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038641077.1|3971754_3972504_-	ATP-binding protein	NA	S4TNF5	Salmonella_phage	86.7	1.3e-122
WP_016156235.1|3972506_3973454_-	hypothetical protein	NA	G9L6A8	Escherichia_phage	30.7	3.8e-23
WP_038641079.1|3973621_3974161_-	toxin YdaT domain-containing protein	NA	K7PJT7	Enterobacteria_phage	95.0	2.0e-90
WP_038641081.1|3974163_3974397_-	helix-turn-helix domain-containing protein	NA	A0A0M4QX15	Salmonella_phage	90.9	1.2e-34
WP_038641083.1|3974500_3974887_+	helix-turn-helix domain-containing protein	NA	A0A0M4R5D1	Salmonella_phage	87.3	9.8e-55
WP_016066196.1|3975787_3976234_+	helix-turn-helix transcriptional regulator	NA	K7PKS0	Enterobacteria_phage	100.0	9.6e-78
WP_129694981.1|3976281_3976632_+	hypothetical protein	NA	K7PHF7	Enterobacteria_phage	99.1	7.0e-60
WP_032238386.1|3976666_3976861_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016156718.1|3977237_3977444_+	hypothetical protein	NA	K7P6H3	Enterobacteria_phage	98.5	1.6e-32
WP_038641087.1|3977756_3980564_+	PD-(D/E)XK nuclease-like domain-containing protein	NA	H6WRX1	Salmonella_phage	68.3	0.0e+00
WP_038641089.1|3980578_3981619_+	recombinase RecT	NA	K7PKR8	Enterobacteria_phage	75.9	4.5e-155
WP_019076930.1|3981657_3981900_+	DUF4060 family protein	NA	K7PHF4	Enterobacteria_phage	88.6	1.9e-32
WP_016156725.1|3981945_3982146_+	hypothetical protein	NA	K7PM28	Enterobacteria_phage	81.0	5.5e-25
WP_038641093.1|3982138_3983332_-|integrase	site-specific integrase	integrase	K7PGY1	Enterobacteria_phage	84.1	6.7e-203
WP_087856120.1|3983586_3983760_-	YciY family protein	NA	NA	NA	NA	NA
WP_038641094.1|3983902_3985363_+	cardiolipin synthase	NA	NA	NA	NA	NA
WP_003020691.1|3985397_3985727_+	YciU family protein	NA	NA	NA	NA	NA
WP_038641095.1|3985760_3986597_-	ion transporter	NA	A0A1B0Y2S3	Lactobacillus_phage	41.2	2.3e-08
3986169:3986184	attR	AGAAGGCATAAAGCGC	NA	NA	NA	NA
WP_006684288.1|3986643_3987648_-	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G3M9Y6	Bacillus_virus	30.7	6.8e-15
WP_038641097.1|3987644_3988658_-	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppD	NA	G9BWD6	Planktothrix_phage	29.4	4.5e-14
>prophage 309
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	3997205	4007615	5099034		Pectobacterium_bacteriophage(25.0%)	10	NA	NA
WP_038641106.1|3997205_3997823_-	thymidine kinase	NA	A0A0A0Q2F0	Pectobacterium_bacteriophage	52.7	1.9e-52
WP_003020723.1|3998453_3998867_+	DNA-binding transcriptional regulator H-NS	NA	NA	NA	NA	NA
WP_038641107.1|3999005_3999914_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	47.5	1.8e-59
WP_038641109.1|4000118_4001132_-	two-component system response regulator RssB	NA	NA	NA	NA	NA
WP_038641111.1|4001221_4002133_-	patatin-like phospholipase RssA	NA	NA	NA	NA	NA
WP_038641113.1|4002244_4002700_+	YchJ family protein	NA	NA	NA	NA	NA
WP_006684274.1|4002755_4003598_+	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	48.8	9.8e-15
WP_038641116.1|4004692_4005370_-	respiratory nitrate reductase subunit gamma	NA	NA	NA	NA	NA
WP_008784959.1|4005369_4006080_-	nitrate reductase molybdenum cofactor assembly chaperone	NA	NA	NA	NA	NA
WP_038641118.1|4006076_4007615_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	40.5	1.8e-19
>prophage 310
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	4019461	4019692	5099034		Mythimna_unipuncta_granulovirus(100.0%)	1	NA	NA
WP_038641135.1|4019461_4019692_-	putative cation transport regulator ChaB	NA	A0A1S5YE01	Mythimna_unipuncta_granulovirus	45.3	2.7e-07
>prophage 311
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	4024265	4028273	5099034		Cafeteria_roenbergensis_virus(50.0%)	5	NA	NA
WP_038641145.1|4024265_4025120_-	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	38.8	2.4e-45
WP_006684256.1|4025155_4025965_-	tetratricopeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_038641147.1|4025968_4026361_-	SirB family protein	NA	NA	NA	NA	NA
WP_038641149.1|4026357_4027191_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_038641152.1|4027190_4028273_-	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	38.8	4.3e-07
>prophage 312
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	4031518	4037215	5099034		Tupanvirus(33.33%)	4	NA	NA
WP_001518537.1|4031518_4032466_+	ribose-phosphate diphosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	8.6e-44
WP_071888142.1|4032590_4034273_+	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	22.4	6.3e-21
WP_038641161.1|4034350_4035814_-	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_038641163.1|4035829_4037215_-	diaminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	26.2	7.4e-28
>prophage 313
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	4045272	4046004	5099034		Enterobacteria_phage(100.0%)	1	NA	NA
WP_038641185.1|4045272_4046004_+	MerR family transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	49.2	4.2e-54
>prophage 314
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	4078668	4079954	5099034		Salmonella_phage(100.0%)	2	NA	NA
WP_038641234.1|4078668_4079031_+	GtrA family protein	NA	B9UDL8	Salmonella_phage	89.2	1.1e-52
WP_038641236.1|4079027_4079954_+	glycosyltransferase family 2 protein	NA	B9UDL7	Salmonella_phage	92.4	5.7e-157
>prophage 315
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	4090581	4144031	5099034	tRNA,protease,tail	Escherichia_phage(21.43%)	48	NA	NA
WP_123261005.1|4090581_4092267_-	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	25.1	2.2e-34
WP_038641259.1|4092471_4093056_-	Slp family lipoprotein	NA	NA	NA	NA	NA
WP_038641261.1|4093151_4093847_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_038641263.1|4093905_4095816_-	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	33.1	1.6e-92
WP_038641265.1|4095956_4096301_+	RidA family protein	NA	NA	NA	NA	NA
WP_003020986.1|4096307_4096487_-	YoaH family protein	NA	NA	NA	NA	NA
WP_038641267.1|4096570_4097932_+	aminodeoxychorismate synthase component 1	NA	S4VNU7	Pandoravirus	41.0	4.4e-41
WP_038641269.1|4097935_4098514_+	CoA pyrophosphatase	NA	NA	NA	NA	NA
WP_038641271.1|4098697_4100062_+	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_038641273.1|4100192_4101794_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_038641275.1|4101800_4103360_-	CNNM family cation transport protein YoaE	NA	A0A0R6PEZ3	Moraxella_phage	45.4	5.1e-41
WP_005122176.1|4103819_4104782_+	PTS mannose transporter subunit IIAB	NA	NA	NA	NA	NA
WP_005122174.1|4104840_4105641_+	PTS mannose/fructose/sorbose transporter subunit IIC	NA	NA	NA	NA	NA
WP_006684184.1|4105653_4106505_+	PTS mannose transporter subunit IID	NA	NA	NA	NA	NA
WP_038641277.1|4106565_4107024_+	DUF986 domain-containing protein	NA	NA	NA	NA	NA
WP_038641279.1|4107456_4108023_+	manganese efflux pump MntP	NA	NA	NA	NA	NA
WP_038641281.1|4108019_4108829_-	23S rRNA (guanine(745)-N(1))-methyltransferase	NA	NA	NA	NA	NA
WP_038641283.1|4108892_4110638_-	peptidoglycan glycosyltransferase FtsI	NA	NA	NA	NA	NA
WP_001062678.1|4110857_4111067_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
WP_006684179.1|4111079_4111223_-	YobF family protein	NA	NA	NA	NA	NA
WP_038641288.1|4111858_4112143_-	YebO family protein	NA	NA	NA	NA	NA
WP_038641290.1|4112217_4112361_-	PhoP/PhoQ regulator MgrB	NA	NA	NA	NA	NA
WP_038641292.1|4112525_4112765_+	membrane protein	NA	NA	NA	NA	NA
WP_038641294.1|4112879_4113671_-	DNA-binding transcriptional regulator KdgR	NA	NA	NA	NA	NA
WP_038641296.1|4113845_4115219_+	MFS transporter	NA	NA	NA	NA	NA
WP_003034964.1|4115265_4116147_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_038641299.1|4116339_4118388_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.4	2.0e-85
WP_003833781.1|4118407_4119094_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_038641301.1|4119190_4119688_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_038641303.1|4119816_4121100_+	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_038641305.1|4121068_4123702_+	PqiB family protein	NA	NA	NA	NA	NA
WP_071888146.1|4123781_4125203_+	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_003034943.1|4125300_4125540_+	DUF1480 family protein	NA	NA	NA	NA	NA
WP_032939629.1|4125642_4125834_+	YebW family protein	NA	NA	NA	NA	NA
WP_038641307.1|4125834_4126476_-	protein-serine/threonine phosphatase	NA	Q71TJ1	Escherichia_phage	49.8	3.3e-55
WP_038641309.1|4126549_4127830_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080700410.1|4128691_4129582_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_080700411.1|4131327_4131441_+	DinI-like family protein	NA	S4TND2	Salmonella_phage	81.1	3.6e-10
WP_038641313.1|4131721_4132021_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_038641316.1|4132711_4133323_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038641317.1|4133376_4133664_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038641319.1|4133951_4134683_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_038641321.1|4135596_4136181_-	DUF4376 domain-containing protein	NA	Q7BQC6	Enterobacteria_phage	47.4	1.8e-47
WP_071888147.1|4136192_4138160_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A2D1UII2	Escherichia_phage	57.0	5.4e-24
WP_071888148.1|4141730_4142351_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	72.8	2.8e-67
WP_038641323.1|4142248_4142983_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	76.1	1.8e-113
WP_038641325.1|4142994_4143690_-|tail	phage minor tail protein L	tail	Q687F1	Enterobacteria_phage	72.3	3.5e-95
WP_038641327.1|4143698_4144031_-|tail	phage tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	67.9	9.1e-41
>prophage 316
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	4147333	4188780	5099034	head,tail,capsid,terminase,holin,integrase,portal,transposase	Klebsiella_phage(34.15%)	57	4159615:4159629	4190131:4190145
WP_038643231.1|4147333_4147564_-	hypothetical protein	NA	Q6UAW9	Klebsiella_phage	63.2	2.9e-22
WP_038641329.1|4147584_4147947_-|tail	phage tail protein	tail	Q6UAW8	Klebsiella_phage	56.8	4.8e-27
WP_038641331.1|4148008_4148491_-|tail	major tail shaft subunit	tail	Q6UAX0	Klebsiella_phage	80.6	1.0e-61
WP_038641333.1|4148524_4148926_-	HK97 gp10 family phage protein	NA	Q6UAX1	Klebsiella_phage	88.0	1.5e-58
WP_038641335.1|4148922_4149312_-	hypothetical protein	NA	Q6UAX2	Klebsiella_phage	64.5	8.7e-43
WP_003832373.1|4149280_4149631_-|head	phage head closure protein	head	Q6UAX3	Klebsiella_phage	75.7	2.4e-44
WP_003832371.1|4149627_4149945_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q6UAX4	Klebsiella_phage	79.6	2.8e-39
WP_038641337.1|4149925_4150303_-	hypothetical protein	NA	Q6UAX5	Klebsiella_phage	59.5	3.2e-18
WP_051594524.1|4150360_4151677_-|capsid	phage major capsid protein	capsid	Q6UAX6	Klebsiella_phage	87.1	1.7e-207
WP_038641339.1|4151750_4152671_-	S49 family peptidase	NA	Q6UAX7	Klebsiella_phage	79.1	2.1e-132
WP_038641341.1|4152708_4153968_-|portal	phage portal protein	portal	Q6UAX8	Klebsiella_phage	88.6	3.2e-219
WP_038641344.1|4154140_4155862_-|terminase	terminase large subunit	terminase	Q7Y413	Yersinia_phage	58.6	1.2e-192
WP_038641346.1|4155861_4156296_-|terminase	phage terminase small subunit P27 family	terminase	A0A1J0GV10	Halomonas_phage	61.1	1.2e-29
WP_003841965.1|4156528_4157044_+	hypothetical protein	NA	A0A077K9U2	Edwardsiella_phage	48.2	1.4e-32
WP_003841963.1|4157179_4157542_-	HNH endonuclease	NA	Q6UAS2	Klebsiella_phage	85.8	1.3e-56
WP_003841960.1|4157811_4157985_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_032941334.1|4158191_4158422_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072144007.1|4158495_4158684_-	cold-shock protein	NA	NA	NA	NA	NA
WP_003841958.1|4158694_4158907_-	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	74.3	2.1e-22
WP_050499177.1|4159282_4159828_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	46.2	1.0e-12
4159615:4159629	attL	CATCTTTAACGGCCT	NA	NA	NA	NA
WP_038641350.1|4159806_4160355_-	lysozyme	NA	K7PM52	Enterobacteria_phage	95.1	1.4e-99
WP_003832349.1|4160326_4160605_-|holin	holin	holin	K7P6H9	Enterobacteria_phage	100.0	3.9e-45
WP_038641352.1|4160758_4160947_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080685918.1|4161049_4161466_+	FlxA-like family protein	NA	NA	NA	NA	NA
WP_038641354.1|4162220_4162835_-	hypothetical protein	NA	H9C175	Pectobacterium_phage	76.9	1.3e-85
WP_038641355.1|4162848_4163889_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	50.9	3.0e-98
WP_038641357.1|4163885_4164245_-	RusA family crossover junction endodeoxyribonuclease	NA	G8C7V6	Escherichia_phage	65.3	1.4e-42
WP_038641358.1|4164247_4164448_-	hypothetical protein	NA	H6WRY8	Salmonella_phage	60.0	1.2e-16
WP_071681812.1|4164577_4164823_-	hypothetical protein	NA	H6WRY6	Salmonella_phage	63.0	2.9e-20
WP_038641360.1|4164868_4165102_-	DinI family protein	NA	K7PM44	Enterobacteria_phage	87.0	3.7e-33
WP_038641362.1|4165388_4166480_-	permease	NA	NA	NA	NA	NA
WP_038641364.1|4166580_4166877_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_038641366.1|4166944_4167370_-	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	4.3e-51
WP_038641369.1|4167382_4168672_-	arsenite efflux transporter membrane subunit ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	73.8	9.6e-171
WP_038641371.1|4168718_4170470_-	arsenite efflux transporter ATPase subunit ArsA	NA	NA	NA	NA	NA
WP_038641374.1|4170487_4170850_-	arsenite efflux transporter metallochaperone ArsD	NA	NA	NA	NA	NA
WP_038641375.1|4170897_4171251_-	As(III)-sensing metalloregulatory transcriptional repressor ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	51.9	4.8e-24
WP_127785720.1|4171374_4171920_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	76.8	1.2e-66
WP_127785709.1|4171831_4172947_-	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	54.0	2.3e-48
WP_038643237.1|4172995_4173550_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003832309.1|4173553_4173766_-	helix-turn-helix transcriptional regulator	NA	A0A077K9X2	Edwardsiella_phage	59.7	3.8e-16
WP_003832307.1|4173871_4174252_+	helix-turn-helix domain-containing protein	NA	K7PH71	Enterobacterial_phage	66.7	6.5e-19
WP_071681809.1|4174627_4174942_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155268630.1|4175081_4176229_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	91.9	9.5e-146
WP_038643238.1|4176459_4176786_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_038641383.1|4176927_4180185_+	PD-(D/E)XK nuclease-like domain-containing protein	NA	K7P6V4	Enterobacteria_phage	58.8	3.9e-293
WP_038641385.1|4180196_4181282_+	recombinase RecT	NA	K7PKR8	Enterobacteria_phage	63.6	1.9e-124
WP_038641387.1|4181321_4181564_+	DUF4060 family protein	NA	K7PHF4	Enterobacteria_phage	88.6	1.5e-32
WP_071888150.1|4181628_4181901_+	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	63.3	2.5e-28
WP_038641389.1|4181869_4182955_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	68.1	3.1e-146
WP_038641391.1|4183291_4183630_-	YebY family protein	NA	NA	NA	NA	NA
WP_038641393.1|4183650_4184523_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_038641395.1|4184526_4184901_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_038641397.1|4185044_4185275_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	58.8	1.3e-14
WP_038641399.1|4185381_4186038_+	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_038641401.1|4186060_4186723_+	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	39.3	3.5e-07
WP_129694994.1|4186704_4188780_-	oligopeptidase B	NA	F2Y2Z7	Organic_Lake_phycodnavirus	36.3	2.2e-31
4190131:4190145	attR	CATCTTTAACGGCCT	NA	NA	NA	NA
>prophage 317
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	4194487	4195963	5099034		Cyanophage(100.0%)	1	NA	NA
WP_003034896.1|4194487_4195963_-	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.1	8.3e-78
>prophage 318
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	4199894	4206101	5099034		Bacillus_virus(50.0%)	7	NA	NA
WP_050764953.1|4199894_4201214_-	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	36.8	1.5e-14
WP_038643243.1|4201229_4202174_-	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_038641425.1|4202252_4203008_+	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	29.4	4.2e-17
WP_038641426.1|4203004_4203790_+	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_005120696.1|4203868_4204879_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.4	1.6e-08
WP_038641428.1|4204887_4205499_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_003034867.1|4205579_4206101_-	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.6e-10
>prophage 319
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	4209954	4216492	5099034	tRNA	Escherichia_coli_phage(33.33%)	7	NA	NA
WP_038641436.1|4209954_4210773_+	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	81.1	2.2e-56
WP_038641437.1|4210824_4211220_+	MAPEG family protein	NA	NA	NA	NA	NA
WP_038641439.1|4211260_4212004_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	2.0e-24
WP_038641441.1|4212000_4212969_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_038641443.1|4213204_4213951_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_038641445.1|4213953_4214520_-	VOC family protein	NA	NA	NA	NA	NA
WP_038641447.1|4214758_4216492_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.9	1.2e-86
>prophage 320
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	4231409	4237062	5099034		Bacillus_thuringiensis_phage(50.0%)	5	NA	NA
WP_038641468.1|4231409_4231799_-	chemotaxis response regulator CheY	NA	Q56AR1	Bacillus_thuringiensis_phage	32.2	2.6e-07
WP_038641470.1|4231817_4232867_-	chemotaxis response regulator protein-glutamate methylesterase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.0	1.8e-05
WP_038641472.1|4232863_4233736_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_038641474.1|4233755_4235357_-	methyl-accepting chemotaxis protein IV	NA	A0A2H4J162	uncultured_Caudovirales_phage	41.7	5.6e-11
WP_038641476.1|4235400_4237062_-	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	36.8	3.4e-11
>prophage 321
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	4248860	4250375	5099034		Cedratvirus(100.0%)	1	NA	NA
WP_038641495.1|4248860_4250375_-	arabinose ABC transporter ATP binding protein AraG	NA	A0A285PWH2	Cedratvirus	29.2	2.8e-12
>prophage 322
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	4262028	4263054	5099034		Wolbachia_phage(100.0%)	1	NA	NA
WP_038641524.1|4262028_4263054_+	patatin-like phospholipase family protein	NA	A0A1B2LRS3	Wolbachia_phage	33.7	1.3e-42
>prophage 323
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	4270175	4270928	5099034		Bacillus_virus(100.0%)	1	NA	NA
WP_003030477.1|4270175_4270928_-	L-cystine ABC transporter ATP-binding protein YecC	NA	G3M9Y6	Bacillus_virus	34.4	6.4e-26
>prophage 324
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	4283330	4284434	5099034		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_038641565.1|4283330_4284434_+	acyltransferase	NA	A0A2H4JA46	uncultured_Caudovirales_phage	31.2	6.8e-24
>prophage 325
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	4300581	4304844	5099034		Burkholderia_phage(50.0%)	4	NA	NA
WP_038641598.1|4300581_4301049_-	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	47.6	5.7e-33
WP_038641600.1|4301029_4302460_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	55.2	3.3e-103
WP_038641602.1|4302536_4303229_-	phosphohydrolase	NA	S4W232	Pandoravirus	27.6	2.0e-05
WP_038641605.1|4303668_4304844_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	56.9	1.2e-108
>prophage 326
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	4312759	4313443	5099034		Bacillus_virus(100.0%)	1	NA	NA
WP_038641624.1|4312759_4313443_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.7	1.1e-27
>prophage 327
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	4318411	4319227	5099034		Amsacta_moorei_entomopoxvirus(100.0%)	1	NA	NA
WP_038641638.1|4318411_4319227_-	energy-coupling factor ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	24.2	1.9e-07
>prophage 328
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	4353163	4355818	5099034		Stx2-converting_phage(50.0%)	3	NA	NA
WP_038641705.1|4353163_4354336_-	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	86.7	4.1e-197
WP_038641707.1|4354475_4355243_-	thiosulfate reductase cytochrome B subunit	NA	NA	NA	NA	NA
WP_038641709.1|4355239_4355818_-	thiosulfate reductase electron transport protein PhsB	NA	A0A077SL61	Escherichia_phage	38.0	4.8e-21
>prophage 329
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	4363774	4364674	5099034		Cellulophaga_phage(100.0%)	1	NA	NA
WP_038641718.1|4363774_4364674_+	ATP phosphoribosyltransferase	NA	A0A0F7Q4B0	Cellulophaga_phage	97.4	4.8e-12
>prophage 330
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	4372271	4376106	5099034		uncultured_virus(33.33%)	3	NA	NA
WP_038641739.1|4372271_4373276_+	NAD-dependent epimerase	NA	A0A218MKE7	uncultured_virus	30.3	9.5e-17
WP_038641741.1|4373335_4374502_-	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	55.5	3.0e-115
WP_038641743.1|4374699_4376106_-	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.5	1.8e-37
>prophage 331
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	4384036	4387708	5099034		Bacillus_phage(33.33%)	3	NA	NA
WP_038641757.1|4384036_4384930_-	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	40.4	2.8e-44
WP_038641758.1|4385169_4386165_-	SDR family oxidoreductase	NA	A0A0K1L6Z1	Scale_drop_disease_virus	28.5	1.5e-09
WP_038641760.1|4386313_4387708_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	35.4	6.1e-22
>prophage 332
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	4393169	4399901	5099034		Bacillus_phage(25.0%)	6	NA	NA
WP_038641770.1|4393169_4394540_-	colanic acid biosynthesis phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	26.9	7.1e-31
WP_038641772.1|4394670_4396107_-	mannose-1-phosphate guanyltransferase	NA	A0A1V0SH58	Hokovirus	31.6	1.5e-52
WP_038641774.1|4396106_4397333_-	colanic acid biosynthesis fucosyltransferase WcaI	NA	NA	NA	NA	NA
WP_038641775.1|4397329_4397809_-	GDP-mannose mannosyl hydrolase	NA	NA	NA	NA	NA
WP_038641777.1|4397811_4398777_-	GDP-L-fucose synthase	NA	M1I5W5	Acanthocystis_turfacea_Chlorella_virus	50.9	5.8e-88
WP_038641779.1|4398779_4399901_-	GDP-mannose 4,6-dehydratase	NA	M4QRT5	Synechococcus_phage	64.9	1.2e-132
>prophage 333
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	4403647	4414289	5099034		Streptococcus_virus(20.0%)	9	NA	NA
WP_038641791.1|4403647_4404136_-	colanic acid biosynthesis acetyltransferase WcaB	NA	A0A191KBJ5	Streptococcus_virus	41.0	4.6e-09
WP_038641793.1|4404138_4404981_-	colanic acid biosynthesis glycosyltransferase WcaA	NA	NA	NA	NA	NA
WP_038641796.1|4405058_4407221_-	tyrosine-protein kinase Wzc	NA	A0A1X9I5D6	Streptococcus_phage	30.3	1.9e-17
WP_038641798.1|4407217_4407667_-	low molecular weight protein-tyrosine-phosphatase Wzb	NA	NA	NA	NA	NA
WP_038641800.1|4407672_4408812_-	polysaccharide export protein	NA	NA	NA	NA	NA
WP_038641804.1|4409467_4411051_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	45.8	8.2e-39
WP_038641805.1|4411095_4412949_-	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
WP_003834269.1|4412974_4413556_-	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	43.2	4.2e-33
WP_003036776.1|4413647_4414289_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	38.3	2.2e-35
>prophage 334
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	4425069	4433202	5099034	tRNA	Bacillus_phage(50.0%)	5	NA	NA
WP_038641823.1|4425069_4428150_+	multidrug efflux RND transporter permease subunit MdtC	NA	S5VTK5	Leptospira_phage	22.7	3.8e-64
WP_038641826.1|4428146_4429553_+	MFS transporter	NA	NA	NA	NA	NA
WP_038641829.1|4429552_4430956_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.6	1.7e-32
WP_038641831.1|4430952_4431675_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	32.7	9.2e-30
WP_006683890.1|4431840_4433202_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	93.4	2.8e-205
>prophage 335
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	4437097	4442294	5099034	protease	Agrobacterium_phage(25.0%)	4	NA	NA
WP_038641840.1|4437097_4439374_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.1	4.8e-165
WP_006683877.1|4439404_4439725_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	3.5e-13
WP_003036813.1|4440048_4440273_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	62.7	3.6e-17
WP_038641842.1|4440347_4442294_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	42.2	3.7e-41
>prophage 336
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	4451719	4453438	5099034		Yellowstone_lake_phycodnavirus(100.0%)	1	NA	NA
WP_038641866.1|4451719_4453438_+	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.4	1.8e-31
>prophage 337
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	4457024	4460911	5099034		Roseobacter_phage(33.33%)	6	NA	NA
WP_038641877.1|4457024_4457855_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	30.1	1.8e-08
WP_001160725.1|4457851_4458175_-	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_071888153.1|4458380_4458569_-	cold-shock protein	NA	NA	NA	NA	NA
WP_038641884.1|4458579_4458792_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	74.3	1.6e-22
WP_038641886.1|4459313_4459829_+	lipoprotein	NA	NA	NA	NA	NA
WP_003027295.1|4460182_4460911_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.0	1.1e-27
>prophage 338
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	4464090	4468595	5099034		Catovirus(50.0%)	4	NA	NA
WP_038641896.1|4464090_4464990_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	27.8	1.8e-11
WP_038641899.1|4465011_4466064_-	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_038641902.1|4466316_4467594_+	MFS transporter	NA	NA	NA	NA	NA
WP_038641905.1|4467590_4468595_+	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	27.0	6.4e-13
>prophage 339
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	4484098	4492518	5099034	tRNA	Enterobacteria_phage(66.67%)	9	NA	NA
WP_038641933.1|4484098_4486132_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.2e-53
WP_038641935.1|4486337_4486796_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	68.6	1.3e-50
WP_038643254.1|4486840_4487311_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	77.6	1.4e-63
WP_038641937.1|4487357_4488077_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_038641939.1|4488073_4489759_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.8	3.5e-282
WP_038641940.1|4489984_4490716_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	92.0	1.2e-104
WP_003027354.1|4490767_4490875_+	protein YohO	NA	NA	NA	NA	NA
WP_038641942.1|4490855_4491587_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_038641944.1|4491570_4492518_-	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	26.1	1.2e-08
>prophage 340
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	4503223	4503958	5099034		Streptococcus_phage(100.0%)	1	NA	NA
WP_038641960.1|4503223_4503958_+	class I SAM-dependent methyltransferase	NA	A0A1X9I6N4	Streptococcus_phage	44.4	3.0e-52
>prophage 341
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	4518371	4519892	5099034		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_005129207.1|4518371_4519892_-	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	32.8	3.4e-10
>prophage 342
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	4523595	4527686	5099034		Cellulophaga_phage(50.0%)	3	NA	NA
WP_003027410.1|4523595_4524264_-	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.8	4.1e-56
WP_038641997.1|4524585_4525422_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_038641998.1|4525700_4527686_+	ligand-gated channel protein	NA	A0A0P0I887	Acinetobacter_phage	32.6	4.5e-10
>prophage 343
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	4532461	4533319	5099034		Catovirus(100.0%)	1	NA	NA
WP_038642007.1|4532461_4533319_+	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	32.8	9.9e-23
>prophage 344
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	4556211	4560515	5099034		Ostreococcus_tauri_virus(50.0%)	4	NA	NA
WP_038642042.1|4556211_4557678_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	30.5	9.9e-39
WP_038642044.1|4557797_4558784_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_038642046.1|4558818_4559532_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_003027474.1|4559945_4560515_+	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	S5MM68	Bacillus_phage	37.6	2.3e-12
>prophage 345
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	4566279	4643172	5099034	protease,head,tail,capsid,terminase,holin,portal	Salmonella_phage(35.19%)	92	NA	NA
WP_038642057.1|4566279_4567869_+	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	31.5	8.8e-17
WP_029139605.1|4567872_4568217_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038642060.1|4568551_4569742_-	Bcr/CflA family multidrug efflux MFS transporter	NA	S4TR35	Salmonella_phage	22.9	1.4e-19
WP_038642062.1|4569757_4570465_-	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_038643260.1|4570616_4572377_+	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	41.6	2.1e-99
WP_006683755.1|4572501_4572786_+	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_006683753.1|4572904_4573912_-	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	47.3	5.0e-82
WP_003027506.1|4574046_4574274_+	YejL family protein	NA	NA	NA	NA	NA
WP_038642064.1|4574305_4576066_+	DUF3413 domain-containing protein	NA	NA	NA	NA	NA
WP_038642066.1|4576492_4577164_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	59.9	4.5e-79
WP_038642069.1|4577156_4578425_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	81.5	3.4e-205
WP_038642071.1|4578426_4578846_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	55.1	1.8e-33
WP_038642073.1|4578923_4579166_+	DinI family protein	NA	Q6UAW0	Klebsiella_phage	76.6	4.4e-29
WP_038642075.1|4579304_4580747_-	hypothetical protein	NA	A0A1V0E5M2	Salmonella_phage	48.2	2.6e-108
WP_038642077.1|4580756_4581701_-	hypothetical protein	NA	H6WRW5	Salmonella_phage	66.1	1.8e-118
WP_038642079.1|4581709_4584430_-	DUF1983 domain-containing protein	NA	S4TTF5	Salmonella_phage	96.0	0.0e+00
WP_038642081.1|4584429_4584828_-	hypothetical protein	NA	S4TR39	Salmonella_phage	92.4	7.2e-69
WP_038642083.1|4584834_4585419_-	hypothetical protein	NA	S4TND4	Salmonella_phage	96.4	6.0e-104
WP_038642085.1|4585418_4586012_-	hypothetical protein	NA	S4TSP7	Salmonella_phage	94.9	1.0e-106
WP_038642087.1|4586174_4586426_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155268631.1|4586397_4586544_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038643263.1|4586584_4589875_-|tail	phage tail tape measure protein	tail	K7PKG1	Enterobacteria_phage	70.8	0.0e+00
WP_038642089.1|4589920_4590100_-	hypothetical protein	NA	K7PH36	Enterobacterial_phage	84.7	6.2e-20
WP_038642091.1|4590158_4590449_-	DUF4035 domain-containing protein	NA	S4TND7	Salmonella_phage	89.6	1.8e-40
WP_038642092.1|4590460_4590832_-|tail	phage tail protein	tail	S4TSQ0	Salmonella_phage	86.0	7.2e-55
WP_038642094.1|4590859_4591564_-|tail	tail protein	tail	K7PHL2	Enterobacterial_phage	74.4	5.7e-93
WP_038642096.1|4591621_4591969_-	DUF3168 domain-containing protein	NA	A0A220NRP0	Escherichia_phage	77.4	3.4e-46
WP_038642098.1|4591965_4592415_-	HK97 gp10 family phage protein	NA	S4TR46	Salmonella_phage	85.9	6.5e-66
WP_038642100.1|4592411_4592750_-|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	69.6	2.3e-39
WP_038642103.1|4592759_4593080_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1W6JNZ5	Morganella_phage	53.9	2.8e-23
WP_038642105.1|4593158_4594376_-|capsid	phage major capsid protein	capsid	A0A1W6JP20	Morganella_phage	75.3	5.9e-170
WP_038642107.1|4594385_4594985_-|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	82.5	2.9e-90
WP_038642109.1|4594977_4596204_-|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	86.5	9.0e-211
WP_038642113.1|4596351_4598109_-|terminase	terminase large subunit	terminase	A0A1B5FP96	Escherichia_phage	90.5	0.0e+00
WP_003841734.1|4598108_4598606_-|terminase	phage terminase small subunit P27 family	terminase	K7PHI2	Enterobacteria_phage	73.9	9.7e-63
WP_038642116.1|4598762_4599113_-	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	79.1	3.9e-50
WP_038642119.1|4599100_4599316_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051594528.1|4599492_4600038_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038642123.1|4600260_4600530_-	hypothetical protein	NA	G8C7W1	Escherichia_phage	72.4	1.5e-22
WP_038642125.1|4600537_4601155_-	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	71.2	2.2e-80
WP_038642127.1|4601154_4601436_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	89.2	6.5e-40
WP_008323296.1|4601422_4601818_-|holin	phage holin family protein	holin	K7PHB9	Enterobacterial_phage	81.7	2.6e-50
WP_038642131.1|4601907_4602504_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038642133.1|4602609_4603188_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	53.9	2.1e-45
WP_038642135.1|4603202_4604192_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	71.7	7.7e-144
WP_001704138.1|4604188_4604872_-	phage regulatory protein/antirepressor Ant	NA	G0ZND1	Cronobacter_phage	60.0	3.0e-62
WP_003034741.1|4604885_4605272_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A192Y8N5	Salmonella_phage	89.1	4.1e-61
WP_038642139.1|4605268_4606147_-	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	75.6	1.1e-130
WP_038642141.1|4606143_4607001_-	conserved phage C-terminal domain-containing protein	NA	A0A1C9IHW0	Salmonella_phage	95.1	9.8e-63
WP_003034732.1|4606990_4607170_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	73.1	3.0e-14
WP_038642145.1|4607342_4607894_-	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	67.8	1.0e-65
WP_003826141.1|4607904_4608132_-	cell division protein	NA	NA	NA	NA	NA
WP_003826139.1|4608234_4608861_+	LexA family transcriptional regulator	NA	K7PM82	Enterobacteria_phage	49.3	4.2e-47
WP_038642148.1|4609454_4609826_+	hypothetical protein	NA	Q8HAA1	Salmonella_phage	87.0	7.2e-55
WP_038642150.1|4609882_4610710_+	DUF2303 family protein	NA	Q8HAA2	Salmonella_phage	96.0	5.6e-148
WP_038642152.1|4610838_4611378_+	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	79.3	5.2e-78
WP_038642154.1|4611538_4611793_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038642156.1|4611789_4612134_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038642158.1|4612126_4612570_+	hypothetical protein	NA	A0A088CE95	Shigella_phage	41.6	1.9e-14
WP_038642160.1|4612571_4613135_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	80.4	1.2e-88
WP_001096408.1|4613185_4613395_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038642163.1|4613397_4614579_+	recombinase	NA	A0A2H4J1K3	uncultured_Caudovirales_phage	30.0	1.0e-30
WP_051594529.1|4614705_4615770_-	RelA/SpoT domain-containing protein	NA	NA	NA	NA	NA
WP_071888156.1|4616484_4616718_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051594530.1|4616868_4617429_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071888157.1|4617425_4617770_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038642167.1|4617772_4618270_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_038642169.1|4618764_4619412_+	nitrate/nitrite response regulator protein NarP	NA	NA	NA	NA	NA
WP_038642171.1|4619513_4620563_-	cytochrome c-type biogenesis protein CcmH	NA	NA	NA	NA	NA
WP_003834613.1|4620559_4621117_-	thiol:disulfide interchange protein DsbE	NA	NA	NA	NA	NA
WP_038642174.1|4621113_4623069_-	heme lyase CcmF/NrfE family subunit	NA	NA	NA	NA	NA
WP_038642175.1|4623065_4623545_-	cytochrome c maturation protein CcmE	NA	NA	NA	NA	NA
WP_005129320.1|4623541_4623754_-	heme exporter protein CcmD	NA	NA	NA	NA	NA
WP_038642178.1|4623750_4624488_-	heme ABC transporter permease	NA	NA	NA	NA	NA
WP_038642180.1|4624563_4625223_-	heme exporter protein CcmB	NA	NA	NA	NA	NA
WP_038642182.1|4625219_4625840_-	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	G3M9Y6	Bacillus_virus	23.9	1.8e-10
WP_003027548.1|4625860_4626463_-	cytochrome c-type protein NapC	NA	NA	NA	NA	NA
WP_038642185.1|4626472_4626922_-	nitrate reductase cytochrome c-type subunit	NA	NA	NA	NA	NA
WP_038642187.1|4626918_4627782_-	quinol dehydrogenase ferredoxin subunit NapH	NA	NA	NA	NA	NA
WP_038642189.1|4627768_4628464_-	ferredoxin-type protein NapG	NA	NA	NA	NA	NA
WP_038642191.1|4628470_4630957_-	nitrate reductase catalytic subunit NapA	NA	NA	NA	NA	NA
WP_038642193.1|4630953_4631217_-	chaperone NapD	NA	NA	NA	NA	NA
WP_038642195.1|4631206_4631698_-	ferredoxin-type protein NapF	NA	NA	NA	NA	NA
WP_038643271.1|4632111_4632609_+|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
WP_038642197.1|4632702_4634364_-	malate dehydrogenase (quinone)	NA	NA	NA	NA	NA
WP_038642199.1|4634641_4635886_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	49.0	8.3e-79
WP_038642202.1|4635848_4637285_-	magnesium transporter	NA	NA	NA	NA	NA
WP_038642204.1|4637390_4639034_-	multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	23.6	1.3e-10
WP_038642206.1|4639109_4639760_-	DNA oxidative demethylase AlkB	NA	A0A2K9L3R7	Tupanvirus	34.3	2.9e-06
WP_038642208.1|4639759_4640824_-	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	52.2	7.0e-18
WP_038642210.1|4640903_4641956_-	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
WP_038642212.1|4642071_4643172_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	59.7	1.7e-115
>prophage 346
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	4647337	4653573	5099034		Hokovirus(50.0%)	3	NA	NA
WP_038642216.1|4647337_4650184_-	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	25.2	9.2e-41
WP_038643273.1|4650352_4652191_+	two-component system sensor histidine kinase AtoS	NA	NA	NA	NA	NA
WP_038642218.1|4652187_4653573_+	acetoacetate metabolism transcriptional regulator AtoC	NA	B5LWN0	Feldmannia_species_virus	32.3	6.8e-05
>prophage 347
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	4657660	4668748	5099034		Pseudomonas_phage(40.0%)	8	NA	NA
WP_038642228.1|4657660_4660297_-	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	30.7	1.8e-91
WP_038642230.1|4660455_4661184_+	bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG	NA	NA	NA	NA	NA
WP_038642232.1|4661604_4663890_+	ribonucleoside-diphosphate reductase subunit alpha	NA	I3UMG3	Colwellia_phage	64.4	2.5e-286
WP_038642234.1|4664001_4665132_+	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	78.9	2.1e-174
WP_038642236.1|4665131_4665386_+	ferredoxin-like diferric-tyrosyl radical cofactor maintenance protein YfaE	NA	G9IAA2	Pseudomonas_phage	76.1	2.4e-25
WP_038642238.1|4665389_4666580_-	MFS transporter	NA	NA	NA	NA	NA
WP_038642240.1|4666741_4667620_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_038642242.1|4667680_4668748_-	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	50.9	2.3e-08
>prophage 348
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	4678447	4682552	5099034		Tupanvirus(66.67%)	3	NA	NA
WP_038642258.1|4678447_4679587_+	UDP-4-amino-4-deoxy-L-arabinose aminotransferase	NA	A0A2K9L470	Tupanvirus	28.2	3.6e-28
WP_038642260.1|4679589_4680573_+	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase	NA	A8CG95	Salmonella_phage	32.5	1.7e-34
WP_038642262.1|4680569_4682552_+	bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA	NA	A0A2K9KZK0	Tupanvirus	25.6	6.3e-20
>prophage 349
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	4695221	4696226	5099034		Bacillus_thuringiensis_phage(100.0%)	1	NA	NA
WP_038642291.1|4695221_4696226_+	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	26.1	5.4e-28
>prophage 350
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	4716833	4717433	5099034		Salmonella_phage(100.0%)	1	NA	NA
WP_038642306.1|4716833_4717433_+	5'-deoxynucleotidase	NA	A0A2L0V156	Salmonella_phage	38.6	5.3e-07
>prophage 351
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	4731219	4731993	5099034		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
WP_038642330.1|4731219_4731993_-	histidine ABC transporter ATP-binding protein HisP	NA	M1I0T9	Acanthocystis_turfacea_Chlorella_virus	27.7	1.1e-07
>prophage 352
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	4736348	4737866	5099034		Mollivirus(100.0%)	1	NA	NA
WP_005129677.1|4736348_4737866_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	44.0	1.1e-88
>prophage 353
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	4744426	4745563	5099034		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_038642351.1|4744426_4745563_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	26.9	1.0e-19
>prophage 354
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	4754710	4755796	5099034		Pandoravirus(100.0%)	1	NA	NA
WP_038642369.1|4754710_4755796_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.3	7.7e-89
>prophage 355
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	4764941	4765874	5099034		Enterobacteria_phage(100.0%)	1	NA	NA
WP_110498802.1|4764941_4765874_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	91.8	4.8e-148
>prophage 356
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	4772786	4774685	5099034		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_038642405.1|4772786_4774685_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	26.2	2.4e-13
>prophage 357
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	4782744	4783665	5099034		Morganella_phage(100.0%)	1	NA	NA
WP_038642416.1|4782744_4783665_+	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	53.1	3.5e-74
>prophage 358
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	4788139	4788874	5099034		Clostridioides_phage(100.0%)	1	NA	NA
WP_038642424.1|4788139_4788874_+	two-component system response regulator YpdB	NA	A0A2R2ZGH8	Clostridioides_phage	25.8	1.6e-13
>prophage 359
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	4812904	4822777	5099034		Lactobacillus_phage(25.0%)	9	NA	NA
WP_038642466.1|4812904_4813831_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	25.2	2.8e-07
WP_038642468.1|4813920_4814919_+	bile acid:sodium symporter	NA	NA	NA	NA	NA
WP_032944144.1|4814915_4815134_-	DUF3820 family protein	NA	NA	NA	NA	NA
WP_038642470.1|4815135_4817151_-	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	43.7	1.7e-150
WP_038642472.1|4817222_4818236_-	cell division protein ZipA	NA	NA	NA	NA	NA
WP_069324501.1|4818466_4819228_+	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_038642476.1|4819391_4820363_+	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	51.0	3.3e-75
WP_002913505.1|4820746_4821004_+	phosphocarrier protein Hpr	NA	NA	NA	NA	NA
WP_003038080.1|4821049_4822777_+	phosphoenolpyruvate-protein phosphotransferase PtsI	NA	A0A1V0SGR7	Hokovirus	31.1	7.4e-17
>prophage 360
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	4826678	4834675	5099034		Streptococcus_phage(25.0%)	7	NA	NA
WP_038642491.1|4826678_4827590_-	cysteine synthase CysM	NA	A0A1X9I5F1	Streptococcus_phage	41.8	7.7e-58
WP_038642493.1|4827657_4828755_-	sulfate/thiosulfate ABC transporter ATP-binding protein CysA	NA	G9BWD6	Planktothrix_phage	38.9	6.3e-30
WP_038642495.1|4828744_4829620_-	sulfate/thiosulfate ABC transporter permease CysW	NA	NA	NA	NA	NA
WP_038642497.1|4829619_4830453_-	sulfate/thiosulfate ABC transporter permease CysT	NA	NA	NA	NA	NA
WP_038642500.1|4830453_4831470_-	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_038642502.1|4831627_4832419_-	SDR family oxidoreductase UcpA	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.6	8.9e-18
WP_071888161.1|4832536_4834675_-	peptidase domain-containing ABC transporter	NA	F2Y2R6	Organic_Lake_phycodnavirus	26.6	3.1e-17
>prophage 361
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	4856992	4860563	5099034		Pandoravirus(50.0%)	5	NA	NA
WP_038642506.1|4856992_4857892_-	porphyrinogen peroxidase	NA	S4VVJ7	Pandoravirus	32.4	1.5e-24
WP_038642508.1|4857985_4858561_-	RpoE-regulated lipoprotein	NA	NA	NA	NA	NA
WP_038642510.1|4858620_4859070_-	DUF2919 domain-containing protein	NA	NA	NA	NA	NA
WP_006683546.1|4859056_4859482_-	GNAT family acetyltransferase	NA	NA	NA	NA	NA
WP_038642512.1|4859693_4860563_+	N-acetylmuramoyl-L-alanine amidase AmiA	NA	A0A0N9SGH1	Paenibacillus_phage	33.3	1.5e-18
>prophage 362
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	4896303	4897017	5099034		Cyanophage(100.0%)	1	NA	NA
WP_038642562.1|4896303_4897017_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A127KMU1	Cyanophage	35.7	2.0e-37
>prophage 363
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	4906837	4912435	5099034		Enterobacteria_phage(33.33%)	5	NA	NA
WP_038642578.1|4906837_4908127_-	uracil permease	NA	Q9KX94	Enterobacteria_phage	36.2	1.5e-62
WP_038642580.1|4908223_4908850_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_038642582.1|4909033_4910464_-	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
WP_038642584.1|4910759_4911797_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	42.4	8.2e-72
WP_038642586.1|4911793_4912435_+	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	40.0	3.4e-28
>prophage 364
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	4918824	4919028	5099034		Escherichia_phage(100.0%)	1	NA	NA
WP_071888163.1|4918824_4919028_+	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	74.6	2.9e-18
>prophage 365
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	4923880	4928774	5099034		Klosneuvirus(33.33%)	4	NA	NA
WP_038642597.1|4923880_4925347_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.3	1.7e-86
WP_038642599.1|4925507_4926881_+	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	34.9	3.4e-41
WP_038642601.1|4926877_4927093_-	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_038642603.1|4927232_4928774_-	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	57.2	2.4e-160
>prophage 366
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	4937717	4938149	5099034		Powai_lake_megavirus(100.0%)	1	NA	NA
WP_003037710.1|4937717_4938149_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	37.1	5.3e-17
>prophage 367
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	4947955	4954277	5099034		Mycoplasma_phage(20.0%)	8	NA	NA
WP_038642620.1|4947955_4949239_-	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	36.0	4.5e-35
WP_038642622.1|4949300_4949501_-	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_003037690.1|4949512_4949848_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_038642624.1|4949849_4951700_-	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	42.1	6.5e-104
WP_038642626.1|4951715_4952231_-	co-chaperone HscB	NA	NA	NA	NA	NA
WP_038642628.1|4952305_4952629_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	47.7	7.0e-22
WP_002913991.1|4952649_4953036_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	77.3	2.7e-52
WP_038642631.1|4953062_4954277_-	cysteine desulfurase	NA	A0A1X7C038	Faustovirus	32.6	1.6e-34
>prophage 368
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	4959926	4961435	5099034		Bacillus_virus(100.0%)	1	NA	NA
WP_038642640.1|4959926_4961435_+	sugar ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	27.9	1.2e-15
>prophage 369
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	4981020	4992309	5099034		Bacillus_phage(50.0%)	7	NA	NA
WP_032939458.1|4981020_4982274_-	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	53.4	3.0e-100
WP_038642674.1|4982600_4983791_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_000717694.1|4983892_4984231_-	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_038642678.1|4984291_4985629_-	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	34.1	1.4e-10
WP_038642680.1|4985625_4986369_-	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_123261017.1|4986391_4987822_-	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	26.1	1.8e-13
WP_038642684.1|4988421_4992309_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	58.9	1.5e-129
>prophage 370
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	4998640	5005402	5099034		uncultured_Mediterranean_phage(33.33%)	8	NA	NA
WP_038642696.1|4998640_4998901_+	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	1.1e-17
WP_038642698.1|4998897_4999278_-	holo-ACP synthase	NA	NA	NA	NA	NA
WP_003838383.1|4999277_5000009_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_038642700.1|5000020_5000749_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_038642702.1|5000760_5001666_-	GTPase Era	NA	NA	NA	NA	NA
WP_003037579.1|5001662_5002343_-	ribonuclease III	NA	A0A2K9L5P0	Tupanvirus	31.8	1.6e-20
WP_038642704.1|5002612_5003587_-	signal peptidase I	NA	NA	NA	NA	NA
WP_038642706.1|5003602_5005402_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	25.1	1.4e-23
>prophage 371
NZ_CP007557	Citrobacter freundii CFNIH1, complete genome	5099034	5010379	5098662	5099034	tRNA,lysis,plate,head,tail,capsid,terminase,portal	Salmonella_phage(68.29%)	79	NA	NA
WP_038642716.1|5010379_5011117_-|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_038642718.1|5011249_5012578_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	29.6	3.9e-42
WP_114140338.1|5012596_5013493_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_038642722.1|5013595_5014183_+	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_005121223.1|5014261_5014645_-	autonomous glycyl radical cofactor GrcA	NA	A0A1W5N098	Cronobacter_phage	70.9	3.6e-33
WP_038642724.1|5014962_5015652_+	uracil-DNA glycosylase	NA	A0A077BCN4	Equid_alphaherpesvirus	52.1	2.1e-55
WP_038642726.1|5015685_5016765_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_003037559.1|5016972_5017392_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	36.5	8.3e-15
WP_038642728.1|5017461_5018160_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_038642730.1|5018196_5020857_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_038642732.1|5020971_5022327_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_038643310.1|5022370_5022694_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_038642734.1|5022690_5023989_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	31.6	6.9e-44
WP_038642736.1|5029684_5032258_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	9.0e-128
WP_038642738.1|5032387_5033119_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_038642740.1|5033115_5034096_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_005130417.1|5034227_5034965_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_003031244.1|5035235_5035574_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_100250063.1|5035677_5035725_+	pheA operon leader peptide PheL	NA	NA	NA	NA	NA
WP_038642743.1|5035824_5036985_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_038642745.1|5037027_5038149_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_038642747.1|5038159_5039230_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.4	9.0e-90
WP_038642749.1|5039445_5039820_+	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_038642751.1|5039978_5040497_+	YfiR family protein	NA	NA	NA	NA	NA
WP_038642753.1|5040489_5041713_+	diguanylate cyclase DgcN	NA	A0A2K8I9Y5	Pseudomonas_phage	38.7	2.2e-07
WP_038642755.1|5041725_5042208_+	OmpA family protein	NA	NA	NA	NA	NA
WP_006687325.1|5042347_5042695_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_003031232.1|5042734_5043502_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_003031230.1|5043546_5044095_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_003031228.1|5044113_5044362_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_006687321.1|5044613_5045975_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_038643312.1|5046141_5046933_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_038642758.1|5046951_5048241_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_038642760.1|5048290_5048884_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_038642764.1|5049006_5049885_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_038642766.1|5049970_5051632_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_003826401.1|5051781_5052126_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_038642768.1|5052176_5052473_-	RnfH family protein	NA	NA	NA	NA	NA
WP_071888166.1|5052456_5052912_-	type II toxin-antitoxin system toxin RatA	NA	NA	NA	NA	NA
WP_038643314.1|5053054_5053537_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	2.6e-28
WP_038642772.1|5054104_5065348_+	BapA prefix-like domain-containing protein	NA	NA	NA	NA	NA
WP_038642774.1|5065419_5066829_+	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_038642776.1|5066825_5069012_+	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	30.7	9.3e-17
WP_129694947.1|5069019_5070183_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_000391794.1|5070742_5071225_+	hypothetical protein	NA	Q19UP0	Mannheimia_phage	34.3	1.6e-17
WP_000980501.1|5071251_5071470_-	ogr/Delta-like zinc finger family protein	NA	Q53ZE7	Salmonella_virus	77.8	7.5e-28
WP_001011796.1|5071538_5072639_-	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	88.5	3.4e-177
WP_000980413.1|5072635_5073121_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.6	6.3e-67
WP_038642785.1|5073117_5076195_-|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	63.1	0.0e+00
WP_000763311.1|5076187_5076307_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
WP_001281010.1|5076321_5076624_-|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	88.0	1.7e-38
WP_001207660.1|5076678_5077194_-|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.3	2.1e-89
WP_000046120.1|5077203_5078376_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	2.1e-204
WP_000905010.1|5078518_5079085_-	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	86.8	3.8e-87
WP_080700418.1|5079543_5080020_+|tail	tail fiber assembly protein	tail	A0A0M4S6V4	Salmonella_phage	78.9	1.8e-26
WP_038642791.1|5080244_5080526_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001086836.1|5081982_5082588_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	92.5	1.5e-110
WP_000268280.1|5082580_5083489_-|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	90.4	7.8e-143
WP_000177590.1|5083475_5083835_-	GPW/gp25 family protein	NA	A0A1S6KZZ4	Salmonella_phage	86.6	9.5e-52
WP_000993775.1|5083831_5084410_-|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	87.0	4.2e-94
WP_000829141.1|5084478_5084925_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	84.9	1.5e-62
WP_001039935.1|5084917_5085349_-|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	92.3	6.4e-71
WP_038642802.1|5085444_5085873_-|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	75.9	2.4e-46
WP_000727855.1|5085869_5086247_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	40.0	6.7e-16
WP_001341072.1|5086248_5086722_-	lysozyme	NA	E5G6N1	Salmonella_phage	91.0	3.7e-80
WP_000171568.1|5086741_5086957_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
WP_038642808.1|5086960_5087164_-|tail	tail protein X	tail	E5G6M9	Salmonella_phage	91.0	2.3e-31
WP_000673530.1|5087163_5087628_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	1.9e-76
WP_038642812.1|5087723_5088374_-|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	95.8	4.3e-111
WP_000742498.1|5088377_5089436_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.4	2.9e-181
WP_000216903.1|5089452_5090286_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	90.6	2.4e-122
WP_001098422.1|5090428_5092195_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.5	0.0e+00
WP_038642819.1|5092194_5093229_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	87.3	2.0e-171
WP_001513676.1|5093265_5094300_-	DUF4062 domain-containing protein	NA	NA	NA	NA	NA
WP_038642823.1|5094512_5095295_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001292590.1|5095298_5095499_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001397660.1|5095718_5095952_-	DinI family protein	NA	A0A1S6L014	Salmonella_phage	89.6	2.0e-31
WP_001154444.1|5095963_5096152_-	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	100.0	2.7e-26
WP_038642826.1|5096310_5098662_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	91.5	0.0e+00
>prophage 1
NZ_CP007558	Citrobacter freundii CFNIH1 plasmid pKEC-a3c, complete sequence	272297	22947	62563	272297	integrase,transposase	Escherichia_phage(23.53%)	39	22932:22991	64103:65061
22932:22991	attL	AGAGTCTGATTCGAAATTATCCTGTGTAATTTGATAATCTTGCGATTCGTCTCGTGAAGA	NA	NA	NA	NA
WP_019706040.1|22947_23784_-|transposase	IS5-like element ISEc61 family transposase	transposase	NA	NA	NA	NA
WP_000262467.1|24349_25144_+	APH(3')-II family aminoglycoside O-phosphotransferase	NA	Q75ZG1	Hepacivirus	74.3	6.4e-109
WP_000349358.1|25170_25530_+	BLMT family bleomycin binding protein	NA	NA	NA	NA	NA
WP_019706001.1|25692_26640_+|transposase	IS30-like element ISAs2 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.7	1.4e-41
WP_016809943.1|26722_27871_+	cephalosporin-hydrolyzing class C beta-lactamase FOX-5	NA	NA	NA	NA	NA
WP_016809945.1|29387_30350_+	HTH-type transcriptional regulator YidZ	NA	NA	NA	NA	NA
WP_041445713.1|30961_31909_+|transposase	IS30-like element ISAs2 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.7	2.3e-41
WP_071843640.1|32630_32834_+	type II toxin-antitoxin system YafQ family toxin	NA	NA	NA	NA	NA
WP_001067855.1|32867_33572_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_012561167.1|34144_34510_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012561166.1|34509_37746_-	conjugative relaxase	NA	U5J9B0	Bacillus_phage	27.3	2.4e-05
WP_017787123.1|37952_38969_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.4	2.9e-186
WP_041445714.1|38973_40473_-	type IV secretion system DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001749975.1|40474_40891_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020319858.1|41663_41801_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001749973.1|41809_42526_+	StdB	NA	NA	NA	NA	NA
WP_000414913.1|42527_42896_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048968061.1|43188_43422_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001749971.1|43532_43853_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000214483.1|43907_44087_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000932975.1|44972_45212_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000881513.1|45221_45626_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000447669.1|45683_46109_-	antirestriction protein	NA	NA	NA	NA	NA
WP_000861760.1|46523_46964_+	translesion error-prone DNA polymerase V autoproteolytic subunit MucA	NA	A0A1W6JNS2	Morganella_phage	48.8	1.2e-27
WP_001749980.1|46951_48217_+	translesion error-prone DNA polymerase V subunit MucB	NA	F1C5A5	Cronobacter_phage	53.8	2.2e-119
WP_001452808.1|48367_49159_+	SprT-like domain-containing protein	NA	NA	NA	NA	NA
WP_000057569.1|49173_49515_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001749982.1|50074_50794_+	replication initiation protein	NA	I3WF20	Macacine_betaherpesvirus	28.9	8.6e-20
WP_001749988.1|52750_53320_-	recombinase family protein	NA	E5FFF9	Burkholderia_phage	43.2	5.2e-36
WP_000845048.1|53712_54726_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_004201280.1|54881_55355_+	trimethoprim-resistant dihydrofolate reductase DfrA14	NA	G3MBI7	Bacillus_virus	28.9	8.4e-16
WP_001144737.1|55575_55842_+	plasmid mobilization relaxosome protein MobC	NA	NA	NA	NA	NA
WP_001389365.1|55984_56749_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_004098817.1|57009_58224_+	type II site-specific deoxyribonuclease	NA	E5E3X4	Burkholderia_phage	42.5	1.2e-34
WP_001288432.1|58257_59691_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.6	7.0e-106
WP_001749967.1|60072_60279_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064577928.1|60283_60772_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_001067855.1|61021_61726_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001173919.1|61987_62563_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	52.7	5.6e-46
64103:65061	attR	TCTTCACGAGACGAATCGCAAGATTATCAAATTACACAGGATAATTTCGAATCAGACTCTAAGAGAAGCCCGACGTGCAGAAAGGGCTGAACGACCAAGCAATGAGCCTCCCTCAGTGGATGAACTCCGTGAGCGCCAGCAACAAAACACAGAAAGAGAACCGGTGGTTGTCAGCTCATCAGCTCCGGCACCAAAGGTGCAAAAGGAAGAGCCAATCGAAGTACAGCCAGGCAAGCGCAAAATTATTTTGGATTAGTGGGGTCGGTTATGAGCAAAAAGCGCATCGTAATCAAAAATGGTGAGGTCTGCGGGTTTGCCGATGAGGTTTCCTTCAAAGGCCTTGAAGTGCAGGAATACAGTAAAACAAGGGTTTCGCGCATCGTGCCGACGAGCGGCATTCTAATGATTGCGTTCTATGTTATTCGCGGACTTTGTTCAGACGAGTCAAAGATTGCGGCATGGACTCGTGTTTGGCGTTGCCAGTGGAAGGTGCTGATCGACGGTAAAAGCTATGGCCCATTCAGCAGTCGTGCGGATGCTATCTCGTTCGAGAAGGACGAGATCTACAAACAAGGCAAATTCTTTGCCGATGCCACTCACGAGGCGGCAGTATGATGACACGGGCGGCTATGGCCGCTCTGTTATCCGCGTTGGTAATAGGCCTTGTGTCTGATTTGGCCGCACAAGAGCTGGTGGTAAGCCCGGTGGCTATAGACAAGTCCACTGAGGTGGAGAAAGAAGCTACCTTCCACAACCGCAAGTGGGTGTTAAGGACGGGGCAGGTTAGTGGATTCTTCATCTGCCAAGGAGATAACAAAGACATTTACTACCGGCATGACAGGGTGGGCGCTCACTGCCAGAAGACATCGACTGGGTGGCGCAATGTACTGGGTCTCAGGGACGATGTTCCGGAAGTTGAGCTGAGCGTGTACCTGGGGACCGTTGAAGGTGTCCCCGTG	NA	NA	NA	NA
>prophage 2
NZ_CP007558	Citrobacter freundii CFNIH1 plasmid pKEC-a3c, complete sequence	272297	66944	75680	272297	transposase	Acidithiobacillus_phage(33.33%)	11	NA	NA
WP_000268395.1|66944_67883_+	hypothetical protein	NA	A0A2P9HXK7	Yersinia_phage	50.2	1.5e-69
WP_000532167.1|67882_68080_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001096362.1|68317_68560_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001258027.1|68562_68925_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000194038.1|69189_69945_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	51.0	5.8e-59
WP_001274811.1|69959_71501_-|transposase	IS21-like element ISAs29 family transposase	transposase	K4I413	Acidithiobacillus_phage	47.6	4.4e-130
WP_001050849.1|71745_72780_+	site-specific DNA-methyltransferase	NA	H8ZMF1	Synechococcus_phage	20.9	1.0e-05
WP_000058870.1|72793_73243_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000338945.1|73224_73536_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001151304.1|73709_74495_+	ParA family protein	NA	A0A1X9IGI7	Lactococcus_phage	26.4	6.1e-11
WP_001207227.1|74498_75680_+	ParB/RepB/Spo0J family partition protein	NA	I3NLC2	Bifidobacterium_phage	28.7	2.4e-11
>prophage 3
NZ_CP007558	Citrobacter freundii CFNIH1 plasmid pKEC-a3c, complete sequence	272297	143920	235836	272297	integrase,transposase	Escherichia_phage(46.15%)	73	167183:167242	235883:235988
WP_011191341.1|143920_145195_+|transposase	IS4-like element ISApu2 family transposase	transposase	NA	NA	NA	NA
WP_000122923.1|145208_146936_+	toprim domain-containing protein	NA	A0A0P0ZFY3	Escherichia_phage	32.6	9.9e-14
WP_000268337.1|146922_147201_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000714162.1|147273_147513_+	permease	NA	NA	NA	NA	NA
WP_001337692.1|147732_148134_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000988732.1|148247_148973_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001138073.1|152089_155062_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.1	0.0e+00
WP_001162012.1|155064_155622_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	81.3	5.8e-48
WP_000845039.1|155927_156941_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_000381802.1|157086_157620_+	aminoglycoside nucleotidyltransferase ANT(2'')-Ia	NA	NA	NA	NA	NA
WP_000679427.1|157776_158124_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259032.1|158117_158957_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_001389365.1|159131_159896_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_001067855.1|160072_160777_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000052512.1|161226_162702_+	ABC-F type ribosomal protection protein Msr(E)	NA	A0A1B0RXA0	Streptococcus_phage	59.0	2.3e-160
WP_000155092.1|162757_163642_+	Mph(E) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_001067855.1|163725_164430_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_004163135.1|164320_165280_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	40.5	1.7e-47
WP_000946487.1|165381_166233_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.1e-11
WP_000376623.1|166360_166861_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_004152787.1|166843_166984_-	hypothetical protein	NA	NA	NA	NA	NA
167183:167242	attL	ATGTCATTTTCAGAAGACGACTGCACCAGTTGATTGGGCGTAATGGCTGTTGTGCAGCCA	NA	NA	NA	NA
WP_064735407.1|167367_167574_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	78.5	1.8e-26
WP_001067855.1|167620_168325_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001553819.1|169233_172131_-|transposase	Tn3-like element Tn5403 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.8	4.2e-182
WP_000509966.1|172225_172831_+	recombinase family protein	NA	A0A1S5Y2X8	uncultured_archaeal_virus	35.3	5.5e-20
WP_004152397.1|173144_174464_+|transposase	IS1182-like element ISKpn6 family transposase	transposase	Q9MBP7	Staphylococcus_prophage	24.2	1.9e-12
WP_004199234.1|174713_175595_-	carbapenem-hydrolyzing class A beta-lactamase KPC-2	NA	A0A1B0VBP7	Salmonella_phage	52.2	2.2e-73
WP_001067855.1|176119_176824_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_007897923.1|176947_178195_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_040113334.1|178181_179948_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017384059.1|179935_182053_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017384060.1|182056_182485_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023314856.1|183810_184140_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_023279877.1|184214_185339_-	alkene reductase	NA	NA	NA	NA	NA
WP_049866819.1|185557_186532_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_017384065.1|186614_187490_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_023279882.1|187596_188448_+	DMT family transporter	NA	NA	NA	NA	NA
WP_023279881.1|188523_189360_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_007897903.1|189654_190314_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_022649401.1|191399_191726_-	four-helix bundle copper-binding protein	NA	NA	NA	NA	NA
WP_022651297.1|192157_193291_+	glutathione-independent formaldehyde dehydrogenase	NA	E3SJ82	Synechococcus_phage	28.8	9.7e-10
WP_012561117.1|194231_196883_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	34.1	5.4e-152
WP_032190484.1|198177_198549_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001189111.1|198857_200366_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.6e-44
WP_101743360.1|201068_202049_+	NAD(P)H-quinone oxidoreductase	NA	NA	NA	NA	NA
WP_040113343.1|203348_204278_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	53.1	1.4e-75
WP_001118645.1|204481_205405_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	93.2	1.0e-166
WP_040113342.1|205611_206409_+	(S)-acetoin forming diacetyl reductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	26.9	5.1e-13
WP_040113332.1|206670_207594_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	92.8	2.3e-166
WP_023205627.1|207737_209129_-	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_040113331.1|209964_210987_-|transposase	IS110-like element IS5708 family transposase	transposase	NA	NA	NA	NA
WP_001067855.1|211149_211854_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_002210516.1|212565_213186_-	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
WP_011117368.1|213178_214444_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.8	4.6e-234
WP_002210514.1|214455_215358_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	100.0	5.3e-160
WP_002210513.1|215618_216380_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_011117369.1|216400_217261_-	class A extended-spectrum beta-lactamase SHV-5	NA	A0A077SL40	Escherichia_phage	99.7	4.4e-156
WP_001620096.1|217558_217819_+	hypothetical protein	NA	A0A077SK33	Escherichia_phage	100.0	1.9e-41
WP_001620097.1|217905_218994_+	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
WP_001067855.1|219966_220671_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000845039.1|220812_221826_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_032488579.1|221986_222541_+	aminoglycoside N-acetyltransferase AAC(6')-Ib3	NA	NA	NA	NA	NA
WP_002089484.1|222616_223081_+	aminoglycoside N-acetyltransferase AAC(3)-Ia	NA	NA	NA	NA	NA
WP_000679427.1|223286_223634_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|223627_224467_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000050481.1|224871_226413_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_012579084.1|226745_227402_+	quinolone resistance pentapeptide repeat protein QnrA1	NA	NA	NA	NA	NA
WP_000259031.1|227601_228441_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000376623.1|228568_229069_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001163403.1|229244_230027_-	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	35.0	2.5e-33
WP_001324342.1|230016_231540_-|transposase	IS21-like element IS1326 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	24.2	1.2e-15
WP_000344784.1|233257_234118_-	TniB family NTP-binding protein	NA	NA	NA	NA	NA
WP_000935451.1|234120_235836_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
235883:235988	attR	TGGCTGCACAACAGCCATTACGCCCAATCAACTGGTGCAGTCGTCTTCTGAAAATGACATCCATGCCCAGCCCGTGCGCGAGCTGGATCACCGCCCGCACGATAGT	NA	NA	NA	NA
>prophage 4
NZ_CP007558	Citrobacter freundii CFNIH1 plasmid pKEC-a3c, complete sequence	272297	245391	254873	272297	integrase,transposase	uncultured_Caudovirales_phage(33.33%)	9	244134:244149	257005:257020
244134:244149	attL	TAATTATGATAATTAC	NA	NA	NA	NA
WP_000543934.1|245391_246402_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0K0N6I5	Gordonia_phage	31.9	3.1e-07
WP_044489169.1|246406_247036_+	3'-5' exonuclease	NA	A2I2Z6	Vibrio_virus	43.3	4.1e-18
WP_011787801.1|247487_248978_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	82.2	8.6e-224
WP_011787802.1|249012_249867_+	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	48.6	1.3e-67
WP_011787803.1|249957_250290_+	TraR/DksA C4-type zinc finger protein	NA	NA	NA	NA	NA
WP_011787804.1|250407_251028_-	recombinase family protein	NA	E5FFF9	Burkholderia_phage	37.1	1.1e-26
WP_011787805.1|251197_251458_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_011918375.1|251457_251769_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_011787830.1|251792_254873_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	30.6	8.2e-51
257005:257020	attR	TAATTATGATAATTAC	NA	NA	NA	NA
