The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP007494	Bordetella holmesii ATCC 51541, complete genome	3699674	560907	614457	3699674	integrase,transposase	Ralstonia_virus(18.18%)	34	561476:561535	610052:610622
WP_101557770.1|560907_562027_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
561476:561535	attL	GACCGAGCGCGTGGTTCGCCCAGCGGCAATCGCGCCGAATCAGAGTTGGTCAATGGACTT	NA	NA	NA	NA
WP_005015714.1|562348_563065_-	phosphoserine phosphatase SerB	NA	NA	NA	NA	NA
WP_005015715.1|563061_563955_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005011985.1|564118_565339_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005015716.1|565491_566574_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.1	1.5e-31
WP_005015717.1|568252_569236_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_005015719.1|569298_570711_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_005015721.1|570828_571671_+	cytochrome assembly protein	NA	NA	NA	NA	NA
WP_005015735.1|571949_572558_+	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	46.8	1.0e-05
WP_005015738.1|572573_573194_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_005015741.1|573258_573966_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.3	1.2e-13
WP_005015743.1|573970_574693_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	28.6	1.9e-11
WP_005015745.1|574679_574970_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005015748.1|575045_576266_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	2.1e-183
WP_025341216.1|576990_577842_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005015753.1|577893_579147_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005015755.1|579323_580112_-	putative hydro-lyase	NA	NA	NA	NA	NA
WP_005015757.1|580230_581145_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005015758.1|581277_583170_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	37.9	4.6e-121
WP_017685928.1|583355_584735_+	uracil-xanthine permease	NA	H9YQ34	environmental_Halophage	50.7	4.1e-26
WP_076879504.1|585179_585476_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_005015774.1|589275_589878_-	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_005015780.1|590470_591070_-	iron transport sensor protein	NA	NA	NA	NA	NA
WP_005015786.1|591920_592775_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_005015790.1|592894_593482_+	HutD family protein	NA	NA	NA	NA	NA
WP_005015791.1|593478_594858_+	formimidoylglutamate deiminase	NA	NA	NA	NA	NA
WP_100225804.1|603167_604517_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	G9E4Q1	Emiliania_huxleyi_virus	32.3	2.9e-45
WP_005015796.1|604530_605382_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	40.4	4.4e-47
WP_005015799.1|605393_606659_-	capsular biosynthesis protein	NA	NA	NA	NA	NA
WP_005015801.1|606720_608625_-	capsular polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_005015804.1|610600_611455_-	hypothetical protein	NA	NA	NA	NA	NA
610052:610622	attR	GACCGAGCGCGTGGTTCGCCCAGCGGCAATCGCGCCGAATCAGAGTTGGTCAATGGACTTTGTGGCCGACGGCCTAGCCTATGGCCGCCGATTCCGCTGTTTGACTATCGTCGATGACTACACTCGCGAATGCCTGGCCATCGAGGTCGATACGTCGTTGCCGGGACTGCGTGTTGCCATGGTGCTGCAACGGCTGGCGGAGATGCGTGGCCTGCCGCGATCTATTACCGTGGACAACGGGCCAGAGTTCGCCGGAAGAGCCTTGGACGCCTGGGCCTACCAAGCAGGCGTAAAGCTGTCGTTTATTCGGCCGGGTAAGCCGGTGGAGAACGCTTATATCGAAAGTTTCAACGGCAAGTTCCGCGACGAATGCCTTAACGAGCACTGGTTCTTGTCCCTGCGACAGGCTAAAAGCTTGATCGAAAACTGGCGAGTCGAGTACAACACCGATCGGCCTCACAGCGCGCTCGGATATTTAACGCCGGCGCAATTCGTGCAGGCTCATCAGAAAGAAGGTCTTTTACCCCTGGGCTCTATGTCGGTGCCGTACTAAATCTGGGGGCAGGTCAGC	NA	NA	NA	NA
WP_005015806.1|611447_612242_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005015810.1|612457_613408_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005015811.1|613506_614457_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP007494	Bordetella holmesii ATCC 51541, complete genome	3699674	1000658	1066136	3699674	transposase,tRNA	Leptospira_phage(22.22%)	47	NA	NA
WP_005016594.1|1000658_1001609_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005016595.1|1001647_1002355_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101557770.1|1002322_1003443_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005016599.1|1005164_1006688_-	phospholipase D family protein	NA	NA	NA	NA	NA
WP_005016600.1|1006742_1007390_-	carbonic anhydrase	NA	NA	NA	NA	NA
WP_005016601.1|1007532_1007874_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005016603.1|1008031_1008364_+	phosphate starvation-inducible protein	NA	NA	NA	NA	NA
WP_005016604.1|1008412_1009453_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005016612.1|1010270_1010567_-	YciI family protein	NA	NA	NA	NA	NA
WP_005016613.1|1010581_1010857_-	muconolactone Delta-isomerase	NA	NA	NA	NA	NA
WP_005016616.1|1010924_1011569_-	CoA transferase subunit B	NA	NA	NA	NA	NA
WP_005016619.1|1011851_1012637_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005016620.1|1012674_1013400_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_005016622.1|1013413_1014754_-	short-chain fatty acid transporter	NA	NA	NA	NA	NA
WP_005016624.1|1014848_1015781_-	3-hydroxyacyl-CoA dehydrogenase family protein	NA	NA	NA	NA	NA
WP_005016626.1|1016009_1018781_-	S8 family serine peptidase	NA	NA	NA	NA	NA
WP_005016629.1|1019219_1022066_-	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
WP_005016630.1|1022212_1022926_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A0A0RPC6	Escherichia_phage	41.4	1.6e-47
WP_005016651.1|1022938_1023481_-	N-acetyltransferase	NA	A0A2H4J136	uncultured_Caudovirales_phage	45.8	1.1e-27
WP_005016653.1|1024584_1026441_+	dihydroxy-acid dehydratase	NA	NA	NA	NA	NA
WP_076879512.1|1026624_1027665_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	28.2	4.3e-20
WP_005016655.1|1027807_1028713_+	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_153566142.1|1030270_1030414_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012067.1|1030400_1031351_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005016656.1|1031407_1032175_-	trans-aconitate 2-methyltransferase	NA	NA	NA	NA	NA
WP_005016658.1|1032292_1032937_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005016662.1|1033200_1033497_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005016664.1|1033643_1034714_+	RNA methyltransferase	NA	NA	NA	NA	NA
WP_005016666.1|1035409_1036264_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005016668.1|1036289_1037510_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	1.0e-182
WP_101557770.1|1040230_1041350_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_076879513.1|1041353_1041602_+	DUF934 domain-containing protein	NA	NA	NA	NA	NA
WP_005016690.1|1041619_1042186_-	UbiX family flavin prenyltransferase	NA	NA	NA	NA	NA
WP_005016691.1|1042188_1042515_-	Grx4 family monothiol glutaredoxin	NA	NA	NA	NA	NA
WP_005016692.1|1042555_1043365_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_005016693.1|1043370_1044453_-	peptide chain release factor 1	NA	A0A0S4KWG0	Pseudomonas_phage	40.7	3.3e-07
WP_005016694.1|1044534_1045809_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_005016695.1|1046453_1046933_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_005016697.1|1048054_1050574_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_005016698.1|1051833_1054902_+	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_005016699.1|1057977_1058811_+	metallophosphoesterase	NA	A0A067XQN2	Caulobacter_phage	28.3	4.8e-22
WP_005016700.1|1058807_1060286_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	63.8	1.1e-159
WP_025341254.1|1060732_1061878_+	muconate cycloisomerase	NA	NA	NA	NA	NA
WP_005016702.1|1061927_1062863_+	catechol 1,2-dioxygenase	NA	NA	NA	NA	NA
WP_005016703.1|1062993_1064292_+	MFS transporter	NA	NA	NA	NA	NA
WP_005016704.1|1064307_1065087_+	1,6-dihydroxycyclohexa-2,4-diene-1-carboxylate dehydrogenase	NA	NA	NA	NA	NA
WP_005016705.1|1065185_1066136_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP007494	Bordetella holmesii ATCC 51541, complete genome	3699674	1930311	1998397	3699674	transposase,tRNA	Ralstonia_virus(41.67%)	51	NA	NA
WP_005012861.1|1930311_1931532_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.6	4.2e-184
WP_005018628.1|1932008_1932464_-	multidrug/biocide efflux PACE transporter	NA	NA	NA	NA	NA
WP_005018629.1|1933431_1935000_-	argininosuccinate lyase	NA	NA	NA	NA	NA
WP_005018630.1|1935222_1935660_+	universal stress protein	NA	NA	NA	NA	NA
WP_005018631.1|1935671_1936082_-	DUF861 domain-containing protein	NA	NA	NA	NA	NA
WP_005018632.1|1936112_1936886_-	NAD(+) diphosphatase	NA	NA	NA	NA	NA
WP_005018633.1|1937112_1939215_+	PQQ-binding-like beta-propeller repeat protein	NA	NA	NA	NA	NA
WP_005018635.1|1940590_1940806_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100225794.1|1940921_1941857_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025341328.1|1941960_1942851_+	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
WP_005018638.1|1942927_1943896_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_005018645.1|1944681_1946775_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_005018646.1|1946804_1947113_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005018648.1|1948142_1949555_-	transglycosylase SLT domain-containing protein	NA	A0A223LD43	Bacillus_phage	29.3	2.1e-06
WP_005018649.1|1949562_1950372_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_005018653.1|1952903_1953101_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_005011985.1|1953063_1954284_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005018655.1|1957292_1958027_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	42.4	2.6e-40
WP_005016668.1|1958195_1959416_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	1.0e-182
WP_005018658.1|1959790_1960777_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_005020418.1|1960780_1963504_+	ribosome-associated ATPase/putative transporter RbbA	NA	A0A2H4PQG7	Staphylococcus_phage	29.2	6.6e-20
WP_005018662.1|1963504_1964632_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_005018665.1|1964644_1966057_+	TolC family protein	NA	NA	NA	NA	NA
WP_005018666.1|1966061_1966238_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005018670.1|1966231_1966888_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_005018673.1|1966908_1967955_+	glycosyltransferase family 2 protein	NA	F1C5B0	Cronobacter_phage	39.5	1.4e-58
WP_005018676.1|1967951_1969541_+	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_005018678.1|1969476_1969986_-	GtrA family protein	NA	NA	NA	NA	NA
WP_017685335.1|1969911_1970805_+	ChbG/HpnK family deacetylase	NA	NA	NA	NA	NA
WP_005018681.1|1970794_1971691_-	alpha/beta fold hydrolase	NA	A0A1C9C5K3	Heterosigma_akashiwo_virus	33.1	6.5e-09
WP_025341331.1|1973461_1974886_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_005018691.1|1974958_1975303_+	TIGR01244 family phosphatase	NA	NA	NA	NA	NA
WP_005018693.1|1975388_1975853_+	universal stress protein	NA	NA	NA	NA	NA
WP_005018697.1|1977016_1979131_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	28.1	6.0e-61
WP_005018699.1|1979163_1979961_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_005013747.1|1980172_1981123_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005018702.1|1981155_1981602_+	YbaK/EbsC family protein	NA	NA	NA	NA	NA
WP_005018704.1|1981650_1982340_-	tol-pal system protein YbgF	NA	NA	NA	NA	NA
WP_005018707.1|1982427_1982922_-	peptidoglycan-associated lipoprotein Pal	NA	NA	NA	NA	NA
WP_005018709.1|1982953_1984270_-	Tol-Pal system protein TolB	NA	NA	NA	NA	NA
WP_005018713.1|1985240_1985702_-	protein TolR	NA	NA	NA	NA	NA
WP_005018715.1|1985701_1986376_-	protein TolQ	NA	NA	NA	NA	NA
WP_005018717.1|1986378_1986801_-	tol-pal system-associated acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_005018720.1|1986854_1988585_-|tRNA	proline--tRNA ligase	tRNA	A0A2K9L3R9	Tupanvirus	28.6	1.2e-11
WP_005018723.1|1988650_1989220_+	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_005018726.1|1989200_1989887_+	response regulator	NA	NA	NA	NA	NA
WP_025341333.1|1989909_1991412_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_005018735.1|1992093_1993614_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012861.1|1993667_1994888_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.6	4.2e-184
WP_005018740.1|1996071_1996977_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005012861.1|1997176_1998397_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.6	4.2e-184
>prophage 5
NZ_CP007494	Bordetella holmesii ATCC 51541, complete genome	3699674	2372822	2448789	3699674	protease,transposase	Ralstonia_virus(25.0%)	58	NA	NA
WP_005011985.1|2372822_2374043_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005012524.1|2378444_2379074_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005012526.1|2379108_2380386_-	TRAP transporter large permease subunit	NA	NA	NA	NA	NA
WP_005012527.1|2380426_2380927_-	TRAP transporter small permease	NA	NA	NA	NA	NA
WP_005012529.1|2380988_2381963_-	DctP family TRAP transporter solute-binding subunit	NA	NA	NA	NA	NA
WP_005012536.1|2384600_2385026_+	group II truncated hemoglobin	NA	NA	NA	NA	NA
WP_005012541.1|2385015_2385717_+	3-deoxy-D-manno-octulosonic acid kinase	NA	NA	NA	NA	NA
WP_005012543.1|2385865_2386969_+	polyamine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005012548.1|2386975_2388103_+	polyamine ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	35.3	6.3e-25
WP_017685678.1|2388099_2389008_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_005012551.1|2389004_2389811_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_005012552.1|2389807_2390161_+	arsenate reductase	NA	NA	NA	NA	NA
WP_005012556.1|2390869_2391583_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012558.1|2391722_2393027_+	DNA recombination protein RmuC	NA	NA	NA	NA	NA
WP_005012560.1|2394733_2395408_+	ribose-5-phosphate isomerase RpiA	NA	NA	NA	NA	NA
WP_005012561.1|2395559_2396309_+	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_005012563.1|2396574_2396847_-	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_005019011.1|2396946_2398302_-	amino-acid N-acetyltransferase	NA	NA	NA	NA	NA
WP_005012567.1|2398487_2402348_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SBU4	Catovirus	28.6	1.8e-47
WP_005012570.1|2402393_2403293_-	lipid A hydroxylase LpxO	NA	H8ZJK8	Ostreococcus_tauri_virus	35.6	8.5e-33
WP_005012572.1|2403431_2406923_+	DNA polymerase III subunit alpha	NA	A0A0K1Y906	Streptomyces_phage	38.4	2.3e-187
WP_005012574.1|2406922_2408023_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_005012577.1|2408019_2408871_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_005012580.1|2408867_2409626_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_005012582.1|2409622_2410738_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_025341365.1|2410785_2411511_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_005012587.1|2411488_2412649_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_076879486.1|2412645_2412903_-	zinc/iron-chelating domain-containing protein	NA	NA	NA	NA	NA
WP_005012592.1|2412905_2413670_-	YdcF family protein	NA	NA	NA	NA	NA
WP_005012594.1|2413682_2414672_-	heptosyltransferase II	NA	NA	NA	NA	NA
WP_017685673.1|2414733_2416509_+	lipid A export permease/ATP-binding protein MsbA	NA	W8CYL7	Bacillus_phage	29.3	8.9e-50
WP_005011985.1|2416632_2417853_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005012606.1|2418881_2419871_+	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_005012607.1|2419991_2420873_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_005019028.1|2421046_2421901_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005012610.1|2421932_2422781_+	sulfurtransferase	NA	NA	NA	NA	NA
WP_005012613.1|2422908_2424129_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	74.9	1.1e-181
WP_005012623.1|2426198_2427203_-	acyltransferase family protein	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	25.9	3.9e-18
WP_005012624.1|2427359_2428331_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_005012626.1|2428409_2429198_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_101557784.1|2429239_2429506_+	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_005012631.1|2429514_2430426_+	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_005012636.1|2432500_2433298_+	GTP cyclohydrolase I FolE2	NA	NA	NA	NA	NA
WP_005012637.1|2433529_2433904_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_005012639.1|2433980_2434304_+	primosomal replication protein N	NA	NA	NA	NA	NA
WP_005012641.1|2434387_2434660_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_005012642.1|2434674_2435130_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_005012643.1|2435251_2436088_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012644.1|2436084_2437458_+	replicative DNA helicase	NA	C7BGG1	Burkholderia_phage	57.7	1.1e-132
WP_005012650.1|2437772_2438723_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012655.1|2439627_2440605_-	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_005012656.1|2440729_2442385_-	PhoH family protein	NA	A0A1L2CUJ9	Pectobacterium_phage	33.7	1.2e-69
WP_005012657.1|2442433_2442898_-	peroxiredoxin	NA	NA	NA	NA	NA
WP_005012658.1|2442894_2443356_-	Xcc1710-like domain-containing protein	NA	NA	NA	NA	NA
WP_100225816.1|2443452_2444769_+	alanine transaminase	NA	NA	NA	NA	NA
WP_005012660.1|2444765_2446070_+	homoserine dehydrogenase	NA	NA	NA	NA	NA
WP_005012661.1|2446066_2447476_+	threonine synthase	NA	NA	NA	NA	NA
WP_101557744.1|2447669_2448789_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.6	5.8e-55
>prophage 6
NZ_CP007494	Bordetella holmesii ATCC 51541, complete genome	3699674	2454442	2524463	3699674	protease,transposase,tRNA	Leptospira_phage(18.18%)	56	NA	NA
WP_005012668.1|2454442_2455903_+|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_005012669.1|2456165_2457239_+	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A2I6UFP9	Klebsiella_phage	46.4	7.9e-78
WP_005012670.1|2457323_2458544_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	3.5e-183
WP_101557770.1|2460300_2461421_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005012673.1|2462906_2464010_+	glycolate oxidase subunit GlcE	NA	NA	NA	NA	NA
WP_005012675.1|2464014_2465265_+	glycolate oxidase subunit GlcF	NA	NA	NA	NA	NA
WP_005012676.1|2465261_2466707_-	NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta	NA	NA	NA	NA	NA
WP_005012678.1|2466703_2467018_-	NAD(P) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_005012682.1|2468318_2469539_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.6	5.5e-184
WP_005012685.1|2469638_2470505_-	N-formylglutamate amidohydrolase	NA	NA	NA	NA	NA
WP_005012688.1|2470565_2471546_-	tripartite tricarboxylate transporter substrate binding protein BugE	NA	NA	NA	NA	NA
WP_005012689.1|2471692_2472613_+	transcriptional regulator GcvA	NA	Q6JIH3	Burkholderia_virus	30.8	2.1e-26
WP_005012692.1|2472621_2473734_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_005012695.1|2473815_2474637_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_005012698.1|2474712_2475321_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_005012700.1|2475458_2476835_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	46.1	7.2e-108
WP_005012704.1|2476896_2477340_+	cytochrome c	NA	NA	NA	NA	NA
WP_080688213.1|2477406_2478063_-	cytochrome B	NA	NA	NA	NA	NA
WP_101557770.1|2478105_2479225_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005012709.1|2479394_2479676_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012711.1|2480386_2481175_+	DUF3053 family protein	NA	NA	NA	NA	NA
WP_005012713.1|2481171_2482278_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_005012715.1|2482951_2484310_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	38.3	2.1e-19
WP_005012717.1|2484424_2484622_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101557770.1|2484639_2485760_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_076879487.1|2485853_2486408_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	43.7	1.3e-31
WP_005012730.1|2486995_2488312_-	ergothioneine biosynthesis protein EgtB	NA	NA	NA	NA	NA
WP_153566681.1|2488324_2489344_-	L-histidine N(alpha)-methyltransferase	NA	NA	NA	NA	NA
WP_080691269.1|2489597_2489897_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012745.1|2490914_2491214_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012747.1|2492574_2494233_-	FMN-binding glutamate synthase family protein	NA	NA	NA	NA	NA
WP_005012749.1|2494381_2495602_-	YeeE/YedE family protein	NA	NA	NA	NA	NA
WP_005012751.1|2495719_2497003_-	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	68.4	4.6e-157
WP_005012755.1|2498056_2498515_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_025341372.1|2499868_2502343_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	32.1	4.0e-64
WP_005012762.1|2502450_2503188_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_005019089.1|2503234_2504479_+	cystathionine gamma-synthase family protein	NA	A0A0B5JD48	Pandoravirus	27.1	1.3e-10
WP_005012769.1|2504801_2505074_+	HU family DNA-binding protein	NA	A4JWM7	Burkholderia_virus	56.2	4.2e-20
WP_005012771.1|2505657_2506386_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_005012772.1|2506407_2507325_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_005012775.1|2507324_2507834_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_005012777.1|2507950_2508622_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_100225809.1|2508677_2509799_+	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	27.7	2.9e-14
WP_005012781.1|2509818_2511663_+	potassium transporter Kup	NA	A7K9V6	Acanthocystis_turfacea_chlorella_virus	30.0	5.9e-65
WP_005012784.1|2511799_2512987_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012786.1|2513286_2514072_+	acyltransferase	NA	NA	NA	NA	NA
WP_101557770.1|2514095_2515215_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005012789.1|2515319_2516657_-	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	83.3	4.3e-57
WP_005012790.1|2516765_2517707_-	ornithine carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	26.0	5.8e-16
WP_005012795.1|2517762_2518944_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	28.4	2.1e-23
WP_005012796.1|2519102_2519393_+	DUF3579 domain-containing protein	NA	NA	NA	NA	NA
WP_005012797.1|2519439_2520108_-	2-hydroxyacid dehydrogenase	NA	A0A1J0F959	Only_Syngen_Nebraska_virus	26.8	8.9e-11
WP_005012798.1|2520104_2520392_-	D-isomer specific 2-hydroxyacid dehydrogenase	NA	NA	NA	NA	NA
WP_038543190.1|2520774_2521560_+	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_005012801.1|2521592_2522327_+	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005011985.1|2523242_2524463_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
>prophage 7
NZ_CP007494	Bordetella holmesii ATCC 51541, complete genome	3699674	2529250	2583214	3699674	protease,transposase,tRNA	Ralstonia_virus(25.0%)	39	NA	NA
WP_005012808.1|2529250_2530201_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012810.1|2530282_2530762_-	sensor protein	NA	NA	NA	NA	NA
WP_005012811.1|2531973_2533173_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	74.9	1.2e-178
WP_005012812.1|2533318_2533696_-	c-type cytochrome	NA	NA	NA	NA	NA
WP_005012813.1|2533719_2535501_-	GMC family oxidoreductase	NA	NA	NA	NA	NA
WP_005012815.1|2536530_2538090_-	murein biosynthesis integral membrane protein MurJ	NA	NA	NA	NA	NA
WP_005012817.1|2538149_2538908_-	3-hydroxyacyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_005019095.1|2539004_2539661_-	adenylate kinase	NA	NA	NA	NA	NA
WP_005012820.1|2539814_2540579_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_005012822.1|2540593_2540773_-	Trm112 family protein	NA	NA	NA	NA	NA
WP_005012823.1|2540798_2541833_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_005012826.1|2541829_2542243_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_005012827.1|2542239_2542824_-	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_005012828.1|2543176_2544535_+	exodeoxyribonuclease VII large subunit	NA	A0A1V0SD82	Indivirus	33.6	1.0e-29
WP_005012829.1|2544628_2545207_+	superoxide dismutase	NA	NA	NA	NA	NA
WP_101557770.1|2545331_2546452_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_080601032.1|2546524_2547781_+	chloride channel protein	NA	NA	NA	NA	NA
WP_005019101.1|2547884_2549090_+	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
WP_005012833.1|2549153_2549603_-	DUF192 domain-containing protein	NA	A0A1B1IUW8	uncultured_Mediterranean_phage	42.2	6.8e-15
WP_005012834.1|2549735_2549981_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	75.0	6.5e-20
WP_005012835.1|2550205_2550520_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	43.9	8.4e-12
WP_005012840.1|2561586_2563254_+	MCE family protein	NA	NA	NA	NA	NA
WP_005012841.1|2563256_2563922_+	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_005012843.1|2564054_2567861_+	trifunctional transcriptional regulator/proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_005012844.1|2568086_2569232_+	branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005012847.1|2569350_2570280_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005012848.1|2570276_2571353_+	inner-membrane translocator	NA	NA	NA	NA	NA
WP_005012850.1|2571349_2572156_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	23.9	7.2e-15
WP_005012851.1|2572152_2572884_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.3	2.6e-16
WP_005012853.1|2573260_2574499_-	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	28.3	6.2e-26
WP_005012854.1|2574546_2574885_-	nitrogen regulatory protein P-II 1	NA	NA	NA	NA	NA
WP_005012067.1|2575131_2576082_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012855.1|2576400_2576583_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005011985.1|2576648_2577869_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005012861.1|2577962_2579183_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.6	4.2e-184
WP_005012863.1|2579242_2579506_+	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_005012868.1|2581546_2581744_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_005012869.1|2581759_2582119_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_005012870.1|2582191_2583214_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	38.8	6.1e-27
>prophage 8
NZ_CP007494	Bordetella holmesii ATCC 51541, complete genome	3699674	2909117	2968446	3699674	transposase	Ralstonia_virus(10.53%)	48	NA	NA
WP_005011985.1|2909117_2910338_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013527.1|2910690_2911167_+	transcription elongation factor GreA	NA	NA	NA	NA	NA
WP_005013528.1|2911425_2912034_-	YhbY family RNA-binding protein	NA	NA	NA	NA	NA
WP_005013529.1|2912052_2912724_+	RlmE family RNA methyltransferase	NA	NA	NA	NA	NA
WP_005019299.1|2912897_2914784_+	ATP-dependent metallopeptidase FtsH/Yme1/Tma family protein	NA	E5ESM9	Bathycoccus_sp._RCC1105_virus	42.5	6.2e-110
WP_005013531.1|2914811_2915654_+	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	32.5	6.5e-27
WP_005013532.1|2915650_2916994_+	phosphoglucosamine mutase	NA	A0A1X9I671	Streptococcus_phage	27.1	2.7e-06
WP_005013533.1|2917178_2917994_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_005013535.1|2919738_2921811_+	polyphosphate kinase 1	NA	NA	NA	NA	NA
WP_005013537.1|2924253_2925111_+	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_005013538.1|2925138_2925915_+	phosphate ABC transporter ATP-binding protein PstB	NA	G9BWD6	Planktothrix_phage	29.7	5.6e-17
WP_005013539.1|2926742_2927252_+	DUF1993 domain-containing protein	NA	NA	NA	NA	NA
WP_005013542.1|2928329_2929100_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	2.8e-77
WP_025341421.1|2929096_2930107_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
WP_101557920.1|2930165_2931246_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.5	2.0e-44
WP_101557831.1|2931413_2932533_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.2e-55
WP_080601033.1|2932534_2933278_+	class A beta-lactamase	NA	A0A1B0VBP7	Salmonella_phage	47.2	8.0e-53
WP_005013549.1|2933282_2933654_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013550.1|2933714_2933960_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013551.1|2934066_2935566_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_005013552.1|2936187_2936523_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013553.1|2936781_2936913_+	entericidin A/B family lipoprotein	NA	NA	NA	NA	NA
WP_005013555.1|2936942_2937440_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013556.1|2937449_2937824_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013558.1|2937914_2939207_+	aspartate carbamoyltransferase	NA	Q84489	Paramecium_bursaria_Chlorella_virus	37.2	2.2e-42
WP_005013559.1|2939323_2940223_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	32.5	5.9e-42
WP_005013561.1|2940374_2940593_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100225812.1|2942926_2944306_-	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	27.3	2.0e-20
WP_005013564.1|2944421_2945117_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005013565.1|2945456_2946518_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	64.0	5.7e-113
WP_005013568.1|2948179_2950477_+	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_005011985.1|2950532_2951753_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013569.1|2952011_2952617_+	DUF2889 domain-containing protein	NA	NA	NA	NA	NA
WP_005013570.1|2952627_2953788_+	ADP-forming succinate--CoA ligase subunit beta	NA	NA	NA	NA	NA
WP_005013571.1|2953809_2954691_+	succinate--CoA ligase subunit alpha	NA	A0A2K9L1S3	Tupanvirus	31.4	1.1e-19
WP_005013572.1|2954987_2955686_+	TerC family protein	NA	W8EBD0	Pseudomonas_phage	33.8	8.9e-22
WP_005013573.1|2955827_2956550_+	TerC family protein	NA	A0A2R2YAT9	Pseudomonas_phage	43.8	8.0e-42
WP_005013576.1|2956668_2957607_+	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_005013577.1|2957637_2958417_+	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_005013578.1|2958403_2959627_+	heme biosynthesis operon protein HemX	NA	NA	NA	NA	NA
WP_005013579.1|2959631_2961179_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013580.1|2961214_2961748_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	55.5	1.8e-51
WP_005013581.1|2961991_2962687_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_005013582.1|2962701_2962833_+	entericidin A/B family lipoprotein	NA	NA	NA	NA	NA
WP_005013583.1|2962880_2964005_+	acyl-CoA/acyl-ACP dehydrogenase	NA	NA	NA	NA	NA
WP_005013585.1|2966345_2966753_-	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
WP_005013586.1|2967013_2967274_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012067.1|2967495_2968446_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 9
NZ_CP007494	Bordetella holmesii ATCC 51541, complete genome	3699674	2973937	3035395	3699674	integrase,transposase,tRNA	Leptospira_phage(18.18%)	55	2992565:2992624	3006558:3007223
WP_101557770.1|2973937_2975057_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005013596.1|2976640_2977435_+	type II secretion system F family protein	NA	NA	NA	NA	NA
WP_005013597.1|2977431_2977869_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153566127.1|2977980_2978133_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013598.1|2978553_2979522_-	homoserine kinase	NA	NA	NA	NA	NA
WP_025341429.1|2979678_2980686_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_017685693.1|2980743_2981202_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_005013601.1|2981275_2982622_-	YihY family inner membrane protein	NA	NA	NA	NA	NA
WP_005013602.1|2982639_2983011_+	DUF2069 domain-containing protein	NA	NA	NA	NA	NA
WP_025341430.1|2984625_2985360_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005013608.1|2985373_2988088_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_005013609.1|2988339_2989704_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_005013610.1|2989743_2990802_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	43.7	4.9e-80
WP_005013611.1|2990829_2991648_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_005013612.1|2991685_2991964_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
2992565:2992624	attL	TCGGCGCGATTGCCGCTGGGCGAACCACGCGCTCGGTCGCCGCGATTCGCTTACGCTTTC	NA	NA	NA	NA
WP_005013614.1|2993227_2993527_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013615.1|2994096_2995500_+	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
WP_005013616.1|2995512_2996163_+	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
WP_005011985.1|2996304_2997525_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013617.1|2997555_2998632_+	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
WP_005013618.1|2998778_2999909_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_005013619.1|3000095_3001721_+	membrane protein	NA	NA	NA	NA	NA
WP_101557807.1|3004975_3006138_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	61.3	8.3e-97
WP_101557808.1|3006179_3006557_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	S5WIU1	Leptospira_phage	53.4	4.5e-28
WP_080687433.1|3006477_3006864_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_101557809.1|3006902_3007169_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_005013625.1|3007561_3008251_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
3006558:3007223	attR	TCGGCGCGATTGCCGCTGGGCGAACCACGCGCTCGGTCGCCGCGATTCGCTTACGCTTTCGTTTTCGCACGCTTAACCCTGCCAGACTGTACAGCCGCCAGATTCGCTTGTGATTTGCTTGCCAGCCTTCGCGACGTAAGAGCACATGGATCCTCCGATAGCCGTAGCGTCGTTTCGCCACTGCCATCTCTTTCATGCGCTCGGTCAGCGCAGCATCGCCTGAGCGTGTGCTCTCGTAGGCAAACAGCGACCGCGAAATTCCTACCAGCCCACAGGCCCGGGTAACACCCATGCTGCGCTCGGTCATTAATGTCCTGACCGCCTCGCGTTTGGCCTGCGGGCTGACTACTTTCGGCTTAGCAGATCCTGAAGCGCCGCCTTGTCCAGCATCGACTCGGCCAACAGCTTCTTGAGCTTGTTGTTCTCCTGCTCCAGCTCCTTGAGCCTCTGAGCGTCCGACACCGTCATGCCACCGAACTTCGCCTTCCAGTTGTAGTACGTTGCCTCGGAGATTCCGTGCTTGCGGCACAACTCTGCGGGCTTGGCACCTGCATCGGCTTCCTTGAGCACGCCGATGATTTGCTCTTCCGTAAATCGTTTCTTCATTGCCATTCCTTTGGGAACGGACTCTACATCGATTTCGTACTAATCACGGGGAGCAGGTCA	NA	NA	NA	NA
WP_005013626.1|3008350_3008512_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017685992.1|3008662_3008827_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013627.1|3008953_3009190_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013628.1|3009379_3009628_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013629.1|3009739_3011110_+	oxygen-independent coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
WP_005013631.1|3011110_3011851_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005013632.1|3012341_3014294_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	35.9	7.1e-125
WP_076879490.1|3014314_3014863_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	29.3	3.8e-12
WP_005013635.1|3015997_3016396_+	PTS IIa component	NA	NA	NA	NA	NA
WP_005013636.1|3016458_3016728_+	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_101557921.1|3016822_3018532_+	phosphoenolpyruvate--protein phosphotransferase	NA	NA	NA	NA	NA
WP_005013638.1|3018579_3018789_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013639.1|3018835_3019258_-	OsmC family protein	NA	NA	NA	NA	NA
WP_005013640.1|3019377_3020355_+	ornithine cyclodeaminase family protein	NA	NA	NA	NA	NA
WP_005013642.1|3021754_3022642_+	ectoine/hydroxyectoine ABC transporter substrate-binding protein EhuB	NA	NA	NA	NA	NA
WP_005013643.1|3022652_3023294_+	ectoine/hydroxyectoine ABC transporter permease subunit EhuC	NA	NA	NA	NA	NA
WP_005013644.1|3023290_3023962_+	ectoine/hydroxyectoine ABC transporter permease subunit EhuD	NA	NA	NA	NA	NA
WP_025341434.1|3023961_3024732_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.8	2.0e-27
WP_005013645.1|3024782_3025232_-	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	62.8	2.3e-47
WP_005013647.1|3025273_3025732_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013648.1|3025752_3026385_-	DedA family protein	NA	NA	NA	NA	NA
WP_005013649.1|3026494_3026962_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_005013650.1|3026983_3027526_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013651.1|3027538_3028243_+	dipeptidase PepE	NA	NA	NA	NA	NA
WP_005013652.1|3028261_3028732_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_005013654.1|3030743_3031955_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	30.4	2.2e-36
WP_005013655.1|3032015_3032531_-	lipoprotein signal peptidase	NA	NA	NA	NA	NA
WP_005013656.1|3032533_3035395_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SJ93	Klosneuvirus	25.4	1.0e-71
>prophage 10
NZ_CP007494	Bordetella holmesii ATCC 51541, complete genome	3699674	3039197	3102676	3699674	integrase,holin,transposase	Leptospira_phage(33.33%)	49	3030397:3030456	3089302:3089380
3030397:3030456	attL	GCAATTCGTGCAGGCTCATCAGAAAGAAGGTCTTTTACCCCTGGGCTCTATGTCGGTGCC	NA	NA	NA	NA
WP_101557831.1|3039197_3040317_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.2e-55
WP_005013660.1|3040618_3041827_+	stearoyl-CoA desaturase	NA	NA	NA	NA	NA
WP_005013662.1|3044115_3046497_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_025341436.1|3046760_3048686_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	31.9	4.3e-66
WP_005013664.1|3048682_3049573_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_005013665.1|3049579_3050713_-	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
WP_005013666.1|3050712_3051534_-	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
WP_100225823.1|3051558_3052767_-	succinyldiaminopimelate transaminase	NA	NA	NA	NA	NA
WP_005013668.1|3053050_3053332_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013669.1|3053497_3053818_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101557814.1|3053857_3054944_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.5	2.0e-44
WP_005013671.1|3055140_3055401_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013542.1|3055893_3056664_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	2.8e-77
WP_025341421.1|3056660_3057671_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
WP_110097767.1|3057669_3058548_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	46.0	1.3e-54
WP_101557815.1|3060653_3061773_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.6	7.5e-55
WP_005012353.1|3062839_3063844_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005013675.1|3063919_3064732_+	type I phosphodiesterase/nucleotide pyrophosphatase 1	NA	NA	NA	NA	NA
WP_005013676.1|3064959_3067131_+|holin	phospholipase C, phosphocholine-specific	holin	NA	NA	NA	NA
WP_005013677.1|3067183_3068503_-	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_005011985.1|3068591_3069812_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013679.1|3070886_3072110_-	MFS transporter	NA	NA	NA	NA	NA
WP_005013681.1|3072943_3073726_-	deaminated glutathione amidase	NA	NA	NA	NA	NA
WP_005013682.1|3073751_3073970_-	SlyX family protein	NA	NA	NA	NA	NA
WP_005019379.1|3074044_3074314_+	YunC family protein	NA	NA	NA	NA	NA
WP_005013684.1|3074533_3074998_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_005013685.1|3075071_3075353_-	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_005013686.1|3075469_3076453_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_005013688.1|3076696_3077695_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_005013690.1|3078292_3079204_+	phosphoglycerate dehydrogenase	NA	M1HBE3	Paramecium_bursaria_Chlorella_virus	30.7	3.7e-20
WP_005013691.1|3079336_3081418_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_005019382.1|3081456_3082161_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_005013692.1|3082253_3083138_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_005013693.1|3083212_3083614_-	DUF2809 domain-containing protein	NA	NA	NA	NA	NA
WP_005013694.1|3083704_3083851_-	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_005013695.1|3084112_3085048_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005013696.1|3085129_3085783_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005013697.1|3086399_3086876_-	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_005013698.1|3086900_3087695_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_005013699.1|3087711_3088692_-	aliphatic sulfonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005013700.1|3088863_3089076_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153566129.1|3089194_3089368_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013701.1|3089489_3091265_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	25.4	3.5e-38
3089302:3089380	attR	GCAATTCGTGCAGGCTCATCAGAAAGAAGGTCTTTTACCCCTGGGCTCTATGTCGGTGCCGTACTAAATCTGGGGGCAG	NA	NA	NA	NA
WP_005013703.1|3092956_3095668_-	pyruvate dehydrogenase (acetyl-transferring), homodimeric type	NA	NA	NA	NA	NA
WP_005013704.1|3096213_3097968_+	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_005013705.1|3097964_3098591_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005013706.1|3098587_3099442_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.8	1.4e-29
WP_005013707.1|3099561_3101616_+	M3 family metallopeptidase	NA	NA	NA	NA	NA
WP_005012067.1|3101725_3102676_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 11
NZ_CP007494	Bordetella holmesii ATCC 51541, complete genome	3699674	3115439	3164444	3699674	transposase	Ralstonia_virus(50.0%)	38	NA	NA
WP_005011985.1|3115439_3116660_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013723.1|3116735_3117857_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005013724.1|3117894_3118608_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.1	1.7e-12
WP_005013725.1|3118618_3119839_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	4.6e-183
WP_153570014.1|3120431_3120635_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013729.1|3121530_3121692_-	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_005013730.1|3121732_3122659_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005013731.1|3122672_3123545_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005013732.1|3123707_3124655_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_026087954.1|3124993_3125575_+	PIN domain-containing protein	NA	NA	NA	NA	NA
WP_005012808.1|3126152_3127103_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013735.1|3127082_3127835_-	pyridoxal-phosphate dependent enzyme	NA	NA	NA	NA	NA
WP_005019399.1|3127847_3128579_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013738.1|3130989_3131259_-	30S ribosomal protein S15	NA	NA	NA	NA	NA
WP_005019401.1|3131347_3131554_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013740.1|3131552_3132071_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003814004.1|3132089_3132869_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_005013742.1|3133036_3134053_-	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_005013744.1|3134125_3134617_-	acetolactate synthase small subunit	NA	NA	NA	NA	NA
WP_003814007.1|3134627_3136343_-	acetolactate synthase 3 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	30.3	3.1e-60
WP_005012808.1|3137506_3138457_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003814009.1|3140108_3141350_-	MFS transporter	NA	NA	NA	NA	NA
WP_003814010.1|3141361_3142135_-	peroxide stress protein YaaA	NA	NA	NA	NA	NA
WP_005013747.1|3142161_3143112_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003814011.1|3143210_3143993_-	3-hydroxybutyrate dehydrogenase	NA	NA	NA	NA	NA
WP_003814013.1|3146033_3147419_+	alcaligin siderophore biosynthesis protein AlcA	NA	NA	NA	NA	NA
WP_005013750.1|3147437_3148043_+	alcaligin siderophore biosynthesis protein AlcB	NA	NA	NA	NA	NA
WP_005013751.1|3148039_3149896_+	alcaligin siderophore biosynthesis protein AlcC	NA	NA	NA	NA	NA
WP_005013752.1|3149892_3150693_+	alcaligin siderophore biosynthesis protein AlcD	NA	NA	NA	NA	NA
WP_005013754.1|3151966_3152941_+	alcaligin siderophore biosynthesis transcriptional regulator AlcR	NA	NA	NA	NA	NA
WP_005013756.1|3154396_3156601_+	TonB-dependent alcaligin siderophore receptor FauA	NA	NA	NA	NA	NA
WP_005013757.1|3156895_3157525_+	MarC family protein	NA	NA	NA	NA	NA
WP_025341443.1|3157532_3157739_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076879523.1|3158979_3159720_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_005013761.1|3160825_3161320_+	RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_005013762.1|3161321_3162239_+	FecR family protein	NA	NA	NA	NA	NA
WP_005013763.1|3162318_3163503_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_005013764.1|3163493_3164444_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 12
NZ_CP007494	Bordetella holmesii ATCC 51541, complete genome	3699674	3471240	3531356	3699674	protease,transposase,tRNA	Ralstonia_virus(23.08%)	55	NA	NA
WP_005014173.1|3471240_3471729_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	S4VYT2	Pandoravirus	39.1	1.3e-06
WP_005014175.1|3471721_3472570_-	haloacid dehalogenase-like hydrolase	NA	NA	NA	NA	NA
WP_005014177.1|3472660_3473158_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014180.1|3473295_3473655_-	cation:proton antiporter	NA	NA	NA	NA	NA
WP_025341464.1|3473651_3473936_-	K+/H+ antiporter subunit F	NA	NA	NA	NA	NA
WP_005014183.1|3473932_3474415_-	Na+/H+ antiporter subunit E	NA	NA	NA	NA	NA
WP_005014185.1|3474416_3476045_-	monovalent cation/H+ antiporter subunit D	NA	NA	NA	NA	NA
WP_005014186.1|3476041_3476386_-	Na+/H+ antiporter subunit C	NA	NA	NA	NA	NA
WP_005019567.1|3476387_3479330_-	monovalent cation/H+ antiporter subunit A	NA	NA	NA	NA	NA
WP_005014197.1|3479775_3480747_+	tripartite tricarboxylate transporter substrate binding protein BugE	NA	NA	NA	NA	NA
WP_005014198.1|3480736_3482119_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012650.1|3482261_3483212_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005014200.1|3483171_3484413_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_005014202.1|3484409_3485531_-	DNA repair exonuclease	NA	NA	NA	NA	NA
WP_005014203.1|3487021_3487489_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005014210.1|3487559_3488210_+	DUF502 domain-containing protein	NA	NA	NA	NA	NA
WP_005014211.1|3488296_3489436_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012353.1|3489604_3490609_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005014212.1|3490605_3491853_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_005014213.1|3492205_3493072_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.0	5.9e-23
WP_005014215.1|3493031_3494636_+	glycerol-3-phosphate dehydrogenase/oxidase	NA	NA	NA	NA	NA
WP_005014221.1|3494647_3495334_-	type 1 glutamine amidotransferase domain-containing protein	NA	NA	NA	NA	NA
WP_005014223.1|3495330_3496371_-	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005014226.1|3496486_3497158_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005014227.1|3497154_3498147_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_005014228.1|3498143_3499082_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.4	8.6e-20
WP_005014229.1|3499078_3500233_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_005014235.1|3501722_3502205_+|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_005014237.1|3502206_3503100_+	NRDE family protein	NA	Q9J5E1	Fowlpox_virus	34.8	6.5e-25
WP_005014239.1|3503096_3503540_+	carboxypeptidase regulatory-like domain-containing protein	NA	NA	NA	NA	NA
WP_005014241.1|3503552_3503927_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014242.1|3504068_3504467_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076879494.1|3504593_3504881_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_005014247.1|3504877_3505294_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_005014248.1|3505469_3506102_+	7-carboxy-7-deazaguanine synthase	NA	NA	NA	NA	NA
WP_005014253.1|3506862_3508014_+	alpha-hydroxy-acid oxidizing protein	NA	NA	NA	NA	NA
WP_005012353.1|3508127_3509132_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005014256.1|3510115_3510823_+	translesion DNA synthesis-associated protein ImuA	NA	NA	NA	NA	NA
WP_005014260.1|3512211_3515370_+	error-prone DNA polymerase	NA	M9MUV5	Rhodococcus_phage	29.0	1.2e-52
WP_005014263.1|3515382_3515904_-	DNA-deoxyinosine glycosylase	NA	NA	NA	NA	NA
WP_005014267.1|3516713_3517313_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	30.9	7.0e-07
WP_005014269.1|3517421_3519278_-	phosphoenolpyruvate carboxykinase (GTP)	NA	NA	NA	NA	NA
WP_005012353.1|3519426_3520431_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005014271.1|3520639_3521902_+	Zn-dependent hydrolase	NA	NA	NA	NA	NA
WP_005014274.1|3521906_3522242_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_005014275.1|3522238_3523168_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005014277.1|3523172_3523886_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_005014278.1|3523989_3525447_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	24.6	1.0e-11
WP_005014281.1|3525443_3525740_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014283.1|3525864_3527223_+	glutathione-disulfide reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.5	1.4e-42
WP_005014285.1|3527323_3528124_-	DUF72 domain-containing protein	NA	NA	NA	NA	NA
WP_005014286.1|3528303_3529422_+	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0B6VT43	Edwardsiella_phage	46.5	3.4e-79
WP_005014289.1|3529494_3529866_+	lipoprotein	NA	NA	NA	NA	NA
WP_005014290.1|3529872_3530724_-	hypothetical protein	NA	A0A1B1INV8	uncultured_Mediterranean_phage	28.9	4.0e-16
WP_005014292.1|3530744_3531356_-|protease	ATP-dependent protease La (LON) domain-containing protein	protease	NA	NA	NA	NA
>prophage 13
NZ_CP007494	Bordetella holmesii ATCC 51541, complete genome	3699674	3608903	3696281	3699674	integrase,protease,transposase,tRNA	Escherichia_phage(16.0%)	76	3602468:3602527	3689240:3689762
3602468:3602527	attL	ACATGGATCCTCCGATAGCCGTAGCGTCGTTTCGCCACTGCCATCTCTTTCATGCGCTCG	NA	NA	NA	NA
WP_005011985.1|3608903_3610124_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005014433.1|3615055_3615970_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005014435.1|3616119_3617085_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_005014437.1|3617092_3617509_+	4-carboxymuconolactone decarboxylase	NA	NA	NA	NA	NA
WP_005014438.1|3617505_3618423_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005014440.1|3618434_3618854_+	EthD family reductase	NA	NA	NA	NA	NA
WP_005014441.1|3618762_3620151_+	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_005019661.1|3620147_3620399_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014447.1|3621507_3621720_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005019667.1|3622538_3623672_+	Ldh family oxidoreductase	NA	NA	NA	NA	NA
WP_005014461.1|3623681_3624632_+	D-3-phosphoglycerate dehydrogenase	NA	M1HKI4	Acanthocystis_turfacea_Chlorella_virus	28.4	4.8e-18
WP_005014462.1|3624663_3625464_+	aldolase	NA	NA	NA	NA	NA
WP_080696280.1|3625421_3626270_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080696281.1|3626179_3626632_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101557807.1|3626459_3627622_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	61.3	8.3e-97
WP_005019669.1|3627734_3628703_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014478.1|3628699_3629620_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_025341469.1|3629716_3634195_-	inverse autotransporter beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_005014480.1|3634572_3638907_-	inverse autotransporter beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_005014481.1|3639545_3640109_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_005014483.1|3640120_3640366_-	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
WP_005014492.1|3640520_3641030_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_005014495.1|3641075_3642056_+	DUF4880 domain-containing protein	NA	NA	NA	NA	NA
WP_005014496.1|3642267_3644619_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_025341471.1|3644665_3645472_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_005014500.1|3645492_3646182_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.8	3.1e-35
WP_005014501.1|3646174_3647455_-	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_005014502.1|3647552_3648491_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100225795.1|3650255_3651359_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	38.7	1.3e-06
WP_005014509.1|3651411_3652161_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_005014511.1|3652167_3653682_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.9	8.8e-83
WP_005014514.1|3654001_3654889_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_005014516.1|3655039_3655546_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_005014518.1|3655542_3656499_+	FecR family protein	NA	NA	NA	NA	NA
WP_005019683.1|3656685_3658032_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_152545255.1|3657999_3658383_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	53.3	1.7e-19
WP_153569218.1|3658234_3658822_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_005013542.1|3658976_3659747_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	2.8e-77
WP_025341421.1|3659743_3660754_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
WP_005014534.1|3661570_3661765_-	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_005014536.1|3661766_3662108_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_005014539.1|3662117_3663980_-	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	38.7	1.4e-98
WP_005014543.1|3664019_3664526_-	Fe-S protein assembly co-chaperone HscB	NA	NA	NA	NA	NA
WP_005014544.1|3664529_3664853_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	54.2	6.8e-25
WP_005014545.1|3664854_3665259_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	79.8	1.9e-53
WP_005014546.1|3665295_3666507_-	IscS subfamily cysteine desulfurase	NA	NA	NA	NA	NA
WP_005014547.1|3666528_3667077_-	Fe-S cluster assembly transcriptional regulator IscR	NA	NA	NA	NA	NA
WP_005014551.1|3667301_3667793_-	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_017685984.1|3668007_3670038_-	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_005014553.1|3670112_3671315_+	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_005014556.1|3673825_3674107_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014560.1|3674193_3674367_+	OsmC family protein	NA	NA	NA	NA	NA
WP_005014564.1|3674478_3674823_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_005014566.1|3674894_3675563_+	anti-ECF sigma factor ChrR	NA	NA	NA	NA	NA
WP_005014572.1|3676978_3678022_+	alcohol dehydrogenase catalytic domain-containing protein	NA	A0A2K9L339	Tupanvirus	29.2	1.4e-31
WP_076879527.1|3678018_3678120_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_101557770.1|3678211_3679331_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005014574.1|3679581_3680235_+	transcriptional repressor LexA	NA	A0A2H4JG58	uncultured_Caudovirales_phage	50.7	1.9e-10
WP_005011985.1|3680350_3681571_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005014581.1|3681621_3684051_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	51.4	3.6e-219
WP_005014587.1|3684216_3685515_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	54.3	3.1e-129
WP_005014590.1|3686274_3687585_-	trigger factor	NA	NA	NA	NA	NA
WP_005014595.1|3687812_3688352_+	TIGR00645 family protein	NA	K4K6D8	Caulobacter_phage	35.8	4.3e-24
WP_101557809.1|3688830_3689097_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_135238891.1|3689135_3689501_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025341473.1|3689382_3690393_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
3689240:3689762	attR	CGAGCGCATGAAAGAGATGGCAGTGGCGAAACGACGCTACGGCTATCGGAGGATCCATGTCAGCGCCGATGTAATACTGACCCACCGCGTCGGAGTAAATCTGACCCACCTGGGCGATGATGGCGGCCTTTTGGCCGCCGACAATGTTGACTCAGGAGCAAGCAGTGGAGATCAAGGTAATGGCGCGTCGCGGCGTCAGCATTCGGGAGATGGCCAAGCAGCTGGGCTGCTCACGCAACACGATCAGGCGGTATCTGCGTGAGGCTGGTGCCCAGCAGTACAAGCCCCGCGAGGCACGGACCACCAAGCTGGATCCGTACAAGGACTATCTGCACGGGCGCATCGAGGCGGCCCGGCCGCACTGGATTCCAGCAGCCGTGCTGCTGCGGGAGATTCAAGAACTGGGCTACCCCGGTGGTGTAACGCAGCTCAAGGAGTTTCTTAGCGGCTACAAGCACCAGGAGCCTGAACCGGTCGTTCGTTTTGAGACGCCGCCTGGCAAGCAGATGCAGGCCGACTTCAC	NA	NA	NA	NA
WP_005013542.1|3690389_3691160_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	2.8e-77
WP_076879496.1|3691239_3691905_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	46.1	2.1e-49
WP_005014598.1|3691872_3692364_-	DUF924 family protein	NA	NA	NA	NA	NA
WP_005014599.1|3692473_3692677_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	66.7	6.6e-18
WP_005014600.1|3692994_3693315_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014605.1|3693298_3693634_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014607.1|3693688_3693901_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014610.1|3693976_3694315_+	IS66 family insertion sequence hypothetical protein	NA	A0A218MNG9	uncultured_virus	50.0	3.7e-05
WP_100225806.1|3694281_3694647_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_005014618.1|3694709_3696281_+|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	47.5	2.0e-125
