The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_HG965802	Bartonella henselae strain BM1374163	1905383	337414	428201	1905383	capsid,tRNA,tail,head,integrase,portal,plate,terminase	Haemophilus_phage(14.81%)	103	370567:370585	424882:424900
WP_011180208.1|337414_340330_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2I2L3Y0	Orpheovirus	24.8	8.8e-63
WP_011180209.1|340525_341119_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011180210.1|341181_341628_-	nucleoside deaminase	NA	NA	NA	NA	NA
WP_011180211.1|341903_343301_+	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_011180212.1|343281_343851_+	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_011180213.1|346705_348037_+	TldD/PmbA family protein	NA	NA	NA	NA	NA
WP_034447481.1|348023_348827_+	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_011180215.1|348872_349118_+	DUF4170 domain-containing protein	NA	K4JVU0	Caulobacter_phage	37.9	2.0e-05
WP_011180216.1|349941_351264_+	lipid IV(A) 3-deoxy-D-manno-octulosonic acid transferase	NA	NA	NA	NA	NA
WP_011180217.1|351253_352273_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_011180218.1|352317_352554_-	DUF2093 domain-containing protein	NA	NA	NA	NA	NA
WP_011180219.1|352674_354513_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	39.9	7.1e-111
WP_034447477.1|354810_355899_+	2'-deoxycytidine 5'-triphosphate deaminase	NA	NA	NA	NA	NA
WP_011180221.1|356734_357886_+	FMN-dependent L-lactate dehydrogenase LldD	NA	NA	NA	NA	NA
WP_011180223.1|360373_360694_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011180224.1|360874_362302_+	amino acid permease	NA	NA	NA	NA	NA
WP_011180225.1|362343_363024_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	27.9	7.9e-15
WP_011180226.1|363020_363659_+	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
WP_011180227.1|363672_364227_+	biotin transporter BioY	NA	NA	NA	NA	NA
WP_038525120.1|368262_368706_+	hypothetical protein	NA	NA	NA	NA	NA
WP_034447472.1|369395_369623_+	hypothetical protein	NA	NA	NA	NA	NA
WP_034447468.1|369754_369973_+	hypothetical protein	NA	NA	NA	NA	NA
370567:370585	attL	AAGTGGTGCCCAGACGCGG	NA	NA	NA	NA
WP_011180232.1|370783_371941_+|integrase	site-specific integrase	integrase	A0A1X9HVL9	Ruegeria_phage	40.8	8.0e-76
WP_011180234.1|372212_372803_+	antA/AntB antirepressor family protein	NA	Q7Y5W2	Haemophilus_phage	49.6	6.2e-24
WP_011180235.1|372922_373198_+	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
WP_011180236.1|373210_373501_+	type II toxin-antitoxin system YafQ family toxin	NA	NA	NA	NA	NA
WP_034447463.1|373623_373836_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011180238.1|373964_374192_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011180239.1|374188_374851_-	glycoside hydrolase family protein	NA	A0A141GEY9	Brucella_phage	61.5	2.6e-47
WP_011180240.1|375010_375313_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A141GEX6	Brucella_phage	45.8	5.4e-16
WP_011180241.1|375299_375620_+	putative addiction module antidote protein	NA	A0A141GEX5	Brucella_phage	46.2	3.3e-16
WP_011180242.1|375663_375942_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011180243.1|375938_376670_-	phage antirepressor Ant	NA	Q7Y5W2	Haemophilus_phage	40.7	1.4e-46
WP_011180244.1|376921_377494_-	antA/AntB antirepressor family protein	NA	Q7Y5W2	Haemophilus_phage	40.7	8.9e-28
WP_011180245.1|377521_378070_-	phage antirepressor Ant	NA	A0A0N6WET9	Escherichia_phage	52.6	5.9e-21
WP_011180246.1|378381_379689_-	phage late control protein	NA	K4HZC6	Acidithiobacillus_phage	39.8	1.6e-69
WP_011180247.1|379685_379910_-|tail	tail protein X	tail	A0A2H4J946	uncultured_Caudovirales_phage	53.1	8.3e-06
WP_011180248.1|379906_380287_-|tail	phage tail protein	tail	D5LGY3	Escherichia_phage	43.1	5.7e-23
WP_011180249.1|380292_382593_-|tail	tail protein	tail	A0A0E3U2N9	Fusobacterium_phage	26.7	5.4e-15
WP_075320635.1|382589_382706_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_011180250.1|382702_382987_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_011180251.1|382988_383495_-|tail	phage major tail tube protein	tail	K4I1G5	Acidithiobacillus_phage	42.2	2.6e-31
WP_011180252.1|383494_384727_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A0A088FVH5	Escherichia_phage	52.2	1.9e-128
WP_011180253.1|385196_385718_+	Rha family transcriptional regulator	NA	A0A159B6D5	Gordonia_phage	57.1	3.8e-25
WP_011180254.1|385763_386093_-	HigA family addiction module antidote protein	NA	NA	NA	NA	NA
WP_011180255.1|386180_386360_+	hypothetical protein	NA	A0A222YXG1	Escherichia_phage	62.5	4.3e-13
WP_011180256.1|386655_387981_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011180257.1|387995_391139_-	DUF4815 domain-containing protein	NA	K4ICQ5	Acidithiobacillus_phage	34.9	6.2e-155
WP_034447459.1|391140_392247_-	phage protein	NA	K4I1F8	Acidithiobacillus_phage	36.4	5.0e-19
WP_011180259.1|392246_393074_-|plate	baseplate J/gp47 family protein	plate	A0A219VH98	Ochrobactrum_phage	34.9	1.7e-40
WP_011180260.1|393070_393400_-	GPW/gp25 family protein	NA	Q75QM0	Wolbachia_phage	59.3	4.9e-31
WP_011180261.1|393408_394098_-|plate	phage baseplate assembly protein V	plate	V5YUM9	Pseudomonas_phage	34.5	4.1e-19
WP_011180262.1|394078_394621_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011180263.1|394672_394945_+	toxin HicA	NA	A0A2P1A0R7	Gordonia_phage	60.0	1.0e-05
WP_004856761.1|394934_395252_+	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_011180264.1|395492_395771_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011180265.1|395767_396526_-	phage antirepressor Ant	NA	Q7Y5W2	Haemophilus_phage	38.3	1.7e-42
WP_011180266.1|396544_397099_-	phage antirepressor Ant	NA	Q7Y5W2	Haemophilus_phage	56.2	2.4e-22
WP_011180267.1|397483_398557_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011180268.1|398592_398946_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011180269.1|398947_400024_-|capsid	major capsid protein	capsid	A0A0A8ILA9	Aurantimonas_phage	35.2	3.8e-56
WP_011180270.1|400036_400405_-|head	head decoration protein	head	A0A0A8IL52	Aurantimonas_phage	46.1	5.7e-12
WP_049784565.1|400401_400722_-	hypothetical protein	NA	NA	NA	NA	NA
WP_034454126.1|400664_401708_-	S49 family peptidase	NA	K4HZZ6	Acidithiobacillus_phage	46.6	8.3e-64
WP_011180273.1|401697_403254_-|portal	phage portal protein	portal	Q75QM9	Wolbachia_phage	35.5	3.5e-74
WP_011180274.1|403253_403502_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011180275.1|403505_405434_-|terminase	phage terminase large subunit family protein	terminase	K4I3Y9	Acidithiobacillus_phage	52.4	1.8e-165
WP_011180276.1|405426_406008_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011180277.1|406070_406385_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A222YWE2	Escherichia_phage	39.8	1.6e-10
WP_011180278.1|406401_406698_+	HigA family addiction module antidote protein	NA	M9MUN2	Rhodococcus_phage	49.4	6.4e-14
WP_011180279.1|406809_406983_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011180280.1|407107_407371_+	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
WP_011180281.1|407357_407639_+	type II toxin-antitoxin system YafQ family toxin	NA	NA	NA	NA	NA
WP_011180242.1|407681_407960_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011180282.1|407956_408715_-	phage antirepressor Ant	NA	Q7Y5W2	Haemophilus_phage	40.7	3.0e-47
WP_011180283.1|408774_409290_-	phage antirepressor Ant	NA	Q7Y5W2	Haemophilus_phage	55.6	7.8e-23
WP_011180285.1|410177_410720_-	phage antirepressor Ant	NA	A0A0P0ZG08	Escherichia_phage	46.9	1.6e-18
WP_011180287.1|411316_411895_-	hypothetical protein	NA	A0A0A8IL87	Aurantimonas_phage	35.0	3.8e-10
WP_011180288.1|411898_412219_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011180290.1|412691_413087_-	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0U4ISP5	Pseudomonas_phage	31.1	1.7e-06
WP_034447446.1|413083_413284_-	type II toxin-antitoxin system HicA family toxin	NA	A0A1L2JY37	Aeribacillus_phage	49.1	1.6e-08
WP_034447444.1|413348_413885_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011180293.1|413895_414342_-	single-stranded DNA-binding protein	NA	A0A0K1LLZ9	Caulobacter_phage	55.7	6.7e-31
WP_011180826.1|414532_414814_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A0M3LQB1	Mannheimia_phage	47.3	1.1e-18
WP_034447441.1|414830_415124_+	HigA family addiction module antidote protein	NA	A0A0M3LPV0	Mannheimia_phage	46.6	6.0e-12
WP_034447437.1|415165_415492_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038525124.1|415656_416076_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011180297.1|416068_417181_-	DUF1376 domain-containing protein	NA	A0A218M9P5	Mycobacterium_phage	51.5	1.6e-12
WP_011180298.1|417170_417518_-	DUF1376 domain-containing protein	NA	A0A076GD06	Sinorhizobium_phage	44.1	1.6e-16
WP_011180299.1|417510_417987_-	hypothetical protein	NA	K4ICN3	Acidithiobacillus_phage	63.8	3.7e-51
WP_011180300.1|418114_418891_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099358257.1|418899_419265_-	hypothetical protein	NA	NA	NA	NA	NA
WP_034447428.1|419364_419724_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011180303.1|419807_420425_+	transcriptional regulator	NA	K7PH71	Enterobacterial_phage	27.1	1.4e-05
WP_011180304.1|420666_421041_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011180305.1|421105_421498_+	Rha family transcriptional regulator	NA	B5AX29	Iodobacteriophage	49.5	2.5e-21
WP_038525127.1|421507_422266_+	antA/AntB antirepressor family protein	NA	Q7Y5W2	Haemophilus_phage	38.2	6.0e-40
WP_034452685.1|422278_422662_+	hypothetical protein	NA	K4Q356	Edwardsiella_phage	57.9	1.0e-11
WP_038525129.1|423103_423883_+	ERF family protein	NA	K4NWX3	Pseudomonas_phage	31.5	2.4e-15
WP_011180604.1|423884_424508_+	YqaJ viral recombinase family protein	NA	A0A0U2BXF3	Paracoccus_phage	43.6	7.4e-44
WP_011180314.1|424580_424784_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011180315.1|425359_426523_+	phosphoserine transaminase	NA	NA	NA	NA	NA
424882:424900	attR	AAGTGGTGCCCAGACGCGG	NA	NA	NA	NA
WP_011180316.1|426911_428201_+	adenylosuccinate synthase	NA	A0A285PX35	Cedratvirus	31.8	4.3e-54
>prophage 2
NZ_HG965802	Bartonella henselae strain BM1374163	1905383	800034	809115	1905383	integrase	Mannheimia_phage(22.22%)	14	784517:784548	814441:814472
784517:784548	attL	CGGGGCTTTTTGTTATTGGGAGAAAGTATTTT	NA	NA	NA	NA
WP_011180600.1|800034_800316_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A0M3LQB1	Mannheimia_phage	45.1	1.1e-15
WP_011180601.1|800334_800634_+	HigA family addiction module antidote protein	NA	A0A0M3LPV0	Mannheimia_phage	47.7	2.8e-17
WP_011180602.1|800690_801728_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A291AUF0	Sinorhizobium_phage	30.3	4.1e-31
WP_034448587.1|801730_801979_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011180604.1|802089_802713_-	YqaJ viral recombinase family protein	NA	A0A0U2BXF3	Paracoccus_phage	43.6	7.4e-44
WP_038525165.1|802714_803494_-	ERF family protein	NA	K4NWX3	Pseudomonas_phage	32.0	6.3e-16
WP_034452685.1|803936_804320_-	hypothetical protein	NA	K4Q356	Edwardsiella_phage	57.9	1.0e-11
WP_011180605.1|804332_805064_-	phage regulatory protein/antirepressor Ant	NA	B5AX29	Iodobacteriophage	41.3	5.1e-28
WP_011180606.1|805078_805435_-	antA/AntB antirepressor family protein	NA	NA	NA	NA	NA
WP_011180607.1|805498_805873_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099358259.1|806111_806381_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011180610.1|806899_807259_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011180611.1|807395_807875_+	hypothetical protein	NA	K4ICN3	Acidithiobacillus_phage	64.0	1.4e-50
WP_034448599.1|807864_809115_+	DUF1376 domain-containing protein	NA	A0A218M9P5	Mycobacterium_phage	52.9	4.2e-14
814441:814472	attR	CGGGGCTTTTTGTTATTGGGAGAAAGTATTTT	NA	NA	NA	NA
>prophage 3
NZ_HG965802	Bartonella henselae strain BM1374163	1905383	1102111	1112715	1905383	tRNA	uncultured_Mediterranean_phage(71.43%)	7	NA	NA
WP_011180873.1|1102111_1103230_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	52.1	1.0e-96
WP_011180874.1|1104393_1104906_-	peptidylprolyl isomerase	NA	A0A1B1IVS0	uncultured_Mediterranean_phage	59.6	1.2e-47
WP_011180875.1|1104928_1105501_-	peptidylprolyl isomerase	NA	A0A1B1IVS0	uncultured_Mediterranean_phage	54.7	1.2e-43
WP_034448154.1|1105490_1106009_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	37.0	7.1e-24
WP_038525424.1|1106033_1108829_-	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	33.7	7.0e-102
WP_011180878.1|1108940_1109459_-	single-stranded DNA-binding protein	NA	A0A0K1LLZ9	Caulobacter_phage	59.3	1.1e-45
WP_038487855.1|1109799_1112715_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	60.4	0.0e+00
