The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP007576	Aeromonas hydrophila pc104A strain PC-104A chromosome, complete genome	5023829	926588	936524	5023829	tRNA	uncultured_Mediterranean_phage(25.0%)	10	NA	NA
WP_016349538.1|926588_927335_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	53.7	2.1e-69
WP_016349539.1|927339_927957_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	46.4	5.3e-34
WP_016349540.1|927953_928535_+	DedA family protein	NA	NA	NA	NA	NA
WP_043118488.1|928545_929586_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A0A7NU10	Lactobacillus_phage	35.6	1.1e-12
WP_011704778.1|929633_930617_+	RNA polymerase sigma factor RpoS	NA	F4YCU2	Synechococcus_phage	34.1	1.7e-34
WP_016349542.1|930701_931715_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	58.3	6.9e-108
WP_005309452.1|931894_932110_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_016349543.1|932125_932569_+	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	48.6	1.7e-26
WP_016349544.1|932657_934445_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	41.1	5.2e-74
WP_073348937.1|934658_936524_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	32.6	1.1e-34
>prophage 2
NZ_CP007576	Aeromonas hydrophila pc104A strain PC-104A chromosome, complete genome	5023829	1071062	1107427	5023829	integrase,portal,terminase,tail,capsid,head	Enterobacteria_phage(17.39%)	43	1063513:1063528	1105038:1105053
1063513:1063528	attL	GCGTTGAGCAGGTAAC	NA	NA	NA	NA
WP_016349628.1|1071062_1072370_-|integrase	site-specific integrase	integrase	Q8W658	Enterobacteria_phage	39.8	8.7e-79
WP_016349629.1|1072345_1072555_-	DUF1233 family excisionase	NA	NA	NA	NA	NA
WP_016349631.1|1072764_1073022_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016349632.1|1073103_1073298_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016349633.1|1073273_1073711_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016349634.1|1073707_1074694_-	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	41.3	3.6e-53
WP_043119575.1|1074731_1074953_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043118571.1|1075893_1076565_-	helix-turn-helix domain-containing protein	NA	K7PH19	Enterobacteria_phage	44.0	1.9e-37
WP_016349638.1|1076667_1076874_+	helix-turn-helix transcriptional regulator	NA	K7PKH4	Enterobacteria_phage	57.4	1.4e-15
WP_016349639.1|1076892_1077390_+	Lambda phage phage regulatory protein CII	NA	NA	NA	NA	NA
WP_016349640.1|1077784_1078741_+	phage regulatory protein, Rha family	NA	A0A1C9IHV9	Salmonella_phage	41.5	2.1e-45
WP_016349641.1|1078863_1079985_+	hypothetical protein	NA	A5VW95	Enterobacteria_phage	32.4	1.5e-15
WP_043159231.1|1080073_1080454_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016349643.1|1080453_1080708_+	hypothetical protein	NA	A0A1I9KFB1	Aeromonas_phage	46.8	6.8e-12
WP_016349644.1|1080724_1081423_+	hypothetical protein	NA	A0A1I9KFA9	Aeromonas_phage	63.6	1.0e-78
WP_016349646.1|1081637_1082120_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016349647.1|1082109_1082505_+	DUF4406 domain-containing protein	NA	A0A1B0YZW9	Pseudomonas_phage	35.8	4.4e-10
WP_134984434.1|1082704_1083181_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016349648.1|1083248_1083512_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016349649.1|1083508_1084498_+	DUF968 domain-containing protein	NA	A0A1V0E819	Vibrio_phage	31.0	2.1e-32
WP_075384563.1|1084503_1084872_+	DUF1064 domain-containing protein	NA	Q3HQZ9	Burkholderia_phage	48.8	2.7e-25
WP_043159228.1|1084916_1085492_+	antitermination protein	NA	NA	NA	NA	NA
WP_043118579.1|1086421_1088962_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_075384564.1|1088971_1090843_+	DUF2357 domain-containing protein	NA	NA	NA	NA	NA
WP_075384565.1|1091295_1091514_+	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_016349654.1|1091425_1092487_+	site-specific DNA-methyltransferase	NA	A0A1I9KF79	Aeromonas_phage	74.4	1.5e-129
WP_016349655.1|1092691_1093687_+	ATP-binding protein	NA	A0A1B2RW50	Lymphocystis_disease_virus	29.0	3.7e-13
WP_059296267.1|1093702_1096204_+	S8 family peptidase	NA	NA	NA	NA	NA
WP_016349657.1|1096525_1097452_-	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_075384569.1|1097444_1098233_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043118585.1|1098519_1098732_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016349660.1|1098731_1099223_+	lysozyme	NA	D6QWN8	uncultured_phage	38.1	4.4e-15
WP_016349661.1|1099222_1099762_+	DUF2514 family protein	NA	A0A059VF51	Pseudomonas_phage	39.5	9.0e-14
WP_016349662.1|1099812_1100097_-	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_043119580.1|1100180_1100561_+	HNH endonuclease	NA	A0A1V0E8A5	Vibrio_phage	53.0	2.4e-29
WP_043118588.1|1100656_1101142_+|terminase	phage terminase small subunit P27 family	terminase	A0A2D1GNP3	Pseudomonas_phage	59.5	1.1e-47
WP_016349665.1|1101151_1102873_+|terminase	terminase large subunit	terminase	U5P0Q5	Shigella_phage	74.2	7.1e-254
WP_016349666.1|1102866_1103055_+	hypothetical protein	NA	A0A1B5FP99	Escherichia_phage	65.8	4.5e-05
WP_016349667.1|1103054_1104308_+|portal	phage portal protein	portal	Q6UAX8	Klebsiella_phage	62.1	1.7e-151
WP_016349668.1|1104295_1105231_+	S49 family peptidase	NA	Q6UAX7	Klebsiella_phage	50.8	2.5e-80
1105038:1105053	attR	GCGTTGAGCAGGTAAC	NA	NA	NA	NA
WP_016349669.1|1105299_1106586_+|capsid	phage major capsid protein	capsid	Q6UAX6	Klebsiella_phage	62.4	1.4e-142
WP_016349670.1|1106657_1107113_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016349671.1|1107115_1107427_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4J8C5	uncultured_Caudovirales_phage	43.2	2.8e-12
>prophage 3
NZ_CP007576	Aeromonas hydrophila pc104A strain PC-104A chromosome, complete genome	5023829	1746113	1757186	5023829	head	Shigella_phage(50.0%)	16	NA	NA
WP_043118779.1|1746113_1746689_+	secretion activator protein	NA	B0ZSJ3	Halomonas_phage	30.4	3.7e-13
WP_016350120.1|1746685_1746988_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005353373.1|1746980_1747202_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016350121.1|1747223_1747451_+	DnaK suppressor protein	NA	NA	NA	NA	NA
WP_016350122.1|1747431_1747746_+	DUF2730 family protein	NA	NA	NA	NA	NA
WP_005345917.1|1747742_1748039_+	hypothetical protein	NA	A0A0C4UR00	Shigella_phage	57.0	6.2e-17
WP_016350123.1|1748041_1748617_+	DUF3486 family protein	NA	A0A0C4UQU5	Shigella_phage	68.9	3.6e-61
WP_016350124.1|1748616_1750170_+	hypothetical protein	NA	A0A0C4UR29	Shigella_phage	58.4	5.7e-162
WP_016350125.1|1750169_1751759_+	DUF935 domain-containing protein	NA	J9SVY0	Pseudomonas_phage	48.4	2.1e-119
WP_016350126.1|1751758_1753228_+	hypothetical protein	NA	A0A2H4IYU7	uncultured_Caudovirales_phage	52.7	1.5e-63
WP_016350127.1|1753247_1753448_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016350128.1|1753447_1753894_+	phage virion morphogenesis protein	NA	Q5ZQY1	Pseudomonas_phage	32.9	4.8e-13
WP_016350129.1|1754116_1755265_+	hypothetical protein	NA	A0A0C4UQU6	Shigella_phage	43.5	2.1e-68
WP_016350130.1|1755309_1756218_+|head	phage head protein	head	A0A0C4UQR9	Shigella_phage	57.2	7.4e-101
WP_016350131.1|1756321_1756771_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016350132.1|1756772_1757186_+	DUF1320 family protein	NA	B7SDP4	Haemophilus_phage	36.4	1.3e-15
>prophage 4
NZ_CP007576	Aeromonas hydrophila pc104A strain PC-104A chromosome, complete genome	5023829	2500531	2517010	5023829	tRNA	Bacillus_virus(12.5%)	11	NA	NA
WP_011706172.1|2500531_2503279_+	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	34.9	1.3e-108
WP_016350659.1|2503806_2504862_-	PA0069 family radical SAM protein	NA	A0A1C9EG97	Acidianus_two-tailed_virus	28.6	2.4e-10
WP_016350660.1|2505036_2505624_+	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_016350661.1|2505860_2507789_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.9	2.8e-126
WP_075384255.1|2507792_2508341_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	37.9	4.9e-15
WP_005300673.1|2508427_2508625_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_005300683.1|2508640_2508997_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_016350663.1|2509312_2510296_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	44.0	1.5e-35
WP_016350664.1|2510308_2512696_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	A0A1L3IZU3	BeAn_58058_virus	24.5	1.8e-05
WP_005300715.1|2512699_2512996_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	35.6	3.0e-11
WP_016350665.1|2513050_2517010_+	transporter substrate-binding domain-containing protein	NA	A0A1V0SGX0	Hokovirus	36.8	2.6e-33
>prophage 5
NZ_CP007576	Aeromonas hydrophila pc104A strain PC-104A chromosome, complete genome	5023829	4373165	4436492	5023829	holin,integrase,portal,transposase,terminase,tRNA,tail,capsid,head	Aeromonas_virus(80.0%)	71	4402594:4402643	4437238:4437287
WP_016351975.1|4373165_4373876_+|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_043119734.1|4374067_4375375_+	branched-chain amino acid transport system II carrier protein	NA	NA	NA	NA	NA
WP_075384505.1|4375711_4377046_+	branched-chain amino acid transport system II carrier protein	NA	NA	NA	NA	NA
WP_016351978.1|4377116_4377347_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016351979.1|4377351_4377813_-	chemotaxis protein CheX	NA	NA	NA	NA	NA
WP_075384504.1|4377802_4378261_-	zinc uptake transcriptional repressor Zur	NA	NA	NA	NA	NA
WP_016351981.1|4378399_4379386_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_011707401.1|4379614_4380040_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005305063.1|4380141_4380414_-	DNA-binding protein HU-alpha	NA	A0A249Y2G7	Serratia_phage	44.2	3.6e-11
WP_011707403.1|4380755_4381238_+	Rsd/AlgQ family anti-sigma factor	NA	NA	NA	NA	NA
WP_011707404.1|4381339_4381720_+	PilZ domain-containing protein	NA	NA	NA	NA	NA
WP_011707405.1|4381791_4383156_-	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_016351983.1|4383256_4385635_+	PilZ domain-containing protein	NA	NA	NA	NA	NA
WP_016351984.1|4385761_4386667_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_016351985.1|4386716_4387727_-	phosphoserine phosphatase SerB	NA	NA	NA	NA	NA
WP_016351986.1|4387847_4388456_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016351987.1|4388509_4390756_+	PAS domain S-box protein	NA	G3MA91	Bacillus_virus	32.6	3.5e-19
WP_011707410.1|4390825_4391542_-	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_016351988.1|4391619_4392828_-	phosphopentomutase	NA	NA	NA	NA	NA
WP_016351989.1|4392842_4394174_-	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.8	2.0e-78
WP_011707413.1|4394283_4395057_-	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_005305103.1|4395448_4395619_-	DUF1427 family protein	NA	R4TMJ4	Halovirus	60.0	6.3e-06
WP_016351990.1|4395742_4397017_-	NupC/NupG family nucleoside CNT transporter	NA	NA	NA	NA	NA
WP_016351991.1|4397230_4398019_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_016351992.1|4398059_4398677_+	type II secretion system protein	NA	NA	NA	NA	NA
WP_016351993.1|4398645_4398828_-	DUF5363 family protein	NA	NA	NA	NA	NA
WP_016351994.1|4399033_4400386_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	42.9	2.0e-94
WP_016351995.1|4400699_4402136_-	ammonium transporter	NA	NA	NA	NA	NA
4402594:4402643	attL	CGGGGTCGGACTCGAACCGACACGGTTATTCACCGGCGGATTTTGAATCC	NA	NA	NA	NA
WP_043119412.1|4402712_4403762_-|integrase	site-specific integrase	integrase	A5X9F3	Aeromonas_virus	92.2	2.8e-189
WP_016351997.1|4403748_4404600_-	hypothetical protein	NA	A5X9F4	Aeromonas_virus	74.0	3.0e-72
WP_043119414.1|4404609_4405323_-	helix-turn-helix transcriptional regulator	NA	A5X9F5	Aeromonas_virus	80.1	4.0e-102
WP_016351999.1|4405459_4405675_+	hypothetical protein	NA	A5X9F6	Aeromonas_virus	64.8	5.9e-17
WP_016352000.1|4405704_4406214_+	phage protein	NA	A5X9F7	Aeromonas_virus	83.4	1.7e-75
WP_043119416.1|4406224_4406683_+	hypothetical protein	NA	A5X9F8	Aeromonas_virus	71.1	3.6e-56
WP_043119419.1|4406940_4407204_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016352003.1|4407376_4407568_+	hypothetical protein	NA	A5X9G0	Aeromonas_virus	74.6	1.1e-19
WP_016352004.1|4407564_4407774_+	hypothetical protein	NA	A5X9G1	Aeromonas_virus	94.2	4.2e-28
WP_016352005.1|4407770_4408187_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016352006.1|4408183_4408720_+	DNA methyltransferase	NA	U3PDF3	Vibrio_phage	64.6	6.3e-68
WP_016352007.1|4409114_4411304_+	replication endonuclease	NA	A5X9G4	Aeromonas_virus	83.1	0.0e+00
WP_016352008.1|4411577_4412072_+	hypothetical protein	NA	A5X9G5	Aeromonas_virus	86.6	5.3e-77
WP_016352009.1|4412074_4412557_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016352010.1|4412553_4412772_+	hypothetical protein	NA	A5X9G7	Aeromonas_virus	72.2	5.6e-23
WP_016352011.1|4412889_4413222_+	hypothetical protein	NA	NA	NA	NA	NA
WP_134984423.1|4413458_4414283_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043119421.1|4414606_4414960_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_155728637.1|4415123_4415294_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016352014.1|4415336_4415588_-	ogr/Delta-like zinc finger family protein	NA	A5X9H0	Aeromonas_virus	84.3	1.1e-35
WP_016352015.1|4415653_4416670_-|portal	phage portal protein	portal	A5X9H1	Aeromonas_virus	91.4	8.6e-183
WP_016352016.1|4416666_4418487_-|terminase	phage terminase ATPase subunit	terminase	A5X9H3	Aeromonas_virus	88.8	0.0e+00
WP_043119423.1|4418662_4419520_+|capsid	phage capsid protein	capsid	A5X9H4	Aeromonas_virus	80.6	1.9e-127
WP_016352018.1|4419529_4420579_+|capsid	phage major capsid protein, P2 family	capsid	A5X9H5	Aeromonas_virus	86.1	7.0e-172
WP_043119425.1|4420582_4421311_+|terminase	terminase endonuclease subunit	terminase	A5X9H6	Aeromonas_virus	89.2	1.3e-121
WP_016352020.1|4421481_4421943_+|head	head completion/stabilization protein	head	A5X9H7	Aeromonas_virus	94.1	2.9e-69
WP_016352021.1|4421951_4422464_+	phage protein	NA	A5X9H8	Aeromonas_virus	86.2	8.4e-86
WP_016352022.1|4422460_4423147_+	phage protein	NA	A5X9H9	Aeromonas_virus	87.3	4.7e-108
WP_016352023.1|4423151_4424276_+	DUF2586 domain-containing protein	NA	A5X9I0	Aeromonas_virus	81.6	3.0e-176
WP_016352024.1|4424279_4424735_+	DUF2597 family protein	NA	A5X9I1	Aeromonas_virus	86.1	2.3e-71
WP_016352025.1|4424738_4424948_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	45.3	1.7e-05
WP_043119426.1|4424969_4425296_+|holin	phage holin, lambda family	holin	A5X9I3	Aeromonas_virus	59.4	1.8e-25
WP_016352027.1|4425282_4425744_+	glycoside hydrolase family 104 protein	NA	G0ZT35	Aeromonas_phage	91.5	4.7e-80
WP_016352028.1|4425740_4426184_+	phage protein	NA	NA	NA	NA	NA
WP_016352030.1|4426307_4426571_+	phage protein	NA	A5X9I7	Aeromonas_virus	85.4	1.4e-33
WP_016352031.1|4426762_4428532_+|tail	phage tail tape measure protein	tail	A5X9I9	Aeromonas_virus	75.3	2.7e-256
WP_016352032.1|4428531_4428855_+	DUF2590 family protein	NA	A5X9J0	Aeromonas_virus	86.9	1.1e-46
WP_016352033.1|4428851_4430039_+	phage protein	NA	A5X9J1	Aeromonas_virus	79.8	7.4e-178
WP_016352034.1|4430031_4430712_+	phage protein	NA	A5X9J2	Aeromonas_virus	75.8	2.9e-86
WP_016352035.1|4430711_4433615_+	hypothetical protein	NA	A5X9J3	Aeromonas_virus	59.6	1.0e-95
WP_043119743.1|4433881_4434325_+	hypothetical protein	NA	A5X9J6	Aeromonas_virus	52.6	3.0e-31
WP_016352037.1|4434321_4434885_+	hypothetical protein	NA	A5X9J7	Aeromonas_virus	72.6	5.6e-59
WP_043119429.1|4434881_4436492_+	hypothetical protein	NA	A5X9J8	Aeromonas_virus	72.8	4.8e-236
4437238:4437287	attR	CGGGGTCGGACTCGAACCGACACGGTTATTCACCGGCGGATTTTGAATCC	NA	NA	NA	NA
