The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP007566	Aeromonas hydrophila AL09-71 isolate 4 chromosome, complete genome	5023861	926608	936544	5023861	tRNA	uncultured_Mediterranean_phage(25.0%)	10	NA	NA
WP_016349538.1|926608_927355_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	53.7	2.1e-69
WP_016349539.1|927359_927977_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	46.4	5.3e-34
WP_016349540.1|927973_928555_+	DedA family protein	NA	NA	NA	NA	NA
WP_043118488.1|928565_929606_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A0A7NU10	Lactobacillus_phage	35.6	1.1e-12
WP_011704778.1|929653_930637_+	RNA polymerase sigma factor RpoS	NA	F4YCU2	Synechococcus_phage	34.1	1.7e-34
WP_016349542.1|930721_931735_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	58.3	6.9e-108
WP_005309452.1|931914_932130_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_016349543.1|932145_932589_+	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	48.6	1.7e-26
WP_016349544.1|932677_934465_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	41.1	5.2e-74
WP_073348937.1|934678_936544_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	32.6	1.1e-34
>prophage 2
NZ_CP007566	Aeromonas hydrophila AL09-71 isolate 4 chromosome, complete genome	5023861	1071077	1107442	5023861	integrase,head,portal,terminase,tail,capsid	Enterobacteria_phage(17.39%)	43	1063528:1063543	1105053:1105068
1063528:1063543	attL	GCGTTGAGCAGGTAAC	NA	NA	NA	NA
WP_016349628.1|1071077_1072385_-|integrase	site-specific integrase	integrase	Q8W658	Enterobacteria_phage	39.8	8.7e-79
WP_016349629.1|1072360_1072570_-	DUF1233 family excisionase	NA	NA	NA	NA	NA
WP_016349631.1|1072779_1073037_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016349632.1|1073118_1073313_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016349633.1|1073288_1073726_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016349634.1|1073722_1074709_-	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	41.3	3.6e-53
WP_043119575.1|1074746_1074968_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043118571.1|1075908_1076580_-	helix-turn-helix domain-containing protein	NA	K7PH19	Enterobacteria_phage	44.0	1.9e-37
WP_016349638.1|1076682_1076889_+	helix-turn-helix transcriptional regulator	NA	K7PKH4	Enterobacteria_phage	57.4	1.4e-15
WP_016349639.1|1076907_1077405_+	Lambda phage phage regulatory protein CII	NA	NA	NA	NA	NA
WP_016349640.1|1077799_1078756_+	phage regulatory protein, Rha family	NA	A0A1C9IHV9	Salmonella_phage	41.5	2.1e-45
WP_016349641.1|1078878_1080000_+	hypothetical protein	NA	A5VW95	Enterobacteria_phage	32.4	1.5e-15
WP_043159231.1|1080088_1080469_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016349643.1|1080468_1080723_+	hypothetical protein	NA	A0A1I9KFB1	Aeromonas_phage	46.8	6.8e-12
WP_016349644.1|1080739_1081438_+	hypothetical protein	NA	A0A1I9KFA9	Aeromonas_phage	63.6	1.0e-78
WP_016349646.1|1081652_1082135_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016349647.1|1082124_1082520_+	DUF4406 domain-containing protein	NA	A0A1B0YZW9	Pseudomonas_phage	35.8	4.4e-10
WP_134984434.1|1082719_1083196_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016349648.1|1083263_1083527_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016349649.1|1083523_1084513_+	DUF968 domain-containing protein	NA	A0A1V0E819	Vibrio_phage	31.0	2.1e-32
WP_075384563.1|1084518_1084887_+	DUF1064 domain-containing protein	NA	Q3HQZ9	Burkholderia_phage	48.8	2.7e-25
WP_043159228.1|1084931_1085507_+	antitermination protein	NA	NA	NA	NA	NA
WP_043118579.1|1086436_1088977_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_075384564.1|1088986_1090858_+	DUF2357 domain-containing protein	NA	NA	NA	NA	NA
WP_075384565.1|1091310_1091529_+	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_016349654.1|1091440_1092502_+	site-specific DNA-methyltransferase	NA	A0A1I9KF79	Aeromonas_phage	74.4	1.5e-129
WP_016349655.1|1092706_1093702_+	ATP-binding protein	NA	A0A1B2RW50	Lymphocystis_disease_virus	29.0	3.7e-13
WP_059296267.1|1093717_1096219_+	S8 family peptidase	NA	NA	NA	NA	NA
WP_016349657.1|1096540_1097467_-	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_075384569.1|1097459_1098248_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043118585.1|1098534_1098747_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016349660.1|1098746_1099238_+	lysozyme	NA	D6QWN8	uncultured_phage	38.1	4.4e-15
WP_016349661.1|1099237_1099777_+	DUF2514 family protein	NA	A0A059VF51	Pseudomonas_phage	39.5	9.0e-14
WP_016349662.1|1099827_1100112_-	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_043119580.1|1100195_1100576_+	HNH endonuclease	NA	A0A1V0E8A5	Vibrio_phage	53.0	2.4e-29
WP_043118588.1|1100671_1101157_+|terminase	phage terminase small subunit P27 family	terminase	A0A2D1GNP3	Pseudomonas_phage	59.5	1.1e-47
WP_016349665.1|1101166_1102888_+|terminase	terminase large subunit	terminase	U5P0Q5	Shigella_phage	74.2	7.1e-254
WP_016349666.1|1102881_1103070_+	hypothetical protein	NA	A0A1B5FP99	Escherichia_phage	65.8	4.5e-05
WP_016349667.1|1103069_1104323_+|portal	phage portal protein	portal	Q6UAX8	Klebsiella_phage	62.1	1.7e-151
WP_016349668.1|1104310_1105246_+	S49 family peptidase	NA	Q6UAX7	Klebsiella_phage	50.8	2.5e-80
1105053:1105068	attR	GCGTTGAGCAGGTAAC	NA	NA	NA	NA
WP_016349669.1|1105314_1106601_+|capsid	phage major capsid protein	capsid	Q6UAX6	Klebsiella_phage	62.4	1.4e-142
WP_016349670.1|1106672_1107128_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016349671.1|1107130_1107442_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4J8C5	uncultured_Caudovirales_phage	43.2	2.8e-12
>prophage 3
NZ_CP007566	Aeromonas hydrophila AL09-71 isolate 4 chromosome, complete genome	5023861	1746114	1757187	5023861	head	Shigella_phage(50.0%)	16	NA	NA
WP_043118779.1|1746114_1746690_+	secretion activator protein	NA	B0ZSJ3	Halomonas_phage	30.4	3.7e-13
WP_016350120.1|1746686_1746989_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005353373.1|1746981_1747203_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016350121.1|1747224_1747452_+	DnaK suppressor protein	NA	NA	NA	NA	NA
WP_016350122.1|1747432_1747747_+	DUF2730 family protein	NA	NA	NA	NA	NA
WP_005345917.1|1747743_1748040_+	hypothetical protein	NA	A0A0C4UR00	Shigella_phage	57.0	6.2e-17
WP_016350123.1|1748042_1748618_+	DUF3486 family protein	NA	A0A0C4UQU5	Shigella_phage	68.9	3.6e-61
WP_016350124.1|1748617_1750171_+	hypothetical protein	NA	A0A0C4UR29	Shigella_phage	58.4	5.7e-162
WP_016350125.1|1750170_1751760_+	DUF935 domain-containing protein	NA	J9SVY0	Pseudomonas_phage	48.4	2.1e-119
WP_016350126.1|1751759_1753229_+	hypothetical protein	NA	A0A2H4IYU7	uncultured_Caudovirales_phage	52.7	1.5e-63
WP_016350127.1|1753248_1753449_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016350128.1|1753448_1753895_+	phage virion morphogenesis protein	NA	Q5ZQY1	Pseudomonas_phage	32.9	4.8e-13
WP_016350129.1|1754117_1755266_+	hypothetical protein	NA	A0A0C4UQU6	Shigella_phage	43.5	2.1e-68
WP_016350130.1|1755310_1756219_+|head	phage head protein	head	A0A0C4UQR9	Shigella_phage	57.2	7.4e-101
WP_016350131.1|1756322_1756772_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016350132.1|1756773_1757187_+	DUF1320 family protein	NA	B7SDP4	Haemophilus_phage	36.4	1.3e-15
>prophage 4
NZ_CP007566	Aeromonas hydrophila AL09-71 isolate 4 chromosome, complete genome	5023861	2505868	2517018	5023861	tRNA	Tupanvirus(16.67%)	8	NA	NA
WP_016350661.1|2505868_2507797_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.9	2.8e-126
WP_075384255.1|2507800_2508349_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	37.9	4.9e-15
WP_005300673.1|2508435_2508633_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_005300683.1|2508648_2509005_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_016350663.1|2509320_2510304_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	44.0	1.5e-35
WP_016350664.1|2510316_2512704_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	A0A1L3IZU3	BeAn_58058_virus	24.5	1.8e-05
WP_005300715.1|2512707_2513004_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	35.6	3.0e-11
WP_016350665.1|2513058_2517018_+	transporter substrate-binding domain-containing protein	NA	A0A1V0SGX0	Hokovirus	36.8	2.6e-33
>prophage 5
NZ_CP007566	Aeromonas hydrophila AL09-71 isolate 4 chromosome, complete genome	5023861	4373202	4436529	5023861	integrase,portal,terminase,head,tRNA,transposase,tail,capsid,holin	Aeromonas_virus(80.0%)	71	4402631:4402680	4437275:4437324
WP_016351975.1|4373202_4373913_+|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_043119734.1|4374104_4375412_+	branched-chain amino acid transport system II carrier protein	NA	NA	NA	NA	NA
WP_075384505.1|4375748_4377083_+	branched-chain amino acid transport system II carrier protein	NA	NA	NA	NA	NA
WP_016351978.1|4377153_4377384_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016351979.1|4377388_4377850_-	chemotaxis protein CheX	NA	NA	NA	NA	NA
WP_075384504.1|4377839_4378298_-	zinc uptake transcriptional repressor Zur	NA	NA	NA	NA	NA
WP_016351981.1|4378436_4379423_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_011707401.1|4379651_4380077_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005305063.1|4380178_4380451_-	DNA-binding protein HU-alpha	NA	A0A249Y2G7	Serratia_phage	44.2	3.6e-11
WP_011707403.1|4380792_4381275_+	Rsd/AlgQ family anti-sigma factor	NA	NA	NA	NA	NA
WP_011707404.1|4381376_4381757_+	PilZ domain-containing protein	NA	NA	NA	NA	NA
WP_011707405.1|4381828_4383193_-	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_016351983.1|4383293_4385672_+	PilZ domain-containing protein	NA	NA	NA	NA	NA
WP_016351984.1|4385798_4386704_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_016351985.1|4386753_4387764_-	phosphoserine phosphatase SerB	NA	NA	NA	NA	NA
WP_016351986.1|4387884_4388493_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016351987.1|4388546_4390793_+	PAS domain S-box protein	NA	G3MA91	Bacillus_virus	32.6	3.5e-19
WP_011707410.1|4390862_4391579_-	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_016351988.1|4391656_4392865_-	phosphopentomutase	NA	NA	NA	NA	NA
WP_016351989.1|4392879_4394211_-	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.8	2.0e-78
WP_011707413.1|4394320_4395094_-	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_005305103.1|4395485_4395656_-	DUF1427 family protein	NA	R4TMJ4	Halovirus	60.0	6.3e-06
WP_016351990.1|4395779_4397054_-	NupC/NupG family nucleoside CNT transporter	NA	NA	NA	NA	NA
WP_016351991.1|4397267_4398056_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_016351992.1|4398096_4398714_+	type II secretion system protein	NA	NA	NA	NA	NA
WP_016351993.1|4398682_4398865_-	DUF5363 family protein	NA	NA	NA	NA	NA
WP_016351994.1|4399070_4400423_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	42.9	2.0e-94
WP_016351995.1|4400736_4402173_-	ammonium transporter	NA	NA	NA	NA	NA
4402631:4402680	attL	CGGGGTCGGACTCGAACCGACACGGTTATTCACCGGCGGATTTTGAATCC	NA	NA	NA	NA
WP_043119412.1|4402749_4403799_-|integrase	site-specific integrase	integrase	A5X9F3	Aeromonas_virus	92.2	2.8e-189
WP_016351997.1|4403785_4404637_-	hypothetical protein	NA	A5X9F4	Aeromonas_virus	74.0	3.0e-72
WP_043119414.1|4404646_4405360_-	helix-turn-helix transcriptional regulator	NA	A5X9F5	Aeromonas_virus	80.1	4.0e-102
WP_016351999.1|4405496_4405712_+	hypothetical protein	NA	A5X9F6	Aeromonas_virus	64.8	5.9e-17
WP_016352000.1|4405741_4406251_+	phage protein	NA	A5X9F7	Aeromonas_virus	83.4	1.7e-75
WP_043119416.1|4406261_4406720_+	hypothetical protein	NA	A5X9F8	Aeromonas_virus	71.1	3.6e-56
WP_043119419.1|4406977_4407241_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016352003.1|4407413_4407605_+	hypothetical protein	NA	A5X9G0	Aeromonas_virus	74.6	1.1e-19
WP_016352004.1|4407601_4407811_+	hypothetical protein	NA	A5X9G1	Aeromonas_virus	94.2	4.2e-28
WP_016352005.1|4407807_4408224_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016352006.1|4408220_4408757_+	DNA methyltransferase	NA	U3PDF3	Vibrio_phage	64.6	6.3e-68
WP_016352007.1|4409151_4411341_+	replication endonuclease	NA	A5X9G4	Aeromonas_virus	83.1	0.0e+00
WP_016352008.1|4411614_4412109_+	hypothetical protein	NA	A5X9G5	Aeromonas_virus	86.6	5.3e-77
WP_016352009.1|4412111_4412594_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016352010.1|4412590_4412809_+	hypothetical protein	NA	A5X9G7	Aeromonas_virus	72.2	5.6e-23
WP_016352011.1|4412926_4413259_+	hypothetical protein	NA	NA	NA	NA	NA
WP_134984423.1|4413495_4414320_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043119421.1|4414643_4414997_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_155728637.1|4415160_4415331_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016352014.1|4415373_4415625_-	ogr/Delta-like zinc finger family protein	NA	A5X9H0	Aeromonas_virus	84.3	1.1e-35
WP_016352015.1|4415690_4416707_-|portal	phage portal protein	portal	A5X9H1	Aeromonas_virus	91.4	8.6e-183
WP_016352016.1|4416703_4418524_-|terminase	phage terminase ATPase subunit	terminase	A5X9H3	Aeromonas_virus	88.8	0.0e+00
WP_043119423.1|4418699_4419557_+|capsid	phage capsid protein	capsid	A5X9H4	Aeromonas_virus	80.6	1.9e-127
WP_016352018.1|4419566_4420616_+|capsid	phage major capsid protein, P2 family	capsid	A5X9H5	Aeromonas_virus	86.1	7.0e-172
WP_043119425.1|4420619_4421348_+|terminase	terminase endonuclease subunit	terminase	A5X9H6	Aeromonas_virus	89.2	1.3e-121
WP_016352020.1|4421518_4421980_+|head	head completion/stabilization protein	head	A5X9H7	Aeromonas_virus	94.1	2.9e-69
WP_016352021.1|4421988_4422501_+	phage protein	NA	A5X9H8	Aeromonas_virus	86.2	8.4e-86
WP_016352022.1|4422497_4423184_+	phage protein	NA	A5X9H9	Aeromonas_virus	87.3	4.7e-108
WP_016352023.1|4423188_4424313_+	DUF2586 domain-containing protein	NA	A5X9I0	Aeromonas_virus	81.6	3.0e-176
WP_016352024.1|4424316_4424772_+	DUF2597 family protein	NA	A5X9I1	Aeromonas_virus	86.1	2.3e-71
WP_016352025.1|4424775_4424985_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	45.3	1.7e-05
WP_043119426.1|4425006_4425333_+|holin	phage holin, lambda family	holin	A5X9I3	Aeromonas_virus	59.4	1.8e-25
WP_016352027.1|4425319_4425781_+	glycoside hydrolase family 104 protein	NA	G0ZT35	Aeromonas_phage	91.5	4.7e-80
WP_016352028.1|4425777_4426221_+	phage protein	NA	NA	NA	NA	NA
WP_016352030.1|4426344_4426608_+	phage protein	NA	A5X9I7	Aeromonas_virus	85.4	1.4e-33
WP_016352031.1|4426799_4428569_+|tail	phage tail tape measure protein	tail	A5X9I9	Aeromonas_virus	75.3	2.7e-256
WP_016352032.1|4428568_4428892_+	DUF2590 family protein	NA	A5X9J0	Aeromonas_virus	86.9	1.1e-46
WP_016352033.1|4428888_4430076_+	phage protein	NA	A5X9J1	Aeromonas_virus	79.8	7.4e-178
WP_016352034.1|4430068_4430749_+	phage protein	NA	A5X9J2	Aeromonas_virus	75.8	2.9e-86
WP_016352035.1|4430748_4433652_+	hypothetical protein	NA	A5X9J3	Aeromonas_virus	59.6	1.0e-95
WP_043119743.1|4433918_4434362_+	hypothetical protein	NA	A5X9J6	Aeromonas_virus	52.6	3.0e-31
WP_016352037.1|4434358_4434922_+	hypothetical protein	NA	A5X9J7	Aeromonas_virus	72.6	5.6e-59
WP_043119429.1|4434918_4436529_+	hypothetical protein	NA	A5X9J8	Aeromonas_virus	72.8	4.8e-236
4437275:4437324	attR	CGGGGTCGGACTCGAACCGACACGGTTATTCACCGGCGGATTTTGAATCC	NA	NA	NA	NA
