The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_HG969191	Bartonella henselae strain BM1374165	1975503	380109	404706	1975503	terminase	Haemophilus_phage(15.0%)	34	NA	NA
WP_038487054.1|380109_382041_-|terminase	phage terminase large subunit family protein	terminase	K4I3Y9	Acidithiobacillus_phage	52.3	9.6e-167
WP_038488823.1|382033_382615_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038487056.1|382677_382992_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A222YWE2	Escherichia_phage	38.7	2.7e-10
WP_034454130.1|383008_383305_+	HigA family addiction module antidote protein	NA	M9MUN2	Rhodococcus_phage	47.1	5.5e-13
WP_038487057.1|383713_383977_+	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
WP_011180281.1|383963_384245_+	type II toxin-antitoxin system YafQ family toxin	NA	NA	NA	NA	NA
WP_038487059.1|384287_384566_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038487061.1|384562_385321_-	antA/AntB antirepressor family protein	NA	Q7Y5W2	Haemophilus_phage	39.5	3.0e-47
WP_038487063.1|386756_387347_-	antA/AntB antirepressor family protein	NA	Q7Y5W2	Haemophilus_phage	50.0	1.4e-23
WP_038487065.1|387674_388253_-	hypothetical protein	NA	A0A0A8IL87	Aurantimonas_phage	35.0	3.8e-10
WP_038487067.1|388256_388577_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038487068.1|389049_389445_-	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0U4ISP5	Pseudomonas_phage	31.1	2.3e-06
WP_038487070.1|389465_389642_-	type II toxin-antitoxin system HicA family toxin	NA	A0A1L2JY37	Aeribacillus_phage	49.1	3.1e-08
WP_038487071.1|389706_390243_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011180293.1|390253_390700_-	single-stranded DNA-binding protein	NA	A0A0K1LLZ9	Caulobacter_phage	55.7	6.7e-31
WP_011180826.1|390890_391172_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A0M3LQB1	Mannheimia_phage	47.3	1.1e-18
WP_034447441.1|391188_391482_+	HigA family addiction module antidote protein	NA	A0A0M3LPV0	Mannheimia_phage	46.6	6.0e-12
WP_034447437.1|391523_391850_-	hypothetical protein	NA	NA	NA	NA	NA
WP_034447433.1|392014_392434_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038487076.1|392426_393494_-	DUF1376 domain-containing protein	NA	A0A218M9P5	Mycobacterium_phage	51.5	1.5e-12
WP_034452646.1|393483_393828_-	DUF1376 domain-containing protein	NA	NA	NA	NA	NA
WP_038487079.1|393817_394300_-	phage related protein	NA	K4ICN3	Acidithiobacillus_phage	58.5	3.1e-42
WP_038488829.1|394430_395198_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038488832.1|395215_395581_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038488835.1|396129_396747_+	transcriptional regulator	NA	K7PH71	Enterobacterial_phage	28.9	1.8e-05
WP_038487083.1|396961_397336_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038487085.1|397401_397794_+	Rha family transcriptional regulator	NA	B5AX29	Iodobacteriophage	49.5	2.5e-21
WP_038487087.1|397803_398562_+	antA/AntB antirepressor family protein	NA	Q7Y5W2	Haemophilus_phage	38.6	3.0e-39
WP_038487089.1|398922_399453_+	antA/AntB antirepressor family protein	NA	A0A139ZPI9	Marinitoga_camini_virus	64.2	6.8e-30
WP_038487091.1|399607_400387_+	ERF family protein	NA	K4NWX3	Pseudomonas_phage	31.5	3.1e-15
WP_038487093.1|400388_401012_+	YqaJ viral recombinase family protein	NA	A0A0U2BXF3	Paracoccus_phage	43.6	9.7e-44
WP_011180314.1|401084_401288_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_038487095.1|401863_403027_+	phosphoserine transaminase	NA	NA	NA	NA	NA
WP_011180316.1|403416_404706_+	adenylosuccinate synthase	NA	A0A285PX35	Cedratvirus	31.8	4.3e-54
>prophage 2
NZ_HG969191	Bartonella henselae strain BM1374165	1975503	776425	785506	1975503	integrase	Mannheimia_phage(22.22%)	14	760908:760939	790868:790899
760908:760939	attL	CGGGGCTTTTTGTTATTGGGAGAAAGTATTTT	NA	NA	NA	NA
WP_011180600.1|776425_776707_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A0M3LQB1	Mannheimia_phage	45.1	1.1e-15
WP_011180601.1|776725_777025_+	HigA family addiction module antidote protein	NA	A0A0M3LPV0	Mannheimia_phage	47.7	2.8e-17
WP_011180602.1|777081_778119_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A291AUF0	Sinorhizobium_phage	30.3	4.1e-31
WP_034448587.1|778121_778370_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011180604.1|778480_779104_-	YqaJ viral recombinase family protein	NA	A0A0U2BXF3	Paracoccus_phage	43.6	7.4e-44
WP_038487424.1|779105_779885_-	ERF family protein	NA	K4NWX3	Pseudomonas_phage	32.0	1.1e-15
WP_034452685.1|780327_780711_-	hypothetical protein	NA	K4Q356	Edwardsiella_phage	57.9	1.0e-11
WP_011180605.1|780723_781455_-	phage regulatory protein/antirepressor Ant	NA	B5AX29	Iodobacteriophage	41.3	5.1e-28
WP_011180606.1|781469_781826_-	antA/AntB antirepressor family protein	NA	NA	NA	NA	NA
WP_011180607.1|781889_782264_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099358259.1|782502_782772_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011180610.1|783290_783650_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011180611.1|783786_784266_+	hypothetical protein	NA	K4ICN3	Acidithiobacillus_phage	64.0	1.4e-50
WP_038487430.1|784255_785506_+	DUF1376 domain-containing protein	NA	A0A218M9P5	Mycobacterium_phage	52.9	4.2e-14
790868:790899	attR	CGGGGCTTTTTGTTATTGGGAGAAAGTATTTT	NA	NA	NA	NA
>prophage 3
NZ_HG969191	Bartonella henselae strain BM1374165	1975503	881373	891128	1975503	integrase	Mannheimia_phage(22.22%)	15	875330:875344	889941:889955
875330:875344	attL	ATCAACAATCAGAAG	NA	NA	NA	NA
WP_011180600.1|881373_881655_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A0M3LQB1	Mannheimia_phage	45.1	1.1e-15
WP_034454650.1|881673_881973_+	HigA family addiction module antidote protein	NA	A0A0M3LPV0	Mannheimia_phage	47.7	2.8e-17
WP_038487481.1|882029_883067_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A291AUF0	Sinorhizobium_phage	30.5	8.3e-32
WP_034448587.1|883069_883318_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038487093.1|883428_884052_-	YqaJ viral recombinase family protein	NA	A0A0U2BXF3	Paracoccus_phage	43.6	9.7e-44
WP_038487483.1|884053_884833_-	ERF family protein	NA	K4NWX3	Pseudomonas_phage	31.5	3.1e-15
WP_011180605.1|884980_885712_-	phage regulatory protein/antirepressor Ant	NA	B5AX29	Iodobacteriophage	41.3	5.1e-28
WP_011180606.1|885726_886083_-	antA/AntB antirepressor family protein	NA	NA	NA	NA	NA
WP_038487486.1|886146_886521_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038488835.1|886735_887353_-	transcriptional regulator	NA	K7PH71	Enterobacterial_phage	28.9	1.8e-05
WP_038488832.1|887901_888267_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038488829.1|888284_889052_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038487489.1|889182_889665_+	phage related protein	NA	K4ICN3	Acidithiobacillus_phage	65.5	1.6e-49
WP_034452646.1|889654_889999_+	DUF1376 domain-containing protein	NA	NA	NA	NA	NA
889941:889955	attR	ATCAACAATCAGAAG	NA	NA	NA	NA
WP_038487492.1|889988_891128_+	DUF1376 domain-containing protein	NA	A0A218M9P5	Mycobacterium_phage	52.9	8.6e-14
>prophage 4
NZ_HG969191	Bartonella henselae strain BM1374165	1975503	1187995	1198599	1975503	tRNA	uncultured_Mediterranean_phage(71.43%)	7	NA	NA
WP_011180873.1|1187995_1189114_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	52.1	1.0e-96
WP_038487847.1|1190277_1190790_-	peptidylprolyl isomerase	NA	A0A1B1IVS0	uncultured_Mediterranean_phage	60.1	3.4e-47
WP_038487850.1|1190812_1191385_-	peptidylprolyl isomerase	NA	A0A1B1IVS0	uncultured_Mediterranean_phage	54.2	3.4e-43
WP_034448154.1|1191374_1191893_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	37.0	7.1e-24
WP_038488907.1|1191917_1194713_-	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	33.7	7.0e-102
WP_011180878.1|1194824_1195343_-	single-stranded DNA-binding protein	NA	A0A0K1LLZ9	Caulobacter_phage	59.3	1.1e-45
WP_038487855.1|1195683_1198599_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	60.4	0.0e+00
>prophage 5
NZ_HG969191	Bartonella henselae strain BM1374165	1975503	1661839	1738597	1975503	terminase,capsid,tail,holin,portal	Klebsiella_phage(12.5%)	60	NA	NA
WP_038488418.1|1661839_1662847_-|tail	tail fiber protein	tail	D5LGZ0	Escherichia_phage	38.8	2.0e-22
WP_038488421.1|1662843_1663968_-|tail	tail fiber domain-containing protein	tail	NA	NA	NA	NA
WP_038488424.1|1663964_1664423_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038488427.1|1664714_1666178_-	hypothetical protein	NA	D6PEY0	uncultured_phage	28.4	7.6e-47
WP_011181177.1|1666534_1667230_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038488430.1|1667609_1668728_-|capsid	N4-gp56 family major capsid protein	capsid	A0A248SKT9	Klebsiella_phage	33.4	9.5e-42
WP_038488433.1|1669099_1669897_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038488439.1|1670265_1672104_-|portal	phage portal protein	portal	A0A248SKZ2	Klebsiella_phage	24.3	2.5e-31
WP_038488442.1|1672103_1673429_-|terminase	terminase	terminase	A0A088F6U9	Sulfitobacter_phage	56.2	2.5e-142
WP_038488445.1|1673843_1674173_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038488448.1|1675177_1677757_-	ATP-dependent chaperone ClpB	NA	K4FB40	Cronobacter_phage	38.5	1.3e-121
WP_051524352.1|1678760_1679033_-	DNA gyrase inhibitor YacG	NA	NA	NA	NA	NA
WP_011181190.1|1679058_1679757_-	septum formation protein Maf	NA	NA	NA	NA	NA
WP_004856585.1|1679952_1680171_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_038488457.1|1680843_1681212_+	helix-turn-helix transcriptional regulator	NA	K4K6E9	Caulobacter_phage	39.8	1.8e-10
WP_038488460.1|1684266_1684848_-	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_038488463.1|1684858_1685011_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038488466.1|1685958_1686330_+	helix-turn-helix transcriptional regulator	NA	K4K6E9	Caulobacter_phage	54.5	3.2e-10
WP_172642315.1|1686825_1687017_+	HipA N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_051524353.1|1686983_1687397_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051524354.1|1687798_1688044_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155265939.1|1688166_1688340_-	hypothetical protein	NA	NA	NA	NA	NA
WP_034454583.1|1688363_1688708_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155245598.1|1691425_1691572_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011181203.1|1692294_1692792_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	38.4	5.2e-16
WP_038488469.1|1692793_1694044_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_011181208.1|1695762_1695888_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_011181209.1|1696000_1696798_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011181210.1|1697200_1697356_-	resolvase fragment-like protein	NA	NA	NA	NA	NA
WP_011181212.1|1697639_1698098_+	helix-turn-helix transcriptional regulator	NA	A0A223W054	Agrobacterium_phage	56.3	6.9e-15
WP_034448520.1|1699949_1700558_+	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
WP_011181215.1|1700576_1701398_+	TIGR00282 family metallophosphoesterase	NA	NA	NA	NA	NA
WP_011181216.1|1703372_1704668_-	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_162097321.1|1704776_1705007_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038488477.1|1705714_1706431_-	YqaJ viral recombinase family protein	NA	Q9MC71	Pseudomonas_phage	43.9	9.1e-38
WP_034454574.1|1707293_1707491_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038488483.1|1707496_1707886_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011181221.1|1708199_1708517_-	hypothetical protein	NA	A0A2L0V128	Agrobacterium_phage	51.5	3.2e-19
WP_038488486.1|1708975_1710004_+	DUF1376 domain-containing protein	NA	A0A076GD06	Sinorhizobium_phage	41.3	1.5e-17
WP_038488490.1|1710277_1712812_+	toprim domain-containing protein	NA	K4NWL6	Pseudomonas_phage	29.7	4.3e-98
WP_034448319.1|1713197_1713416_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011181226.1|1714098_1714665_+	hypothetical protein	NA	NA	NA	NA	NA
WP_034448331.1|1717912_1718119_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155245599.1|1719225_1719402_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011181228.1|1720276_1720561_-	hypothetical protein	NA	NA	NA	NA	NA
WP_034448338.1|1721779_1722193_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172642081.1|1723119_1723278_-	hypothetical protein	NA	NA	NA	NA	NA
WP_034448348.1|1725022_1725571_+	hypothetical protein	NA	NA	NA	NA	NA
WP_034448356.1|1727921_1728584_+	glycoside hydrolase family protein	NA	A0A141GEY9	Brucella_phage	62.1	4.2e-45
WP_011181234.1|1728580_1728808_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011181235.1|1728936_1729158_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038488970.1|1731345_1731954_+	DedA family protein	NA	NA	NA	NA	NA
WP_011181238.1|1731966_1732539_+	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_038488518.1|1732637_1732838_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011181239.1|1733320_1734130_+	membrane protein	NA	NA	NA	NA	NA
WP_038488522.1|1734560_1735115_+	dUTP diphosphatase	NA	A0A2R8FDW2	Brazilian_cedratvirus	59.7	1.7e-36
WP_011181241.1|1735940_1736522_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_038488524.1|1736518_1737361_-	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_038488973.1|1737829_1738156_+	DUF883 family protein	NA	NA	NA	NA	NA
WP_038488527.1|1738159_1738597_+|holin	phage holin family protein	holin	NA	NA	NA	NA
